Elizabeth Karn Marie Jasieniuk. Abstract 1 INTRODUCTION ORIGINAL ARTICLE

Transcription

1 Received: 19 Septembe 2016 Accepted: 5 Mach 2017 DOI: /eva ORIGINAL ARTICLE Genetic divesity and stuctue of Lolium peenne ssp. multifloum in Califonia vineyads and ochads indicate potential fo spead of hebicide esistance via gene flow Elizabeth Kan Maie Jasieniuk Univesity of Califonia Davis, Depatment of Plant Sciences, Davis, CA, USA Coespondence Elizabeth Kan, Univesity of Califonia Davis, Depatment of Plant Sciences, Davis, CA, USA. evkan@ucdavis.edu Funding infomation USDA-NIFA-AFRI, Awad Numbe: Abstact Management of agoecosystems with hebicides imposes stong selection pessues on weedy plants leading to the evolution of esistance against those hebicides. Resistance to glyphosate in populations of Lolium peenne L. ssp. multifloum is inceasingly common in Califonia, USA, causing economic losses and the loss of effective management tools. To gain insights into the ecent evolution of glyphosate esistance in L. peenne in peennial copping systems of nothwest Califonia and to infom management, we investigated the fequency of glyphosate esistance and the genetic divesity and stuctue of 14 populations. The sampled populations contained fequencies of esistant plants anging fom 10% to 89%. Analyses of neutal genetic vaiation using micosatellite makes indicated vey high genetic divesity within all populations egadless of esistance fequency. Genetic vaiation was distibuted pedominantly among individuals within populations athe than among populations o sampled counties, as would be expected fo a wide- anging outcossing weed species. Bayesian clusteing analysis povided evidence of population stuctuing with extensive admixtue between two genetic clustes o gene pools. High genetic divesity and admixtue, and low diffeentiation between populations, stongly suggest the potential fo spead of esistance though gene flow and the need fo management that limits seed and pollen dispesal in L. peenne. KEYWORDS agicultual weed, glyphosate, glyphosate esistance, hebicide, Italian yegass, Lolium peenne ssp. multifloum, micosatellite makes 1 INTRODUCTION Weedy plants pose a majo poblem to agicultual poduction causing significant cop losses woldwide and economic damages estimated to total $33 billion annually in the United States (Oeke, 2006; Pimentel, Zuniga, & Moison, 2005). Weeds ae an ongoing challenge fo fames as weed contol pactices exet stong selection fo the evolution of weed adaptations that ende the management pactices less effective ove time (Baett, 1983; Owen, Michael, Renton, Steadman, & Powles, 2011; Powles & Yu, 2010). One of the best examples of this pocess is the evolution of esistance to hebicides. In weed populations containing phenotypic vaiation fo susceptibility to an hebicide, those individuals with an inheited ability to suvive and epoduce following an hebicide application ae favoed and esistance inceases in the population ove time (Delye, Jasieniuk, & Le Coe, 2013; Neve, Vila- Aiub, & Roux, 2009). To date, ove 470 cases of esistance in 250 This is an open access aticle unde the tems of the Ceative Commons Attibution License, which pemits use, distibution and epoduction in any medium, povided the oiginal wok is popely cited The Authos. Evolutionay Applications published by John Wiley & Sons Ltd 616 wileyonlinelibay.com/jounal/eva Evolutionay Applications. 2017;10:

2 617 species have been documented to a wide vaiety of hebicides woldwide (Heap, 2016). Whethe o not a weed population is able to adapt in esponse to management pactices depends on whethe that population contains the necessay genetic vaiation (Jasieniuk, Bule- Babel, & Moison, 1996; Sakai et al., 2001). Population size, standing genetic vaiation, selection, and gene flow with othe populations all play a ole in the spatial distibution of evolved adaptive taits (Delye, Jasieniuk, et al., 2013; Lawton- Rauh, 2008). Fo studies of adaptation in agicultual weeds, stong selection pessues on weed populations such as tillage o hebicide application ae usually known and population sizes ae often lage (Neve et al., 2009). Population sizes of common weeds vay acoss an agicultual landscape with some aeas containing heavy infestations, allowing fo high genetic divesity within a species acoss a egion though the accumulation of mutations ove time. In self- pollinating weeds, populations may be genetically unifom as individuals within populations often shae nealy identical highly homozygous genotypes because of epeated inbeeding, but populations ae likely to diffe genetically (Wad & Jasieniuk, 2009). In contast, obligately outcossing weeds ae expected to contain high genetic divesity within populations but low genetic diffeentiation among populations. The amount and distibution of phenotypic and genetic vaiation within weed populations influence the potential fo adaptation in agicultual landscapes, which ae vaiable in both space and time as a esult of habitat fagmentation due to divese cops and associated cop and weed management pactices. Ultimately, the adaptation of weed populations to a vaiable envionment acoss an agicultual landscape may lead to population stuctuing in both selfing and outcossing weeds. Genetic divesity in weed populations is equied fo weed adaptation, but is also impacted by it as a esult of stong positive selection and population bottlenecks (Neve et al., 2009). Successful hebicide applications kill 95% 99% of individuals in susceptible weed populations. This substantial eduction in population size may mean that the alleles of only a small faction of individuals ae passed on to the next geneation, potentially causing some alleles to be lost by genetic dift. Altenatively, stong selection will favo selectively advantageous alleles, if pesent in the population, and educe population genetic divesity. Fo instance, individuals which suvive hebicide teatment due to heitable mechanisms will pass on thei esistance- confeing alleles to thei pogeny, and esistance will incease in fequency in the population ove time. As the fequency of esistant individuals inceases in a population, futhe hebicide applications will become less effective in educing population size, leading to estoation of populations to thei oiginal size but with deceased genetic divesity. Stong selection fo esistance may also be associated with a selective sweep at causative loci which not only esults in the loss of susceptible alleles at the adaptive locus but also any alleles at loci in gametic disequilibium with it (Maynad- Smith & Haig, 1974; Menchai, Delye, & Le Coe, 2007). In summay, weed populations with a high fequency of esistant individuals ae expected to contain lowe genetic divesity than populations with a low fequency of esistant individuals both due to population bottlenecks while an hebicide is still effective in contolling the weed and due to selection as esistance to the hebicide evolves. Lolium peenne ssp. multifloum (Italian yegass) is an annual gass weed that causes economic losses in annual and peennial copping systems woldwide (Peston, Wakelin, Dolman, Bostamam, & Boutsalis, 2009). L. peenne has an obligately outcossing, self- incompatible mating system with wind- mediated pollen movement (Feaon, Haywad, & Lawence, 1983). Populations of L. peenne ssp. multifloum and the closely elated L. peenne ssp. igidum have epeatedly evolved esistance to seveal hebicides fom diffeent classes (Heap, 2016; Owen, Matinez, & Powles, 2014; Peston et al., 2009). The ability of L. peenne to apidly evolve esistance to hebicides has been attibuted to high genetic divesity within populations esulting fom lage population sizes and a self- incompatible outcossing mating system (Balfouie, Chamet, & Ravel, 1998; Busi & Powles, 2009). Howeve, while the genetic divesity of cultivated and wild accessions of L. peenne have been easonably well chaacteized (e.g., Bazauskas, Lenk, Pedesen, Stende, & Lübbestedt, 2011; Kubik, Sawkins, Meye, & Gaut, 2001; McGath, Hodkinson, & Bath, 2007; Wang, Dobowolski, Cogan, Foste, & Smith, 2009), the genetic vaiation and stuctue of weedy populations in agicultual settings (cop fields, ochads, vineyads) have not been examined, to ou knowledge, despite the unique demogaphic pocesses and selective pessues in agicultual systems that ae likely to shape genetic divesity in weeds. To date, studies of weedy L. peenne have lagely focused on chaacteizing hebicide esistance phenotypes and esistance levels (e.g., Jasieniuk et al., 2008; Busi & Powles, 2009, Busi, Neve, & Powles, 2013; Liu, Hulting, & Malloy- Smith, 2016) and detemining the undelying physiological and genetic mechanisms of esistance (e.g., Avila- Gacia, Sanchez- Olguin, Hulting, & Malloy- Smith, 2012; Gaines et al., 2014; Ge et al., 2012; Mahmood, Mathiessen, Kistensen, & Kudsk, 2016; Yu, Abdallah, Han, Owen, & Powles, 2009). In Califonia, a population of L. peenne was identified with esistance to glyphosate in 1998 (Simamata, Kaufmann, & Penne, 2003), and glyphosate esistance was late found to have spead in peennial copping systems of the Cental Valley of Califonia (Jasieniuk et al., 2008). In 2013, populations of L. peenne suspected of containing individuals esistant to glyphosate wee identified in Sonoma County and Lake County in nothwesten Califonia, outside of the Cental Valley, afte 2 yeas of failed contol with glyphosate. It has been hypothesized that gene flow may spead hebicide esistance among weed populations within an agicultual landscape to a geate degee than novel mutations as ates of gene flow ae geneally believed to be highe than ates of mutation (Jasieniuk et al., 1996). Hebicide esistance alleles may be pesent in populations pio to the onset of selection pessue by an hebicide (Delye, Deulvot, et al., 2013), and may spead by gene flow even befoe the tait is selectively advantageous. Evidence fo the spead of hebicide esistance among populations by seed dispesal has been shown in seveal highly selfpollinating weed species, based on pattens of molecula make and phenotypic vaiation (Okada et al., 2013, 2014; Osuna, Okada, Ahmad, Fische, & Jasieniuk, 2011). Inteestingly, howeve, neutal genetic and phenotypic vaiation in Ipomoea pupuea, a weed species with a mixed mating system, povided suppot fo independent oigins of esistance

3 618 in multiple geogaphic locations (Kueste, Chang, & Baucom, 2015). In outcossing weeds, analyses of neutal genetic vaiation evealed low population diffeentiation, and possible spead of esistance though local gene flow (Delye, Clement, Penin, Chauvel, & Le Coe, 2010) but independent oigins though novel mutations (Menchai et al., 2007). The goal of the cuent study was to chaacteize genetic vaiation of nothwesten Califonia L. peenne populations whee hebicide esistance evolution is vey ecent and likely ongoing. We examined the fequency of glyphosate- esistant plants in populations acoss the landscape along with micosatellite make vaiation to addess the following questions: (i) do populations of outcossing weeds contain high genetic divesity and is this divesity educed in populations with a high fequency of glyphosate- esistant individuals, (ii) is thee evidence of genetic stuctuing and diffeentiation among populations of this widespead weed acoss an agicultual landscape, and (iii) is thee potential fo spead of esistance alleles acoss the landscape though gene flow? 2 MATERIALS AND METHODS 2.1 Population sampling To detemine whethe glyphosate- esistant individuals ae pesent in L. peenne ssp. multifloum populations in nothwest Califonia, we sampled 13 ochads and vineyads in 2013 fom Sonoma County and Lake County (Table 1) in the geneal egions whee gowes had epoted difficulty contolling plants with glyphosate to fam advisos and in suounding aeas whee populations may be expeiencing gene flow with esistant plants. One population identified as esistant to glyphosate fom Butte County was also sampled to seve as a compaison with an aea which had evolved esistance geate than 10 yeas ago (Jasieniuk et al., 2008; Simamata et al., 2003). Within each population, young leaf tissue and panicles with matue seed wee collected fom each of individuals at least one mete apat fom one anothe while walking andomly selected tee o vine ows. Leaf tissue was tanspoted to the laboatoy fo DNA extaction. Seed panicles wee stoed in pape envelopes fo 3 months to allow seeds to afte- ipen and ovecome domancy befoe planting and testing plants fo esistance to glyphosate. 2.2 Phenotyping plant esponse to glyphosate Eight seeds fom each sampled plant wee geminated on moistened filte pape in peti dishes at 20 C and a 12- h photopeiod. Geminated seedlings wee tansplanted into 8 8 cm squae pots filled with UC soil mix (sand, compost, and peat in 1:1:1 atio with 1.8 kg/m 3 dolomite) with two seedlings pe pot and gown in the glasshouse at 27/15 C with ambient light conditions. At the tilleing stage, individual plants wee divided into genetically identical clones following the method descibed by Boutsalis (2001) and gown in the glasshouse to the 2 3 leaf stage. One clone of a genotype was teated with wate, which seved as a contol. The second clone was teated with glyphosate (Roundup PoweMax, Monsanto, St. Louis, MO) at the ate of acid equivalent 1,681 g/ha, which is twice the ecommended (label) field ate fo the contol of annual Lolium peenne plants unde six inches tall. All teatments wee applied in an enclosed cabinet tack spaye equipped with an 8002E nozzle (TeeJet, Spaying Systems Co., Wheaton, IL) deliveing 200 L/ha. Thee weeks afte glyphosate teatment, we scoed each plant as alive o dead and chaacteized the pecentage of esistant plants in each population by the pecentage of plants suviving glyphosate teatment of the total numbe of plants teated. Plants fom a peviously chaacteized susceptible efeence seed collection (Jasieniuk et al., 2008) wee included duing each hebicide application to confim hebicide activity. TABLE 1 Lolium peenne ssp. multifloum populations sampled fo this study Pop ID Copping system County Latitude (N) Longitude (W) N S N G N P %R 1 Ochad Butte Vineyad Sonoma Vineyad Sonoma Vineyad Sonoma Vineyad Sonoma Vineyad Sonoma Vineyad Sonoma Vineyad Sonoma Vineyad Sonoma Vineyad Sonoma Vineyad Lake Ochad Lake Ochad Lake Ochad Lake N S, numbe of individuals sampled fo leaf tissue and seeds fom each population; N G, numbe of individuals genotyped; N P, numbe of pogeny phenotyped fo esponse to glyphosate; % R, pecentage of individuals suviving teatment with glyphosate at 1681 g a.e. ha 1.

4 Genotyping plants using micosatellite makes DNA was extacted fom collected leaf tissue following the CTAB method (Doyle & Doyle, 1987), then quantified, and diluted to 25 ng/ μl. We genotyped individuals at 12 polymophic loci using 11 micosatellite pime pais (Table 2), which included b1b1, b1b3, b3b1, b3b8, b3c5, b1a8, b4d3, b5d12 (Lauvegeat, Bae, Bonnet, & Ghesquiee, 2005), p3 (Kubik et al., 2001), and 14C9, 44A7 (King et al., 2008). Pime pai 14C9 amplified two loci, called 14C9-1 and 14C9-2. Two sets of alleles, with one o two alleles in each of the two egions amplified by this pime pai, wee obseved in all individuals genotyped at these loci. Fo all pime pais, fowad pimes labeled with eithe 6- Fam o Hex (Integated DNA Technologies, Coalville, IA) wee used in PCRs consisting of 25 ng DNA template, 1 Qiagen PCR buffe (Valencia, CA), 0.25 mm additional MgCl 2, 0.4 μm fowad and evese pimes, mm DNTPs, and 0.5 units Taq polymease. The PCR pogam consisted of an initial denatuing peiod of 3 min at 94 C, followed by 30 cycles of 1 min at 94 C, 1 min at x C, 2 min at 72 C, and a final extension of 10 min at 72 C, whee x is a pime- dependent annealing tempeatue (Table 2). PCR poducts wee multiplexed into six pais of PCR poduct and sepaated using an ABI 3100 Genetic Analyze (Applied Biosystems, Foste City, CA) with GENESCAN 400HD as an intenal size standad (Applied Biosystems). Fagments wee sized with GeneMappe 3.7 (Applied Biosystems). Genotypes wee also inspected manually. 2.4 Micosatellite make eo ate To assess genotyping eos, we tested fo null alleles o genotyping stutte using Micochecke vesion (Van Oostehout, Hutchinson, Wills, & Shipley, 2004). Because null alleles wee detected fo seveal loci, FeeNa softwae (Chapuis & Estoup, 2007) was used to estimate the fequency of null alleles and thei effect on F ST estimates using the standad F ST estimation method and the unbiased adjusted excluding null alleles F ST (ENA) method with 1,000 bootstap eplicates. We tested standad and adjusted F ST values fo diffeences using Student s t- test. 2.5 Genetic divesity and stuctue To estimate the allelic divesity of each locus, we calculated the total numbe of alleles detected at each locus (N A ) using F STAT softwae TABLE 2 Chaacteistics and souces of 12 micosatellite loci used to genotype Lolium peenne ssp. multifloum. Micosatellite makes wee selected based on polymophism and consistent amplification of alleles Make Fowad and Revese Pimes Ta Repeat Motif Souce b1b1 f CAGGTCCAGCGCTAGTGTTA 57 (CT)4(CA)2N Lauvegeat et al. GAGGTGTGGTGCTGGGATAG 136(AC)7 b1b3 f AGGTGTCCTGTTGCTTTGGA 57 (TG)7 Lauvegeat et al. TTTACCCCCAGGGATCAAAT b3b1 f TTTCCCTGGGATAGCGTTAG 57 (TG)10 Lauvegeat et al. TTAGCATAAACAGATGAAGCATAAC b3b8 f TGTCATGTCCGCTGTCTACG 57 (CA)10 Lauvegeat et al. GAGAGTGGGCGATCATCTTC b3c5 f TGTCATGTTCAGAAAGTGCG 55 (GT)8 Lauvegeat et al. TGTCCACATAAATGCACCTCA b1a8 f GACTTTCAGGCATCGGTCAT 57 (TG)7 Lauvegeat et al. CCCAGCTCCATTCTTAATGC b4d3 f ATTGATGGTGCCACTCCTCT 53 (CA)7 Lauvegeat et al. ATGGACAAAGCAGGGGTTC b5d12 f GAATCCTCGATGTGGGCTAC 53 (GT)5 Lauvegeat et al. TAAAACGGAACCACCCATTC p3 f GTATAGTACCCATTCCGT 53 (CA)22 Kubik et al. (2001) GCCGCCCTGCCATGCTG 14C9-1 f AATGATGGCACGGAGCAATCG 50 (CT)22 King et al. (2008) CTGTAATTCCAGGTCACTACC 14C9-2 f AATGATGGCACGGAGCAATCG 50 CT King et al. (2008) CTGTAATTCCAGGTCACTACC 44A7 f CACGTAGAAGCCACACTTTAC 50 (CT)60 King et al. (2008) GTCACATTCCATTCACTTCCG Ta, annealing tempeatue. Pime pai 14C9 amplified two independent micosatellite loci (see Results section).

5 620 vesion (Goudet, 1995). Wight s inbeeding coefficient (F IS ) was estimated fo each of the 14 populations and aveaged ove populations fo each locus, and Wight s fixation index (F ST ) was calculated ove the 14 populations by locus, also in F STAT. Statistical significances of F IS and F ST wee detemined with 1,000 pemutations. Obseved heteozygosity (H O ) and total gene divesity o expected heteozygosity (H E ) at each locus wee calculated using Genepop on the Web softwae vesion 4.2 (option 5, suboption 1; Raymond & Rousset, 1995; Rousset, 2008). To estimate genetic divesity within each population acoss all 12 loci, we calculated the aveage numbe of alleles detected pe locus (N A ), mean allelic ichness (A R ) defined as the numbe of alleles aified to the smallest population sample size, and Wight s inbeeding coefficient (F IS ) in F STAT. Statistical significance of F IS was detemined with 1,000 pemutations. We also calculated H O and H E fo each population in Genepop on the Web (option 5, suboption 1). We did not estimate population diffeentiation based on the statistic R ST because stepwise mutations at micosatellite loci likely contibute elatively little to genetic diffeentiation between ecently founded populations, such as those of weedy Lolium peenne (Kalinowski, 2002). Depatues fom Hady Weinbeg popotions pe locus and pe population wee tested using the Hady Weinbeg exact test with default Makov chain paametes in Genepop on the Web (option 1, suboption 3). To test fo linkage disequilibium between each pai of loci in each population, we pefomed a paiwise log likelihood atio test fo disequilibium in Genepop on the Web (option 2, suboption 1) with default Makov chain paametes. To detect ecent changes in effective population sizes o population bottlenecks, we pefomed a one- tailed Wilcoxon sign- ank test fo heteozygote excess compaed to that expected unde a dift mutation model using Bottleneck softwae vesion (Conuet & Luikat, 1997; Piy, Luikat, & Conuet, 1999). A sequential Bonfeoni coection was applied to adjust significance levels fo multiple compaisons (Rice, 1989). To investigate the spatial stuctuing of genetic vaiation among populations and counties, we pefomed multiple distance- based analyses using GenAlEx 6.5 (Peakall & Smouse, 2006, 2012). Fist, we calculated a matix of genetic distances, based on Nei s D (Nei, 1978), between each pai of populations with GenAlEx softwae intepolating fo missing data, and then used the paiwise genetic distances in the following analyses. We pefomed a pincipal coodinate analysis (PCA) using the standadized covaiance method in GenAlEx to assess whethe populations located within the same county and/ o geogaphically nea each othe wee also genetically simila and thus may shae an evolutionay histoy. To test fo isolation by distance (IBD) and detemine whethe genetic stuctuing coelates with geogaphic stuctuing between populations, we conducted a Mantel test (Mantel, 1967) in GenAlEx with 1,000 pemutations between the matix of paiwise genetic distances descibed above and a matix of paiwise geogaphic distances calculated using the GPS coodinates (latitude and longitude) of each population. We also pefomed a hieachical analysis of molecula vaiance (AMOVA; Excoffie, Smouse, & Quatto, 1992) in GenAlEx, which examined the distibution of genetic vaiation at five hieachical levels: among counties within the total sample, among populations within those counties, among populations in the total sample, among individuals within populations, and among individuals within the total sample. The AMOVA was pefomed with 1,000 pemutations. To assess population stuctue and detemine the degee of admixtue among populations, we used a model- based Bayesian clusteing algoithm in STRUCTURE softwae vesion (Pitchad, Stephens, & Donnelly, 2000). STRUCTURE infes genetic clustes o populations based on the multilocus genotypes of all individuals, independent of sampled location, by pobabilistically assigning individuals to a cluste o jointly to multiple clustes if thei genotypes indicate admixtue between clustes, while simultaneously maximizing Hady Weinbeg equilibium and minimizing linkage disequilibium within those clustes. STRUCTURE analysis was pefomed with a bun- in peiod of 1,000,000 iteations followed by 1,000,000 iteations fo the numbe of genetic clustes (K) anging fom K = 1 to K = 12. Five independent uns at each value of K wee pefomed using the population admixtue model fo potentially intebeeding populations and coelated allele fequencies. Likelihood values of ln P(D) wee assessed fo each un. The most likely value of K was infeed using the ΔK method (Evanno, Regnaut, & Goudet, 2005) in STRUCTURE Haveste online (Eal & von Holdt, 2012). Each individual s pobability of assignment to each cluste (q), also intepeted as the popotion of an individual s genome that oiginated in each cluste (Pitchad et al., 2000), was visualized fo all individuals using Distuct softwae vesion 1.1 (Rosenbeg, 2004). To examine substuctuing within genetic clustes, the multilocus genotypes of individuals with q > 0.6 to a cluste wee analyzed independently, as suggested by Evanno et al., using the same paametes as above. 3 RESULTS 3.1 Plant esponse to glyphosate Within sampled populations of L. peenne ssp. multifloum, esistance to glyphosate, estimated as the pecentage of individuals suviving glyphosate teatment pe population, vaied fom 9.7% to 89.0% (Figue 1, Table 1). The Butte County population sampled fom the aea whee glyphosate esistance was fist epoted in Califonia (Simamata et al., 2003) contained 73.8% esistant individuals. In Lake County, thee populations (populations 12, 13, and 14) fom an aea whee gowes epoted possible esistance contained 85% 89% esistant individuals, while a population (population 15) bodeing the aea contained 21% esistant individuals. In Sonoma County, populations show a gadient of suvivoship anging fom 9.7% suvivoship in the southen end to 40.6% in the nothen end of the county (Table 1). 3.2 Genetic divesity and stuctue Genetic divesity of micosatellite loci Infomation on null alleles fo each locus can be found in the Data S1 section. We detected 259 distinct alleles in 412 individuals of L.

6 km R S FIGURE 1 Geogaphic distibution of the populations sampled fo this study in nothwest Califonia. Cicles indicate the popotion of glyphosate- esistant (black) and glyphosate- susceptible (gay) individuals in each population, based on glasshouse sceening of plants gown fom field- collected seeds. Numbes ae the population IDs (see Table 1) TABLE 3 Genetic divesity detected at 12 micosatellite loci in 412 individuals of Lolium peenne spp. multifloum Make N A Allele sizes (bp) % missing H E H O F IS F ST b1b % ** 0.049* b1b % ** 0.034* b3b % ** b3b % ** 0.020* b3c % ** 0.088* b1a % ** b4d % ** b5d % * 0.051* p % ** C % ** C % ** A % ** 0.015* N A, total numbe of alleles detected; allele sizes, ange of PCR poduct sizes (bp); % missing, % missing data at each locus; H E, expected heteozygosity; H O, obseved heteozygosity; F IS, Wight s inbeeding coefficient; F ST, Wight s fixation index wee aveaged ove 14 populations sampled in Califonia. p values: *p <.01, **p <.001.

7 622 peenne ssp. multifloum acoss 12 micosatellite loci. The total numbe of alleles detected pe locus anged fom 8 to 56 (Table 3), and all loci wee polymophic in each population. Obseved heteozygosity (H O ) anged fom to 0.754, while expected heteozygosity (H E ) vaied fom to All loci evealed a eduction in obseved heteozygosity compaed to expected heteozygosity. Coespondingly, values of the inbeeding coefficient, F IS, wee statistically significant fo all loci and anged fom to Because a eduction in heteozygosity compaed to that expected unde Hady Weinbeg conditions was obseved acoss all loci egadless of whethe null alleles wee detected, it is unlikely that null alleles ae the majo cause of heteozygosity deficits. Pe locus estimates of F ST anged fom to 0.088, indicating little genetic diffeentiation among populations at each locus (Table 3). Among 923 paiwise compaisons of loci and populations, linkage disequilibium was detected in only eight locus- by- population test combinations following Bonfeoni coection (Table S2). Linkage disequilibium was neve detected between the same pai of loci twice, consistent with independently segegating loci. One micosatellite pime pai, 14C9, was found to amplify two sepaate loci (14C9-1 and 14C9-2) with nonovelapping allele sizes (Table 2, Table 3). Both loci wee scoed and teated as sepaate micosatellite loci in data analyses. At locus 44A7, 56 alleles wee identified anging in size fom 131 to 278 base pais (Table 3). Despite the lage ange of allele sizes, no division of alleles into sepaate size classes that might indicate amplification of multiple loci was detected, and all individuals contained eithe one o two alleles as expected fo diploids genotyped at a single micosatellite locus Genetic divesity of populations Within populations, the aveage numbe of alleles detected pe locus (N A ) was high anging fom 8.7 to Coespondingly, allelic ichness (A R ) anged fom 7.7 to 9.2 with an aveage of 8.4 ove all populations (Table 4). Expected heteozygosity (H E ) anged fom 0.74 to 0.81 among populations, wheeas obseved heteozygosity (H O ) anged fom 0.40 to 0.52, indicating a heteozygote deficiency elative to Hady Weinbeg expectations in all populations. Accodingly, values of the inbeeding coefficient F IS fo populations wee high anging fom to (Table 4). Population bottlenecks as indicated by heteozygote excess elative to expectations unde a dift mutation model wee detected in seven populations (Table 4). Thee populations (1, 12, and 14) containing a high fequency of esistant individuals (% R > 70%) all show a lowe than aveage allelic ichness (A R = 7.7, 8.1, and 7.7, espectively) (Table 4), which might indicate that populations with a high fequency of esistant individuals have lowe genetic divesity. Bottlenecks wee detected in these thee populations (Table 4). Howeve, the population (population 13) containing the highest fequency of glyphosate- esistant individuals (89% R) (Table 1) also had the highest numbe of alleles detected pe locus (N A = 12.1) and the highest allelic ichness (A R = 9.2), and no bottleneck was detected. Coespondingly, thee is no significant coelation between fequency of esistant plants within populations and allelic ichness (Speaman s ank coefficient ρ = 0.22, p =.449). If population 13 is emoved fom the analysis, the coelation is stonge but still not significant (Speaman s ank coefficient ρ = 0.525, p =.065). 3.3 Population stuctue A pincipal coodinate analysis (PCA) of genetic distances between populations evealed diffeentiation among populations with gouping of some populations by geogaphic oigin (Figue 2). Most populations fom the southen end of Sonoma County (2, 3, and 4) goup tightly togethe, while populations fom the cental and nothen pats of Sonoma County (6, 8, 9, 10, and 11) along with population 13 fom Pop ID N G N A A R H E H O F IS B ** * ** ** ** ** * ** ** * ** * ** * ** ** * ** ** * ** TABLE 4 Genetic divesity within populations of L. peenne ssp. multifloum based on vaiation at 12 micosatellite loci N G, numbe of individuals genotyped; N A, aveage numbe of alleles detected pe locus; A R, mean allelic ichness; H E, expected heteozygosity; H O, obseved heteozygosity; F IS, Wight s inbeeding coefficient, and B, the p value of Wilcoxon sign- ank test fo genetic bottleneck. p values: *p <.05 following Bonfeoni coection. **p <.001.

8 623 Cood Pincipal coodinates (PCA) Cood. 1 FIGURE 2 Pincipal coodinate analysis (PCoA) of paiwise genetic distances between populations. The fist two axes explain 32.2% and 19.1% of genetic vaiation Lake County goup togethe. Populations located in Lake County (12, 13, 14, and 15) ae moe genetically distant fom each othe and do not goup tightly togethe. The pecentage of vaiation explained by the fist two axes ae 32.2% and 19.1%. A Mantel test evealed a weak, nonsignificant coelation between genetic and geogaphic distances (slope = , R 2 = 0.14, p =.468), indicating that the genetic diffeentiation obseved among populations is not elated solely to geogaphic isolation. As population clusteing by county was not explained by geogaphic distance, an AMOVA was conducted to detemine how much of the genetic vaiance could be attibuted to county o population diffeences. The AMOVA evealed low, but significant, genetic diffeentiation among counties (F RT = 0.018, p =.001), among populations within counties (F SR = 0.018, p =.001), and among populations within the total sample (F ST = 0.036, p =.001) (Table 5). Genetic diffeences among individuals within populations (F IS = 0.466, p =.001) and among individuals within the total sample (F IT = 0.485, p =.001) ae high. Because of lage genetic diffeences among individuals, 45.6% of the genetic vaiation is distibuted among individuals within populations and 47.4% among individuals in the total sample, with 1.8% of genetic vaiation distibuted between counties, 1.8% among populations within counties, and 3.5% among populations in the total sample, based on the F- statistic fo the coesponding measue. STRUCTURE analysis (Pitchad et al., 2000) was used to futhe examine genetic stuctuing. STRUCTURE evealed inceasing values of ln P(D) with inceasing K values anging fom 1 to 12 with no clea maximum likelihood (Figue 3a). ΔK (Evanno et al., 2005) clealy showed the highest value at K = 2, indicating two genetic clustes (Figue 3b). The popotion of the genome, as epesented by the 12 micosatellite loci, that assigns to each cluste, q, was calculated fo each individual. Individuals assigning to cluste 1 with q > 0.7 wee compised of some individuals fom Sonoma County and Butte County and a few individuals fom Lake County, while most individuals fom Lake County and some fom Sonoma County and Butte County assigned to cluste 2 (Figue 4a). While individuals fom Sonoma County and Butte County assigned to both genetic clustes, individuals fom Lake County assigned highly to cluste 2. All populations contained some individuals that assigned patially to each cluste (q < 0.6) indicating admixtue between genetic clustes (Figue 4a). Thee is no appaent patten of genetic stuctuing based on whethe the individuals oiginated fom field populations that wee pedominantly esistant o susceptible to glyphosate (Table 1). The majoity of individuals fom populations 12, 13, and 14, whee the fequency of glyphosate esistance was 85% 89%, assigned to cluste 2 with q > 0.7, but most individuals fom population 15 whee esistance fequency was 21% also assigned to the same cluste. Of the individuals fom population 1 genotyped, 48% and 52% assigned to clustes 1 and 2, espectively, but 77% of individuals phenotyped wee esistant to glyphosate, indicating that glyphosate- esistant individuals likely assign to both clustes. To examine pattens of hieachical population stuctue, individuals assigning to each cluste with q > 0.6 wee sepaated and analyzed independently. STRUCTURE analysis of each cluste evealed evidence of subclusteing, with K = 3 within cluste 1 and K = 4 within cluste 2 (Figue 3c f). Among individuals that assigned to cluste 1, most individuals assigned highly to one of the thee subclustes (Figue 4b). Howeve, thee is little appaent geogaphic substuctuing of genetic vaiation, with the exception that most individuals fom Butte County assigned to subcluste 1. Among individuals that assigned to cluste 2, most individuals wee admixed, assigning to multiple subclustes (Figue 4c). 4 DISCUSSION 4.1 High genetic vaiation obseved in weedy L. peenne egadless of esistance fequency Ou analyses indicate vey high genetic divesity within populations of L. peenne ssp. multifloum as expected based on the biology of this widespead obligately outcossing species. Howeve, given the lage numbe of detected alleles and the allele fequencies obseved, a highe level of heteozygosity was expected than was obseved acoss all populations (Table 4). While some of this eduction in heteozygosity may be due to null alleles that do not amplify duing PCR ceating TABLE 5 Analysis of molecula vaiance (AMOVA) esults showing F- statistics fo codominant allelic data fo genetic vaiation distibuted among five hieachical levels Effect F-statistic F p Among counties in total sample F RT Among populations in counties F SR Among populations in total sample F ST Among individuals in populations F IS Among individuals in total sample F IT % of total genetic vaiation

9 624 (a) lnp [D] K 12 (c) lnp [D] K (e) 8600 lnp [D] K (b) ΔK (d) ΔK (f) ΔK K K K FIGURE 3 Bayesian clusteing analysis (STRUCTURE, Pitchad et al., 2000) of Lolium peenne plots of (a, c, e) the log likelihood ln P[D] fo five uns at each value of K, and (b, d, f) the second ode of change in ln P[D], ΔK, as a function of the numbe of clustes o gene pools, K, fom the analysis of all samples (a, b) and subclusteing analysis of individuals assigning with q > 0.6 to cluste 1 (c, d) and to cluste 2 (e, f) within the global analysis (a) 1 q 0 (b) q 0 (c) q FIGURE 4 Assignment of 412 individuals of L. peenne ssp. multifloum to the genetic clustes infeed by Bayesian clusteing analysis (STRUCTURE). Each vetical ba coesponds to a distinct individual and its pobability of assignment, q, to each cluste. (a) K = 2, the most likely numbe of genetic clustes fo the global data set, (b) K = 3, the most likely numbe of subclustes among individuals assigning with q > 0.6 to cluste 1, and (c) K = 4, the most likely numbe of subclustes among individuals assigning with q > 0.6 to cluste 2 the false appeaance of homozygous individuals, this would esult in educed obseved heteozygosity only in loci with a high fequency of null alleles. Howeve, a eduction in obseved heteozygosity is pesent acoss all loci, leading to the conclusion that thee is a biological cause fo the lowe than expected heteozygosity (Table 3). This could be due to a vey ecent o ongoing population bottleneck in L. peenne populations due to contol by glyphosate o othe weed management pactices. Seven of the 14 sampled populations show evidence of a past bottleneck. These seven populations may be located in fields with moe intensive weed management and thus have undegone a stonge bottleneck. In populations with no detected bottleneck, extensive gene flow with othe populations could have

10 625 estoed genetic divesity and eased the genetic signatue of a past population bottleneck. Bottlenecks ae only detectable if they ae eithe vey stong o vey ecent (Luikat & Conuet, 1998), although the bottleneck imposed by intense selection by glyphosate and the evolution of glyphosate esistance likely has been ecent, pobably occuing within the last 20 yeas, that is 20 geneations, based on when esistance to glyphosate fist was identified in Lolium in the United States and woldwide (Powles, Loaine- Colwill, Dellow, & Peston, 1998; Simamata et al., 2003). Although esistance alleles may have been pesent at low fequencies pevious to 20 yeas ago, they did not ise to fequencies high enough to be poblematic until glyphosate use in agicultue intensified, following the intoduction of inexpensive geneic fomulations of the hebicide and widespead adoption of educed- o no- tillage copping systems and glyphosate- esistant tansgenic cops. Populations which have undegone ecent population bottlenecks and stong selective sweeps fo adaptive taits may be expected to contain lowe genetic divesity than populations, which have not yet adapted to the selection pessue. Populations with a high fequency of esistant individuals would be expected to contain lowe genetic divesity than those with a lowe fequency of esistant individuals. Howeve, L. peenne populations with a high fequency of esistant plants (>70%) still contained high levels of obseved genetic divesity, despite evidence of a population bottleneck in some populations. The lack of coelation between the fequency of esistant plants within populations and the fixation index (F IS ) (Speaman s ank coefficient ρ = 0.02, p =.93), within- population genetic divesity (H E ) (Speaman s ank coefficient ρ = 0.13, p =.67), and allelic ichness (A R ) (Speaman s ank coefficient ρ = 0.22, p =.449) suggests that weed population size and genetic divesity may have been influenced by othe weed contol pactices o envionmental conditions, in addition to teatment with glyphosate. Hebicide otations and mixtues, tillage, mowing, and pest and envionmental pessues pesent vaiable selection pessues, which may educe genetic divesity in all populations, making it difficult to detect eductions in divesity in populations with a high fequency of glyphosate- esistant individuals. Repeated intoductions of L. peenne seeds fom othe fields may seve to incease within- population genetic divesity and compensate fo alleles lost though selective sweeps and bottlenecks. It is also possible that less- intensively managed L. peenne plants gowing in oadsides o noncop aeas nea the sampled populations may be expeiencing less intense selection and subsequently a less intense population bottleneck and that gene flow though pollen exchange with these plants may estoe some genetic divesity in populations undegoing selection fo esistance. The genetic divesity obseved in weedy populations of L. peenne was highe than that obseved in othe hebicide- esistant agicultual weeds. Populations of anothe outcossing gass weed species, Alopecuus myosuoides, in Fance with evolved esistance to ACCaseinhibiting hebicides had lowe values (0.246 and 0.240) of expected heteozygosity based on AFLP makes (Delye et al., 2010; Menchai et al., 2007; espectively), and populations of a glyphosate- esistant weed with a mixed mating system, Ipomoea pupuea, also had lowe total genetic divesity (H E = 0.304) based on micosatellite makes (Kueste et al., 2015). Populations of species with an outcossing mating system would be expected to have highe genetic divesity than those with pedominantly self- pollinating mating systems. Glyphosateesistant populations of the two closely elated selfing species Conyza canadensis and Conyza bonaiensis in Califonia displayed a wide ange of genetic divesities (H E = and H E = , espectively) based on micosatellite makes (Okada et al., 2013, 2014). While genetic divesity obseved in weedy L. peenne populations was highe than that obseved in othe species of weeds, the amount of genetic divesity detected in this study was simila to that obseved in most othe studies of L. peenne. Aveage obseved heteozygosity acoss loci in weedy populations (H O = 0.46) was simila to values obseved (H O = 0.40 and H O = 0.44) in some studies of peennial cultivas (Bazauskas et al., 2011 and Wang et al., 2009; espectively) but lowe than anothe study of peennial L. peenne cultivas (H O = 0.62) (Kubik et al., 2001) based on micosatellite makes. Expected heteozygosity in wild Euopean L. peenne populations anged fom to based on AFLP makes (McGath et al., 2007). The high numbe of alleles detected pe locus aveaged acoss populations (N A = 10.5) in Califonia populations was also simila o highe than that seen in studies of L. peenne cultivas using some of the same micosatellite makes (N A = 19.4, 13.3, and 9.9; Kubik et al., 2001; Wang et al., 2009; Bazauskas et al., 2011, espectively). Inteestingly, the foage cultivas of L. peenne do not show lowe genetic divesity than thei wild and weedy elatives despite many geneations of beeding. Rathe, L. peenne seems to display a vey high level of genetic divesity, egadless of oigin. 4.2 Spatial and genetic stuctuing of populations Glyphosate- esistant plants wee detected in L. peenne populations fom all sampled aeas (Table 2). The Butte County population, located nea whee glyphosate esistance was fist detected in Califonia, contained a high popotion of esistant individuals (Figue 1). In Lake County, the high fequency of esistant plants in populations was consistent with gowe epots of inceased difficulty contolling plants, with a lowe fequency futhe away. In Sonoma County, a vey low fequency of esistant individuals was obseved in the southen end of the county, with modeate fequency in the nothen end. The fequency of individuals suviving glyphosate teatment in Sonoma County was substantially lowe than the othe aeas despite simila epots of weed contol failue fom gowes. Glyphosate has been used fo decades as the pimay hebicide fo weed contol in ochads and vineyads, and noncop aeas of Califonia. The appeaance of glyphosate esistance is an adaptive esponse to the widespead and epeated use of glyphosate as a weed management stategy. The obseved micosatellite vaiation indicates genetic stuctuing of L. peenne populations in nothwest Califonia. Pincipal coodinate analysis of genetic distances indicates that populations located close to each othe tend to be genetically simila, as is seen in the gouping of most populations in southen Sonoma County and of populations in nothen Sonoma County togethe with population 13 (Figue 2).

11 626 Howeve, geogaphic poximity does not necessaily indicate genetic similaity. The pincipal coodinate analysis (Figue 2) and paiwise F ST (Table S3) both eveal lage genetic distance between populations within Lake County than between populations within Sonoma County. This indicates that despite the elatively lage geogaphic distances, Sonoma County populations ae closely elated to each othe due to eithe highe genetic exchange between them o less diffeentiation ove time, possibly elated to the elative homogeneity of the vineyad copping system acoss Sonoma County compaed to the mix of peennial cops gown in Lake County. Diffeences in wate availability in pimaily dip- iigated vineyads compaed to spinkle- iigated ochads may lead to local adaptation o phenological diffeences due to wate stess may contibute to population diffeentiation in Lake County populations. The lack of coelation between genetic distance and geogaphic distance found by a Mantel test indicates that genetic distance between populations is not due mainly to factos associated with isolation by distance, but to some othe facto such as local adaptation o diffeences in the stength of selection pessues acoss the landscape. Extensive long- distance gene flow may also eode the elationship between genetic distance and geogaphic distance, especially if gene flow is not homogeneous acoss the entie ange. An analysis of molecula vaiance indicates a significant amount of genetic vaiation is distibuted at the county and population level (Table 5). Howeve, both county and population diffeences ae outweighed by the high genetic vaiation among individuals, as might be expected in this highly divese outcossing species (Bazauskas et al., 2011). Bayesian clusteing STRUCTURE analysis indicates the pesence of two distinct gene pools o genetic clustes (Figue 3a). While the individuals assigning to cluste 1 ae pimaily fom Butte County and Sonoma County, individuals assigning to cluste 2 come fom all thee counties and include almost all individuals fom Lake County (Figue 4a). This indicates that thee is little admixtue between individuals in Lake County and individuals in the othe sampled aeas o that L. peenne has been intoduced into the egion too ecently fo substantial admixtue to have occued. In the subclusteing analysis, thee is little appaent spatial stuctue among individuals assigning to subclustes (Figue 4b,c). Many individuals had admixed genomes assigning patially to multiple subclustes, indicating little diffeentiation o high gene flow between individuals assigning to these subclustes. 4.3 Evolution of esistance and potential fo spead of esistance alleles Togethe, data on spatial pattens of population stuctuing and fequencies of glyphosate- esistant phenotypes allow compaison of hypotheses egading single o multiple evolutionay oigins and subsequent spead of glyphosate esistance in L. peenne populations in nothwest Califonia. Populations with modeate fequencies of esistant individuals in Sonoma County (30% > R > 80%, populations 7, 9, 10, 11) contain mostly individuals that assign to cluste 1 with q > 0.7, while populations with high fequencies of esistant individuals (R > 80%, populations 12, 13, 14) contain a lage popotion of individuals that assign to cluste 2 with q > 0.7 (Figue 4a, Table 2). This suggests that glyphosate esistance has likely evolved independently in individuals that assign to each cluste. Unfotunately, it was not possible to genotype and phenotype the same individuals, which would have allowed stonge infeence. In addition, the high genetic divesity obseved among individuals within populations and the low pecentage of genetic vaiation obseved among populations make it difficult to infe single o multiple oigins of esistance using only neutal genetic vaiation. Howeve, ou sequencing of the gene encoding glyphosate s taget enzyme in esistant and susceptible plants confims multiple taget- site mutations, which have peviously been identified to cause esistance to glyphosate, and thus multiple independent oigins of glyphosate esistance (Kan & Jasieniuk, In eview), in ageement with the esults of STRUCTURE analysis in this study. Thee is also evidence that some plants ae esistant due to a mechanism othe than taget- site mutations, indicating that multiple mechanisms of esistance ae pesent in the egion esulting fom at least one additional independent oigin of esistance (Kan and Jasieniuk, in eview). It is possible that in the futue, additional novel mutations may esult in yet moe independent oigins of esistance. STRUCTURE analysis evealed potential fo futue spead of esistance alleles though gene flow. Many admixed individuals with genotypes that assigned patially to each cluste wee identified (Figue 4). While the majoity of individuals assign highly to a single cluste, the consideable numbe of admixed individuals in many populations indicates that gene flow is common. Localized gene flow between populations located nea each othe may be pollen- mediated, and pollen movement ove distances of 3 km has been documented in L. peenne ssp. igidum (Busi, Yu, Baett- Lennad, & Powles, 2008). Shot- and long- distance gene flow may also be mediated by seed movement on agicultual machiney and vehicles, o ove shot distances by wind o animals. The highe levels of admixtue detected in this study compaed to studies of othe hebicide- esistant weeds (Kueste et al., 2015; Okada et al., 2013, 2014) likely elate to the outcossing natue of L. peenne. Spead of esistance alleles though gene flow could also esult in populations and individuals containing multiple mechanisms of glyphosate esistance. Successful management of glyphosate- esistant L. peenne populations in peennial copping systems will likely equie implementation of integated pest management pogams that include chemical and nonchemical techniques to not only contol cuently esistant plants, but educe the intensity of selection pessue fo futue independent oigins of esistance and limit the spead of esistance though gene flow. Inceasing tillage whee possible, mowing to educe seed set, applying hebicide altenatives to glyphosate, o applying glyphosate in mixtues with othe hebicides may help pevent o delay futue oigins of esistance by educing population sizes and educing the selection pessue of glyphosate in these systems. To limit spead of esistance though gene flow, cleaning weed seed fom equipment and shoes moved between infested fields may help educe long- distance seed tansfe. Mowing o tillage may also educe shotdistance gene flow though pollen dispesal by educing the numbe of flowes esistant plants poduce, although these management techniques may not be able to entiely eliminate pollen poduction. It is