Linkages and Collaborations in India and Abroad including Outside Funded Projects
|
|
- Aron Daniels
- 5 years ago
- Views:
Transcription
1 Linkages and Collaborations in India and Abroad including Outside Funded Projects ICAR Institutes/ SAUs 1. Planning, designing and analysis of experiments planned On Stations under the AICRP on IFS 2. Planning, designing and analysis of On Farm research experiments planned for AICRP on IFS ICAR-IIFSR, Modipuram 01 April March 2017 ICAR-IIFSR, Modipuram 01 April March Planning, designing and analysis of data relating to experiments for AICRP on long-term fertilizer experiments 4. Modelling network of gene responses to abiotic stress in rice 5. Information system for planning and analysis of experiments on All-India Coordinated Research Project on Vegetable Crops 06. Development of innovative approaches for small area estimation of crop yield, socio-economic and food insecurity parameters AICRP on LTFE ICAR- IISS, Bhopal ICAR-NRCB, New Delhi, ICAR-DRR, Hyderabad, ICAR-DKMA, New Delhi, CDAC, Pune (NFBSFARA) AICRP, ICAR-IIVR, Varanasi ICAR-NAARM, Hyderabad ICAR, Lal Bahadur Shastri Young Scientist Award 01 April March April March February March December March Network project on market intelligence ICAR-NIAP, New Delhi (ICAR, DARE) 13 February March Development of 16s rdna rumen specific microb database ICAR-NIANP, Bangalore 01 April 2014 (IASRI association w.e.f. 23 July 2014) 31 March Tobacco Agridaksh: An online expert system ICAR-CTRI, Rajahmundry 20 October October Network project on impact assessment of agricultural research and development ICAR-NIAP, New Delhi (ICAR) 01 January 2015 (IASRI association w.e.f. 12 January 2015) 31 March
2 ICAR-IASRI Annual Report ICAR network project on transgenics in crops 12. Developing a comprehensive web based system for agriculturally important microbes. 13. Computational identification and modelling of genetic variation in relation to performance traits in buffaloes. 14. Genomic data analysis for identification of economically important markers and viral diagnostics in pulses. ICAR-NRCPB, New Delhi 27 January March 2017 NBAIM, Mau. 01 April March 2017 CIRB, Hisar 06 June March 2017 IIPR, Kanpur 06 June March Computational approach for harnessing genome information and its integration with wheat phenome for efficient varietal development. IIWBR, Karnal 15 June March Mining and validation of candidate gene markers and screening on antimicrobial peptides of black pepper and small cardamom. 17. Bioinformatic analysis of sequence data of brinjal and bitter gourd for identification of functional and regulatory genes for traits of economic importance. 18. Molecular and computational approach to delineate metabolic pathways for better carbohydrate utilization in Labeo spp. IISR, Kozhikode, Kerala 15 June March 2017 NBPGR, New Delhi 16 June March 2017 CIFA, Bhubaneshwar 16 June March Elucidating the mechanism of Pashmina fibre development: An OMICS approach. SKUAST-K, Srinagar NDRI, Karnal 01 July June Microbial domain research projects on computational aspects. 21. Development of database repertoire for Clostridium perfiringens strains prevalent in causing Enterotoxaemia in goats. 22. Development of database on SNPs associated with economically important traits of Indian goats. 23. RiceMetaSys: Understanding rice gene network for blast resistance and drought tolerance through system biology approach. NBAIM, Mau 03 July March 2017 CIRG, Makhdoom 04 July March 2017 CIRG, Makhdoom 04 July March 2017 NRCPB, New Delhi 08 July March ICAR Research Data Repository for Knowledge Management as KRISHI: Knowledge based Resources Information System Hub for Innovations in Agriculture. Funded by ICAR Headquarter Plan Scheme under XII Plan period ( ). NAARM, Hyderabad, NBSS&LUP, Nagpur, ICAR-IARI, New Delhi, DKMA, New Delhi, CMFRI, Kochi, CRIDA, Hyderabad 24 July March
3 Linkages and Collaborations 25. Identification of genetic polymorphisms for pathogenicity in Vibrio sp. 26. Metagenomic applications and transcriptomes profiling for inland aquatic environmental health surveillance. CIBA, Chennai 19 August March 2017 CIFRI, Barrackpore 01 September March Cluster ensemble algorithms for germplasms evaluation on Chickpea NCIPM, New Delhi, NBPGR, New Delhi 18 September September Network project on computational biology and agricultural bioinformatics under two sub-projects: Sub-project 1: Gene regulatory networks modeling for heat stress responses of sources and sink for development of climate smart Wheat. Sub-project 2: Studying drought-responsive genes in subtropical maize germplasm and their utility in development of tolerant maize hybrids. ICAR-IARI, New Delhi 26 November March Transcriptome and proteome analysis for identification of candidate genes responsible for pistillate nature in castor. Funded by Extramural funded under Crop Sciences Division. ICAR- IIOR, Hyderabad 21 January March Knowledge management system for agriculture extension services in Indian NARES. Funded by Extramural funded under Agricultural Extension Division, ICAR. Agricultural Extension Division, ICAR. Government of India 04 March March Whole genome sequencing and development of allied genomics resources in two commercially important Fish-Labeo rohita and clarias batrachus ICAR-NBFGR, CIFA, AAU (DBT) 28 January September Whole genome based SNP mining and development of breed signatures for dairy and dual purpose indigenous cattle 33. Study to test the developed alternative methodology for estimation of area and production of horticultural crops. (CHAMAN program under MIDH) 34. Pilot study for developing state level estimates of crop area and production on the basis of sample sizes recommended by Professor Vaidyanthan Committee Report ICAR-NBAGR, Karnal ICAR-NDRI, Karnal (DBT) Department of Agriculture and Cooperation (DAC), Ministry of Agriculture and Farmers Welfare (MoA), Government of India. Directorate of Economics and Statistics, Department of Agriculture and Cooperation, Ministry of Agriculture and Farmers Welfare, Government of India, New Delhi. 09 July July September June February August
4 ICAR-IASRI Annual Report Investigation of Causes of Divergence between Official and Trade Estimates of Jute Production. Directorate of Economics & Statistics (DES), Department of Agriculture, Cooperation and Farmers Welfare, Ministry of Agriculture and Farmers Welfare, Govt. of India. 01 September August Stochastic differential equation models and their applications to agriculture. 37. Impact of ICT in Agricultural Education in India. Funded by ICAR Extra Mural Research Projects-Agricultural Extension Division. Science and Engineering Research Board (SERB), New Delhi. Agricultural Extension Division, ICAR. 06 November November April March Forecasting Agricultural output using Space Agrometeorology and Land based Observations (FASAL). Funded by IMD, New Delhi. 39. Smallholder s productivity and agricultural growth through technology, sustainable intensification and ecosystem services. IMD, New Delhi 13 April March 2017 ICAR- IARI, New Delhi March Incomplete split-plot designs: construction and analysis. Funded by SERB. 41. Standardization and validation of scales for measuring socio-psychological constructs related to risk adjustment and entrepreneurship behaviours of farmers. Funded by ICAR Extra Mural Research Project (Under Agricultural Extension division). Science and Engineering Research Board (SERB), New Delhi. Agricultural Extension Division, ICAR. 16 August August September March Development of varietal and hybrid technologies of pearl millet [Pennisetum glaucum (L). R. Br.] For higher yield and nutritional improvement. (Collaboration with ICAR-IARI) ICAR-IARI, New Delhi, NRCPB, New Delhi, FS&PHT, SSA&C 26 September March In silico analysis of data for identification of functional alleles for stress tolerance and quality traits using bioinformatics in Potato. ICAR-CPRI, Shimla 12. September March Assessment of post harvest losses in fruits and vegetables and strategies for their reduction in Andman and Nicobar Islands. ICAR-CIARI 01 June 2015 (Association of IASRI w.e.f. 03 October 2016) 31 May Creating awareness for efficient use of ICT and MOOCs in agriculture education. Funded by Extramural. Extramural, ICAR 01 November March
5 Linkages and Collaborations 46. Phenomics of moisture deficit stress tolerance and nitrogen use efficiency in Rice and Wheat Phase II. Funded by National Agricultural Science Fund (NASF). IARI, New Delhi, Indian Institute of Technology, New Delhi, National Rice Research Institute, Cuttack, National Agricultural Science Fund (NASF). 01 January March Management and impact assessment of farmer first project. Funded by ICAR farmer first programme under KVK scheme (ATARI-I) ICAR- NIAP, New Delhi, NAARM, Hyderabad, DKMA, New Delhi 14 February March Doubling farmers income in India by : Estimating farm income and facilitating the implementation of strategic framework. ICAR-NIAP, New Delhi 31 March March Creating a fully characterized genetic resource pipeline for mustard improvement programme in India. Funded by National Agricultural Science Fund (NASF) PAU, Ludhiyana, ICAR-IARI, New Delhi, GBPAUT 01 January December Study on improving methods for estimating crop area, yield and production under mixed, repeated and continuous cropping 51. Testing and validation of alternative methodology developed by IASRI for estimation of area and production of horticultural crops in Madhya Pradesh State. 52. Testing and validation of alternative methodology developed by IASRI for estimation of area and production of horticultural crops in Haryana State. Consultancy Studies FAO (Food and Agriculture Organization), Rome DAC, Ministry of Agriculture, GOI DAC, Ministry of Agriculture, GOI 18 December October June February August May
6 ICAR-IASRI Annual Report
Linkages and Collaborations in India and Abroad including Outside Funded Projects
Linkages and Collaborations in India and Abroad including Outside Funded Projects 1 Planning, designing and analysis of experiments planned on stations under All India Coordinated Research Project on Integrated
More informationNDRI CIAE ICAR RC NEH
Terms of Reference Indian Council of Agricultural Research (ICAR) has initiated a Network Project, National Initiative on Climate Resilient Agriculture (NICRA) during February 2011 and continued during
More informationINDIAN COUNCIL OF AGRICULTURAL RESEARCH KRISHI BHAWAN, NEW DELHI BE VIS-À-VIS RELEASES UPTO September,_2009
INDIAN COUNCIL OF AGRICULTURAL RESEARCH KRISHI BHAWAN, NEW DELHI 110 001 NON-PLAN BE-2009-10 VIS-À-VIS RELEASES UPTO September,_2009 (Rupees in lakhs) S. Subject Matter Division BE 2009- Releases No. 10
More informationDivision of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi
Circular ICAR--HRM Training Programme for Scientific Staff ICAR 2017--18 2017 Genomics--Assisted Breeding Genomics for Crop Improvement (March 1-21, 2018) Programme Director: Dr. Ashok K. Singh Division
More informationWeather based Agro advisory Research Programs in ICAR
Central Research Institute for Dryland Agriculture Santosh Nagar, Hyderabad 500 059 G.G.S.N.RAO,V.U.M. RAO and A.V.M.S.RAO Weather based Agro advisory Research Programs in ICAR Importance of Agro advisory
More informationSubmitting proposal for the certificate course of mushroom production within one week period. Submission of training proposal on seed production
Summary of Action Points/Recommendations of the XXIII Meeting of ICAR Regional Committee No. IV held during August 26-27, 2016 at, Patna, Bihar Crop husbandry: 1. Enhancement of fodder 2. Training on combine
More informationRFD (Results Framework Document) Targets for the period Indian Institute of Pulses Research Kanpur
RFD (Results Framework Document) Targets for the period 2012-13 Indian Institute of Pulses Research Kanpur 208 024 Indian Institute of Pulses Research Kanpur 208 024 Section 1: Vision, Mission, Objectives
More informationConferences, Workshops, Meetings, Seminars and Annual Day Organized
Conferences, Workshops, Meetings, Seminars and Annual Day Organized Dr. Ajit As Organizing Secretary organized the Eighteenth National Conference of Agricultural Research Statisticians at ICAR-Indian Institute
More informationLIST OF RESEARCH PROJECTS
Annexure-I LIST OF RESEARCH PROJECTS DEVELOPMENT AND ANALYSIS OF EXPERIMENTAL DESIGNS FOR AGRICULTURAL SYSTEMS RESEARCH ICAR National Professor Scheme 1. Designs for single factor and multi-factor experiments
More informationRemote Sensing for Agricultural Applications
Remote Sensing for Agricultural Applications Shibendu S. Ray Mahalanobis National Crop Forecast Centre Department of Agriculture, Cooperation & Farmers Welfare, New Delhi shibendu.ncfc@gov.in GeoSmart
More informationMuhammad Musa, Ph.D. Senior Program Specialist (Crops) SAARC Agriculture Centre, Dhaka Bangladesh
Agriculture Centre SAARC Muhammad Musa, Ph.D. Senior Program Specialist (Crops), Dhaka Bangladesh Challenges Food production situation in South Asia population vis-à-vis production levels Poverty (37%)
More informationFASAL: The Operational Programme for Crop Assessment in India
FASAL: The Operational Programme for Crop Assessment in India 23 Jul, 17 Aug, 11 Sep 2015 13 Jul, 7 Aug, 1 Sep 2014 Neetu Mahalanobis National Crop Forecast Centre Ministry of Agriculture & Farmers Welfare,
More informationBiofortification in selected crops for nutritional security. Coordinator: Project Director, Directorate of Rice Research
ICAR Agri-Consortia Research Platforms (Agri-CRP) Biofortification in selected crops for nutritional security Coordinator: Project Director, Directorate of Rice Research Billions of people around the world
More informationCitizen s/client s Charter. for. Crop Science Division ( )
Citizen s/client s Charter for Crop Science Division (2014-2015) Address: Indian Council of Agricultural (ICAR) Krishi Bhawan, Dr. Rajendra Prasad Road New Delhi - 110001 Website ID : www.icar.org.in Date
More informationSpace Technology for Decision Support in Agriculture
Space Technology for Decision Support in Agriculture Shibendu Shankar Ray Department of Agriculture, Cooperation & Farmers Welfare New Delhi 110 012, India www.ncfc.gov.in, shibendu.ncfc@nic.in Indian
More informationCrop Assessment using Space, Agro-Meteorology & Land based observations : Indian Experience
Crop Assessment using Space, Agro-Meteorology & Land based observations : Indian Experience Shibendu S. Ray Mahalanobis National Crop Forecast Centre Department of Agriculture, Cooperation & Farmers Welfare,
More informationChapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction
Chapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction Robert T. Fraley In the following chapters prominent scientists will discuss the recent genetic improvements in maize that have
More informationStrengthening biosafety compliance among public sector institutions in India: A SABP Initiative. Dr. Vibha Ahuja, Chief General Manager, BCIL
Strengthening biosafety compliance among public sector institutions in India: A SABP Initiative Dr. Vibha Ahuja, Chief General Manager, BCIL Structure of presentation Biosafety Regulations in India South
More informationIndia, Agriculture and ARD
India, Agriculture and ARD Global Conference on Agricultural Research for Development S.K. Datta Deputy Director General Indian Council of Agricultural Research Everything can wait but not agriculture
More informationName : Dr. Sanjeev K Banyal Designation : Assistant Professor Qualification : Ph. D. Discipline : Horticulture
Name : Dr. Sanjeev K Banyal Designation : Assistant Professor Qualification : Ph. D. Discipline : Horticulture Specialization : Fruit Science Contact details Phone (M) : 9418059914 Email: skbanyal@gmail.com
More informationBiosafety Issues and Bt cotton A case study. O. P. GOVILA Retd. Professor Genetics IARI
Biosafety Issues and Bt cotton A case study O. P. GOVILA Retd. Professor Genetics IARI Introduction Classical plant breeding is limited to the introduction of required characters into plant by genetic
More informationEnsuring Remunerative Prices to Farmers Challenges and the Way Forward
Ensuring Remunerative Prices to Farmers Challenges and the Way Forward Surabhi Mittal, P K Joshi, Avinash Kishore and Suresh Pal * Background Doubling farmers income by 2022 is a paradigm shift in transforming
More informationResults-Framework Document (RFD) for
Results-Framework Document (RFD) for Horticulture Division (1 st April, 11-31 st March, 12) INDIAN COUNCIL OF AGRICULTURAL RESEARCH KRISHI BHAWAN, NEW DELHI 110 114 Section 1: Vision, Mission, Objectives
More informationTexas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco
Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS Texas A&M AgriLife Research and Extension Center at Weslaco 2015 GOAL Protect water quality and increase the amount
More informationProject Proposal. Establishment of Seed Processing Infrastructure Facilities for Vegetable Crops
123 Project Proposal on Establishment of Seed Processing Infrastructure Facilities for Vegetable Crops Under National Horticulture Mission Lucknow, Uttar Pradesh By M/s ------------------------------------------------------------------
More informationGovernment of India s Perspective and Initiatives on Integration of Future Smart Food in Rice-Fallows
Government of India s Perspective and Initiatives on Integration of Future Smart Food in Rice-Fallows Dr. B. Rajender, Joint Secretary (Crops & Oilseeds) Department of Agriculture, Cooperation & Farmers
More informationHIND AGRICULTURAL RESEARCH AND TRAINING INSTITUTE
Role of ICAR in Indian Agricultural Development RASHTRIYA KRISHI Volume 12 Issue 1 June, 2017 49-59 e ISSN 2321 7987 Article Visit us : www.researchjournal.co.in Role of ICAR in Indian Agricultural Development
More informationThe test results of a new sowing app for groundnut. New sowing application increases yield by 30% January 2017, No
Happenings Newsletter January 2017, No. 1737 Feature Stories New sowing application increases yield by 30% Photo: S Punna, ICRISAT Rameswari Devi at her field in Devanakonda, Andhra Pradesh. The test results
More information13. Agricultural Economics, Marketing and Statistics
13. Agricultural Economics, Marketing and Statistics 76 Challenges to ensuring global food security through wheat: Technological breakthrough in wheat, popularly known as green revolution technology, and
More informationSreedhar Patil 5/30/2013
Farming in India Sreedhar Patil 5/30/2013 Location of India in World Map States in India Bangalore, Karnataka, INDIA 28 states and seven union territories Annual Rainfall in India Rivers in India River
More informationFuture Action Plan of Biotechnology in Sri Lanka
Future Action Plan of Biotechnology in Sri Lanka Prof. Rohan Rajapakse, Executive Director Sri Lanka Council for Agricultural Research Policy Contents Project Objectives National Agricultural Biotechnology
More informationLegumes are the 3 rd largest family of flowering plants
What s a Pulse? Legumes are the 3 rd largest family of flowering plants Second only to grasses in agricultural importance Keystone family for nutrition Pulses are legumes of which we eat the seed Why legumes?
More informationFood Security through Rice bean Research in India and Nepal (FOSRIN) Dr. Naveen Kumar
Food Security through Rice bean Research in India and Nepal (FOSRIN) Dr. Naveen Kumar Scientist Agronomy Fodder Production and Grassland Management Centre CSKHPKV, Palampur Distt. Kangra (HP) India-176
More informationSustainable Agricultural Mechanization in India Strategy and Long-term Policies
Sustainable Agricultural Mechanization in India Strategy and Long-term Policies Dr. Kanchan K. Singh A.D.G. (Engg.) Indian Council of Agricultural Research New Delhi, INDIA 5 th Regional Forum on Sustainable
More informationRice bean in India with Particular Emphasis on the Himalayan Region
Rice bean in India with Particular Emphasis on the Himalayan Region M. Dutta Prof & Head, Dept. of Crop Improvement and TPL, Plant Breeding, AICRN on UC (ICAR) GBPUAT, Hill Campus, Ranichauri, Uttarakhand,
More informationIndo Swiss Collaboration in Biotechnology (ISCB)
Indo Swiss Collaboration in Biotechnology (ISCB) The Indo-Swiss Collaboration in Biotechnology (ISCB) was established in 1974 as a capacity building programme supported by the Swiss Agency for Development
More informationIndia Organic Food Market Forecast & Opportunities, 2017
Organic Food Market Market Size Organic food market in India is likely to treble in four years organic food market in India at $0.36 billion in 2014 According to India Organic Food Market Forecast & Opportunities,
More informationHuman Resource Development of Agricultural Mechanization in India: Policy and Status. K. K. Singh
Human Resource Development of Agricultural Mechanization in India: Policy and Status K. K. Singh Director ICAR-Central Institute of Agricultural Engineering Nabi Bagh, Berasia Road, Bhopal-462038.India
More informationGOVERNMENT OF INDIA MINISTRY OF AGRICULTURE AND FARMERS WELFARE DEPARTMENT OF AGRICULTURAL RESEARCH & EDUCATION
GOVERNMENT OF INDIA MINISTRY OF AGRICULTURE AND FARMERS WELFARE DEPARTMENT OF AGRICULTURAL RESEARCH & EDUCATION LOK SABHA UNSTARRED QUESTION NO. 2715 TO BE ANSWERED ON 02/08/2016 AGRICULTURAL ENGINEERING
More informationScience to Support Plant Protection for Horticulture AAFC s Science & Technology Branch
Science to Support Plant Protection for Horticulture AAFC s Science & Technology Branch Crop, Plant Protection and the Environment Committee March 15, 2018 Dr. Della Johnston Outline Strategic direction
More informationFrom Genotype to Phenotype
From Genotype to Phenotype Johanna Vilkki Green technology, Natural Resources Institute Finland Systems biology Genome Transcriptome genes mrna Genotyping methodology SNP TOOLS, WG SEQUENCING Functional
More informationIndian Seed Sector : The Way Forward 1
Indian Seed Sector : The Way Forward 1 R.S. Paroda Former Director General, ICAR and Secretary, DARE, Govt. of India Dear Members of NSAI, It gives me immense pleasure to be with your again this evening.
More informationCentral Institute of Brackishwater Aquaculture, Indian Council of Agricultural Research 75, Santhome High Road, R.A.Puram, Chennai
Introduction Central Institute of Brackishwater Aquaculture, Indian Council of Agricultural Research 75, Santhome High Road, R.A.Puram, Chennai 600028 Strategic Plan 2010-2015 for RFD of CIBA 2010-2011
More informationOutline of Presentation
Seed Production Systems in Pulse Crops in India- Community based perspectives, Outline of Presentation Dr J S Sandhu Agriculture Commissioner Ministry Of Agriculture Government Of India Email- ag.comm@nic.in
More informationConstruction of an Integrated Database on Biosafety and use of GMOs in India
FINAL TECHNICAL REPORT Construction of an Integrated Database on Biosafety and use of GMOs in India Principal Investigator : Dr. T. R. Sharma Coordinator : Prof. K.R. Koundal Co- Investigators: Dr. K.
More informationU.S. Government Funding for Prebreeding: Role of the Private Sector. Nora Lapitan and Jennifer Long US Agency for International Development
U.S. Government Funding for Prebreeding: Insights, Forecast and the Role of the Private Sector Nora Lapitan and Jennifer Long US Agency for International Development Outline How US Federal funding agencies
More informationImproving methods for estimating post harvest losses
Broad Topic Sub Topics/ Papers Reviewed Report Improving methods for estimating post harvest losses Post Harvest Food Losses Estimation - Development of Consistent Methodology by Jaspreet Aulakh and Anita
More informationImpact Assessment of Agricultural Extension Reforms in Bihar. K.M. Singh 1, M.S. Meena 2 and A.K. Jha 3 ABSTRACT
110 Indian Res. J Ext. Edu. 9 (2 ), May 2009 Impact Assessment of Agricultural Extension Reforms in Bihar K.M. Singh 1, M.S. Meena 2 and A.K. Jha 3 1. Head, 2. Sr.Scientist (Agril. Ext.), Division of Socio
More information14 Indian Res. J. Ext. Edu. 11 ( 3 ), September, Issues Related to Low Productivity of Maize in Haryana
14 Indian Res. J. Ext. Edu. 11 ( 3 ), September, 2011 Issues Related to Low Productivity of Maize in Haryana V.K. Yadav 1, P. Supriya², Shailesh Kumar 3 and C.Y. Manikanhaiya 4 1. Sr. Scientist (Agril.
More informationStudy-IQ education
Science & Tech Target- 2018 (Series-7) BIOTECHNOLOGY By Dr. Ravi P. Agrahari - Scientist in IIT Delhi - Author of Mc Graw Hill Publication for Science & Technology - last 17 years teaching experience for
More informationClass IX Chapter 15 Improvement in Food Resources Science
What do we get from cereals, pulses, fruits and vegetables? (i) Cereals provide us with carbohydrates. Also, they are a rich source of energy. (ii) Pulses give us proteins. (iii) Fruits and vegetables
More informationQuestion 1: What do we get from cereals, pulses, fruits and vegetables? (i) Cereals provide us with carbohydrates. Also, they are a rich source of energy. (ii) Pulses give us proteins. (iii) Fruits and
More informationImportance of Gramin Krishi Mousam Sewa in Hill Region of West Bengal
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 03 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.703.284
More informationBioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
More informationBiofortified Varieties: Sustainable Way to Alleviate Malnutrition
Biofortified Varieties: Sustainable Way to Alleviate Malnutrition Indian Council of Agricultural Research New Delhi 110 001 Biofortified Varieties: Sustainable Way to Alleviate Malnutrition Indian Council
More informationBiofortified Varieties: Sustainable Way to Alleviate Malnutrition
Biofortified Varieties: Sustainable Way to Alleviate Malnutrition Indian Council of Agricultural Research New Delhi 110 001 Biofortified Varieties: Sustainable Way to Alleviate Malnutrition Indian Council
More informationClass IX Chapter 15 Improvement in Food Resources Science
Class IX Chapter 15 Improvement in Food Resources Science Question 1: What do we get from cereals, pulses, fruits and vegetables? (i) Cereals provide us with carbohydrates. Also, they are a rich source
More informationINTRA AND INTER CLUSTER STUDIES FOR QUANTITATIVE TRAITS IN GARLIC (Allium sativum L)
SAARC J. Agri., 11(2): 61-67 (2013) INTRA AND INTER CLUSTER STUDIES FOR QUANTITATIVE TRAITS IN GARLIC (Allium sativum L) R. K. Singh *, B. K. Dubey and R. P. Gupta National Horticultural Research and Development
More informationNational Vegetable Initiative for Urban Clusters
Operational Guidelines for MANAGEMENT SUPPORT GROUP FOR National Vegetable Initiative for Urban Clusters SMALL FARMERS AGRIBUSINESS CONSORTIUM Department of Agriculture & Cooperation 1. INTRODUCTION 1.1.
More informationPaper No.: 02. Paper Title: PRINCIPLES OF THE FOOD PROCESSING & PRESERVATION
Paper No.: 02 Paper Title: PRINCIPLES OF THE FOOD PROCESSING & PRESERVATION Module 01: Scope of Food Processing in India with National and International Perspective Paper Coordinator: Dr. P. Narender Raju,
More informationInformation Support to Stakeholders through ATIC S Web Pages
Vol.3 No. 2, 47-53 (2014) Received: Feb.2014; Accepted: Oct, 2014 Information Support to Stakeholders through ATIC S Web Pages D.S. Sheoran 1 and Jogender Singh 2 1.Department of Extension Education, CCSHAU,
More informationChampions of the Poor of the Semi-Arid Tropics
ICRISAT and Partners Champions of the Poor of the Semi-Arid Tropics William D. Dar Director General, ICRISAT This presentation The context Our research heartland Major outputs and impacts Moving into the
More information1.0 VISION 2.0 MISSION 3.0 OBJECTIVES 4.0 BIOTECHNOLOGY
1.0 VISION Uttar Pradesh to become more prosperous State through utilizing modern tools of biotechnologybringing prosperity to farmers, generating employment in rural areas, food for all, Good health and
More informationResults-Framework Document (RFD)
Results-Framework Document (RFD) for National Centre for Agricultural Economics and Policy Research (2012-2013) P.B.No.11305, Dev Prakash Shastri Marg, Pusa, New Delhi 110 012 www.ncap.res.in Page 1 of
More informationMolecular Techniques to Assess Microbial Community Structure and identification. January 2-9, 2017
Molecular Techniques to Assess Microbial Community Structure and identification January 2-9, 2017 INTRODUCTION Microbes make up most of the biodiversity on Earth, and several of the processes which microorganisms
More informationRFD. Results Framework Document For. Central Rice Research Institute ( )
RFD Results Framework Document For Central Rice Research Institute ( 2012) Vision Section 1: Vision, Mission, Objectives and Functions Food and nutritional security through sustainable rice. Mission To
More informationRECRUITMENTS OF SCIENTISTS: DIRECT RECRUITMENT OR ON DEPUTATION. Areas of specialization as essential qualifications: [Advt. No.NABI/02/2017/Rectt.
National Agri-Food Biotechnology Institute (NABI) (Department of Biotechnology, Ministry of Science and Technology, Govt of India) Knowledge city, Sector-81, Mohali, (Punjab), India-140306 Web: www.nabi.res.in
More informationChapter 15: Improvement in Food Resources Science
Chapter 15: Improvement in Food Resources Science Page No: 204 1. What do we get from cereals, pulses, fruits and vegetables? Cereals provide us with carbohydrates. Also, they are a rich source of energy.
More information13. Agricultural Economics, Marketing and Statistics
13. Agricultural Economics, Marketing and Statistics The principles of economics as applied to production of crops and livestock are mainly focused on maximizing yields while maintaining a good ecosystem.
More informationData science and precision farming
Data science and precision farming Agriculture and Earth Observation workshop 4 5 July 2017 Dutch Ministry of Economic Affairs The Hague, The Netherlands Prof. Jakob de Vlieg Applied Data Science, JADS
More informationAnnexure-I Terms of Reference for consultant to assist in preparation of a draft report on the State of Indian Agriculture
Annexure-I Terms of Reference for consultant to assist in preparation of a draft report on the State of Indian Agriculture 2013-14 1. The draft report on the State of Indian Agriculture should be prepared
More informationAgriculture. List of Tables
Agriculture List of Tables 7.1: Area Production and yield of Agricultural Crops in Sikkim (Part-A) 7.2: Area Production and yield of Agricultural Crops (Part-B) 7.3: Area Production and yield of Agricultural
More informationDrought Monitoring & Management An Indian Experience
Drought Monitoring & Management An Indian Experience Ravinder Kaur Project Director Water Technology Center Indian Agricultural Research Institute, New Delhi Email: pd_wtc@iari.res.in Spatial and Temporal
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More information1 What are three cropping seasons of India? Explain any one in brief. 2 Discuss three main impacts of globalization on Indian agriculture.
1 What are three cropping seasons of India? Explain any one in brief. 2 Discuss three main impacts of globalization on Indian agriculture. 3.Distinguish between rabi and kharif season? 4. What is Horticulture?
More informationPlant cultivation on moving field conveyer system and various imaging platforms in Nanaji Deshmukh Plant Phenomics Centre at ICAR-IARI, New Delhi
Hon ble Prime Minister Shri. Narendra Modi dedicated the "Nanaji Deshmukh Plant Phenomics Centre" at ICAR-IARI, New Delhi to the Nation on 11 th October 2017 Development of climate resilient crop varieties
More informationAcharya.N.G.Ranga Agricultural University, Rajendranagar, Hyderabad. Course No: AGRO 101
Acharya.N.G.Ranga Agricultural University, Rajendranagar, Hyderabad. 1 Course No: AGRO 101 Course Title: Principles of Agronomy and Agricultural Meteorology Credit Hours: 3(2+1) Dr.A. Pratap Kumar Reddy,
More informationPulses strategy for sustainable food and nutritional security in SAARC region. Mohan C. Saxena
Pulses strategy for sustainable food and nutritional security in SAARC region Mohan C. Saxena Outline Importance of pulses Availability of pulses in SAARC region & its nutritional implications Challenges
More informationEradicating hunger & malnutrition
Eradicating hunger & malnutrition The biggest challenge of our time Agricultural biodiversity is a prerequisite for sustainable agriculture and food security 2 Agriculture Facing its biggest challenge
More informationIndian Institute of Soil Science
Indian Institute of Soil Science Bhopal Courses 1. Farmers Resource Based Site Specific Nutrient Management in Different Production Systems 2. Advanced Methods of Soil and Plant Analysis 3. Recent Advances
More information10. BIOTECHNOLOGY (Code No. 045)
10. BIOTECHNOLOGY (Code No. 045) An unprecedented growth of human knowledge in the field of Biological Sciences coupled with equally significant developments in the field of technology have brought significant
More informationPhone: (o) Vegetable Breeding
Name : Dr. Deepa Sharma Designation : Assistant Scientist Qualification : Ph. D. Fellowship/Awards : Highest OGPA during M.Sc. Gold Medal recipient in Ph. D. Merit scholarship during B.Sc. programme Discipline
More informationA Study on the performance of agricultural sector in India
Indian J. Agric. Res., 51 (3) 2017 : 282-286 Print ISSN:0367-8245 / Online ISSN:0976-058X AGRICULTURAL RESEARCH COMMUNICATION CENTRE www.arccjournals.com/www.ijarjournal.com A Study on the performance
More informationAGRICULTURE. Agriculture and Crop Production. Genetics, Plant Breeding and Microbiology 15. Livestock Production 5 Scope and Importance
AGRICULTURE Course Structure Part Section Unit Topics Marks A Agriculture and Crop Production I 1 Scope and Importance 2 Physical Environment 3 Agriculture Economics 30 B Genetics, Plant Breeding and Microbiology
More informationPlant Breeding as an integral part of Sustainable Agriculture
2 Plant Breeding as an integral part of Sustainable Agriculture Dr. Dirk Zimmermann Sustainable Agriculture Campaigner Greenpeace Germany International Cotton Conference, Bremen, 17.03.2016 dirk.zimmermann@greenpeace.de
More informationVISION ICAR Zonal Project Directorate, Zone II. Bhumi Vihar Complex, Block GB, Sector III Salt Lake City Kolkata
VISION 2050 ICAR Zonal Project Directorate, Zone II Bhumi Vihar Complex, Block GB, Sector III Salt Lake City Kolkata 700097 1 The context Agriculture is a critical sector of the Indian economy. Contribution
More informationSOCIO-ECONOMIC PROFILE OF WOMEN GOAT KEEPERS AND REARING CHALLANGES IN GOAT IN NADIA DISTRICT OF WEST BENGAL
International Journal of Science, Environment and Technology, Vol. 4, No 2, 2015, 331 336 ISSN 2278-3687 (O) 2277-663X (P) SOCIO-ECONOMIC PROFILE OF WOMEN GOAT KEEPERS AND REARING CHALLANGES IN GOAT IN
More informationChapter 4 Agriculture
Chapter 4 Agriculture Types of Farming Primitive Subsistence Farming Practiced on small patches of land. Involves family/community labour. Uses primitive tools such as hoe, digging sticks etc. Predominance
More informationDr K C Bansal, Director, NBPGR made a presentation on PGR Management: Current status, future strategies and thrust areas for the 12 th Five Year Plan.
Proceedings of the 1 st Meeting of the National Advisory Board on Management of Genetic Resources, December 13, 2011and held at NBPGR, New Delhi -110012 The 1 st meeting of the National Advisory Board
More informationPromoting Women in Science
Promoting Women in Science Initiatives of Department of Biotechnology Department of Biotechnology Ministry of Science & Technology Government of India Department of Biotechnology Set up in 1986 Focus Research
More informationDIRECTORATE OF SEED RESEARCH. cht vuqla/kku funs kky; VISION 2030
DIRECTORATE OF SEED RESEARCH cht vuqla/kku funs kky; VISION 2030 (Indian Council of Agricultural Research) Kushmaur, Kaithauli, Mau 275 101(U.P.) www.dsr.org.in VISION 2030 Kushmaur, Kaithauli Mau 275
More informationDevelopment of Climate Resilient Villages
Development of Climate Resilient Villages Alok Sikka, YG Prasad, Ch. Srinivasa Rao Indian Council of Agricultural Research, New Delhi, India Montpellier March 16 18, 2015 Climate Change Projections India
More informationIndian Institute of Soil Science
Indian Institute of Soil Science Bhopal Courses 1. Farmers Resource Based Site Specific Nutrient Management in Different Production Systems 2. Advanced Methods of Soil and Plant Analysis 3. Recent Advances
More informationPage 1 of 6. Agriculture. I. Answer the Following
Agriculture Page 1 of 6 I. Answer the Following Q1. What is the importance of agriculture in the Indian economy? Ans. Two-thirds of India s population is engaged in agricultural activities. Agriculture
More informationPreclinical Toxicology of GM Crops. Dr. B. Sesikeran, MD, FAMS Director National Institute of Nutrition (ICMR) Hyderabad
Preclinical Toxicology of GM Crops Dr. B. Sesikeran, MD, FAMS Director National Institute of Nutrition (ICMR) Hyderabad 500 007 1 Status of genetic modification of crops Existing: Simple modifications
More informationHarnessing Biotechnology for Food Security in the Asia-Pacific Region
Technical Conference on Agricultural Biotechnologies in Developing Countries: Options and opportunities in crops, forestry, livestock, fisheries and agro-industry to face the challenges of food insecurity
More informationSunil Jain, Sankarsana Sahoo, Kumar Sundaram, Pramod Kumar
Sunil Jain, Sankarsana Sahoo, Kumar Sundaram, Pramod Kumar Plan of Presentation Methodology of GVA Estimation of Crop Sector Methodology for GVA of Crop sector on Financial Year basis. Methodology for
More informationIndian Chem 2018 Indian Agrochemical Market Scenario and opportunities. Mr. Harsh Dhanuka Vice President, Dhanuka Agritech Ltd.
Indian Chem 2018 Indian Agrochemical Market Scenario and opportunities Mr. Harsh Dhanuka Vice President, Dhanuka Agritech Ltd. 1 CONTENTS India - Country Of Vast Opportunity Indian Agriculture Global Outlook
More informationBioengineered Crops as Tools for Colombian Agricultural Development
Bioengineered Crops as Tools for Colombian Agricultural Development Opportunities and Strategic Considerations Peter Gregory, Ph.D pg46@cornell.edu Agricultural Biotechnology Consultant International Professor
More information6.3 Farmers rights, their scope and legal protection in India
6.3 Farmers rights, their scope and legal protection in India S.P. Bala Ravi Farmers contributions to the development of plant genetic resources Today, we understand and appreciate the importance of plant
More information