Linkages and Collaborations in India and Abroad including Outside Funded Projects

Size: px
Start display at page:

Download "Linkages and Collaborations in India and Abroad including Outside Funded Projects"

Transcription

1 Linkages and Collaborations in India and Abroad including Outside Funded Projects ICAR Institutes/ SAUs 1. Planning, designing and analysis of experiments planned On Stations under the AICRP on IFS 2. Planning, designing and analysis of On Farm research experiments planned for AICRP on IFS ICAR-IIFSR, Modipuram 01 April March 2017 ICAR-IIFSR, Modipuram 01 April March Planning, designing and analysis of data relating to experiments for AICRP on long-term fertilizer experiments 4. Modelling network of gene responses to abiotic stress in rice 5. Information system for planning and analysis of experiments on All-India Coordinated Research Project on Vegetable Crops 06. Development of innovative approaches for small area estimation of crop yield, socio-economic and food insecurity parameters AICRP on LTFE ICAR- IISS, Bhopal ICAR-NRCB, New Delhi, ICAR-DRR, Hyderabad, ICAR-DKMA, New Delhi, CDAC, Pune (NFBSFARA) AICRP, ICAR-IIVR, Varanasi ICAR-NAARM, Hyderabad ICAR, Lal Bahadur Shastri Young Scientist Award 01 April March April March February March December March Network project on market intelligence ICAR-NIAP, New Delhi (ICAR, DARE) 13 February March Development of 16s rdna rumen specific microb database ICAR-NIANP, Bangalore 01 April 2014 (IASRI association w.e.f. 23 July 2014) 31 March Tobacco Agridaksh: An online expert system ICAR-CTRI, Rajahmundry 20 October October Network project on impact assessment of agricultural research and development ICAR-NIAP, New Delhi (ICAR) 01 January 2015 (IASRI association w.e.f. 12 January 2015) 31 March

2 ICAR-IASRI Annual Report ICAR network project on transgenics in crops 12. Developing a comprehensive web based system for agriculturally important microbes. 13. Computational identification and modelling of genetic variation in relation to performance traits in buffaloes. 14. Genomic data analysis for identification of economically important markers and viral diagnostics in pulses. ICAR-NRCPB, New Delhi 27 January March 2017 NBAIM, Mau. 01 April March 2017 CIRB, Hisar 06 June March 2017 IIPR, Kanpur 06 June March Computational approach for harnessing genome information and its integration with wheat phenome for efficient varietal development. IIWBR, Karnal 15 June March Mining and validation of candidate gene markers and screening on antimicrobial peptides of black pepper and small cardamom. 17. Bioinformatic analysis of sequence data of brinjal and bitter gourd for identification of functional and regulatory genes for traits of economic importance. 18. Molecular and computational approach to delineate metabolic pathways for better carbohydrate utilization in Labeo spp. IISR, Kozhikode, Kerala 15 June March 2017 NBPGR, New Delhi 16 June March 2017 CIFA, Bhubaneshwar 16 June March Elucidating the mechanism of Pashmina fibre development: An OMICS approach. SKUAST-K, Srinagar NDRI, Karnal 01 July June Microbial domain research projects on computational aspects. 21. Development of database repertoire for Clostridium perfiringens strains prevalent in causing Enterotoxaemia in goats. 22. Development of database on SNPs associated with economically important traits of Indian goats. 23. RiceMetaSys: Understanding rice gene network for blast resistance and drought tolerance through system biology approach. NBAIM, Mau 03 July March 2017 CIRG, Makhdoom 04 July March 2017 CIRG, Makhdoom 04 July March 2017 NRCPB, New Delhi 08 July March ICAR Research Data Repository for Knowledge Management as KRISHI: Knowledge based Resources Information System Hub for Innovations in Agriculture. Funded by ICAR Headquarter Plan Scheme under XII Plan period ( ). NAARM, Hyderabad, NBSS&LUP, Nagpur, ICAR-IARI, New Delhi, DKMA, New Delhi, CMFRI, Kochi, CRIDA, Hyderabad 24 July March

3 Linkages and Collaborations 25. Identification of genetic polymorphisms for pathogenicity in Vibrio sp. 26. Metagenomic applications and transcriptomes profiling for inland aquatic environmental health surveillance. CIBA, Chennai 19 August March 2017 CIFRI, Barrackpore 01 September March Cluster ensemble algorithms for germplasms evaluation on Chickpea NCIPM, New Delhi, NBPGR, New Delhi 18 September September Network project on computational biology and agricultural bioinformatics under two sub-projects: Sub-project 1: Gene regulatory networks modeling for heat stress responses of sources and sink for development of climate smart Wheat. Sub-project 2: Studying drought-responsive genes in subtropical maize germplasm and their utility in development of tolerant maize hybrids. ICAR-IARI, New Delhi 26 November March Transcriptome and proteome analysis for identification of candidate genes responsible for pistillate nature in castor. Funded by Extramural funded under Crop Sciences Division. ICAR- IIOR, Hyderabad 21 January March Knowledge management system for agriculture extension services in Indian NARES. Funded by Extramural funded under Agricultural Extension Division, ICAR. Agricultural Extension Division, ICAR. Government of India 04 March March Whole genome sequencing and development of allied genomics resources in two commercially important Fish-Labeo rohita and clarias batrachus ICAR-NBFGR, CIFA, AAU (DBT) 28 January September Whole genome based SNP mining and development of breed signatures for dairy and dual purpose indigenous cattle 33. Study to test the developed alternative methodology for estimation of area and production of horticultural crops. (CHAMAN program under MIDH) 34. Pilot study for developing state level estimates of crop area and production on the basis of sample sizes recommended by Professor Vaidyanthan Committee Report ICAR-NBAGR, Karnal ICAR-NDRI, Karnal (DBT) Department of Agriculture and Cooperation (DAC), Ministry of Agriculture and Farmers Welfare (MoA), Government of India. Directorate of Economics and Statistics, Department of Agriculture and Cooperation, Ministry of Agriculture and Farmers Welfare, Government of India, New Delhi. 09 July July September June February August

4 ICAR-IASRI Annual Report Investigation of Causes of Divergence between Official and Trade Estimates of Jute Production. Directorate of Economics & Statistics (DES), Department of Agriculture, Cooperation and Farmers Welfare, Ministry of Agriculture and Farmers Welfare, Govt. of India. 01 September August Stochastic differential equation models and their applications to agriculture. 37. Impact of ICT in Agricultural Education in India. Funded by ICAR Extra Mural Research Projects-Agricultural Extension Division. Science and Engineering Research Board (SERB), New Delhi. Agricultural Extension Division, ICAR. 06 November November April March Forecasting Agricultural output using Space Agrometeorology and Land based Observations (FASAL). Funded by IMD, New Delhi. 39. Smallholder s productivity and agricultural growth through technology, sustainable intensification and ecosystem services. IMD, New Delhi 13 April March 2017 ICAR- IARI, New Delhi March Incomplete split-plot designs: construction and analysis. Funded by SERB. 41. Standardization and validation of scales for measuring socio-psychological constructs related to risk adjustment and entrepreneurship behaviours of farmers. Funded by ICAR Extra Mural Research Project (Under Agricultural Extension division). Science and Engineering Research Board (SERB), New Delhi. Agricultural Extension Division, ICAR. 16 August August September March Development of varietal and hybrid technologies of pearl millet [Pennisetum glaucum (L). R. Br.] For higher yield and nutritional improvement. (Collaboration with ICAR-IARI) ICAR-IARI, New Delhi, NRCPB, New Delhi, FS&PHT, SSA&C 26 September March In silico analysis of data for identification of functional alleles for stress tolerance and quality traits using bioinformatics in Potato. ICAR-CPRI, Shimla 12. September March Assessment of post harvest losses in fruits and vegetables and strategies for their reduction in Andman and Nicobar Islands. ICAR-CIARI 01 June 2015 (Association of IASRI w.e.f. 03 October 2016) 31 May Creating awareness for efficient use of ICT and MOOCs in agriculture education. Funded by Extramural. Extramural, ICAR 01 November March

5 Linkages and Collaborations 46. Phenomics of moisture deficit stress tolerance and nitrogen use efficiency in Rice and Wheat Phase II. Funded by National Agricultural Science Fund (NASF). IARI, New Delhi, Indian Institute of Technology, New Delhi, National Rice Research Institute, Cuttack, National Agricultural Science Fund (NASF). 01 January March Management and impact assessment of farmer first project. Funded by ICAR farmer first programme under KVK scheme (ATARI-I) ICAR- NIAP, New Delhi, NAARM, Hyderabad, DKMA, New Delhi 14 February March Doubling farmers income in India by : Estimating farm income and facilitating the implementation of strategic framework. ICAR-NIAP, New Delhi 31 March March Creating a fully characterized genetic resource pipeline for mustard improvement programme in India. Funded by National Agricultural Science Fund (NASF) PAU, Ludhiyana, ICAR-IARI, New Delhi, GBPAUT 01 January December Study on improving methods for estimating crop area, yield and production under mixed, repeated and continuous cropping 51. Testing and validation of alternative methodology developed by IASRI for estimation of area and production of horticultural crops in Madhya Pradesh State. 52. Testing and validation of alternative methodology developed by IASRI for estimation of area and production of horticultural crops in Haryana State. Consultancy Studies FAO (Food and Agriculture Organization), Rome DAC, Ministry of Agriculture, GOI DAC, Ministry of Agriculture, GOI 18 December October June February August May

6 ICAR-IASRI Annual Report

Linkages and Collaborations in India and Abroad including Outside Funded Projects

Linkages and Collaborations in India and Abroad including Outside Funded Projects Linkages and Collaborations in India and Abroad including Outside Funded Projects 1 Planning, designing and analysis of experiments planned on stations under All India Coordinated Research Project on Integrated

More information

NDRI CIAE ICAR RC NEH

NDRI CIAE ICAR RC NEH Terms of Reference Indian Council of Agricultural Research (ICAR) has initiated a Network Project, National Initiative on Climate Resilient Agriculture (NICRA) during February 2011 and continued during

More information

INDIAN COUNCIL OF AGRICULTURAL RESEARCH KRISHI BHAWAN, NEW DELHI BE VIS-À-VIS RELEASES UPTO September,_2009

INDIAN COUNCIL OF AGRICULTURAL RESEARCH KRISHI BHAWAN, NEW DELHI BE VIS-À-VIS RELEASES UPTO September,_2009 INDIAN COUNCIL OF AGRICULTURAL RESEARCH KRISHI BHAWAN, NEW DELHI 110 001 NON-PLAN BE-2009-10 VIS-À-VIS RELEASES UPTO September,_2009 (Rupees in lakhs) S. Subject Matter Division BE 2009- Releases No. 10

More information

Division of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi

Division of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi Circular ICAR--HRM Training Programme for Scientific Staff ICAR 2017--18 2017 Genomics--Assisted Breeding Genomics for Crop Improvement (March 1-21, 2018) Programme Director: Dr. Ashok K. Singh Division

More information

Weather based Agro advisory Research Programs in ICAR

Weather based Agro advisory Research Programs in ICAR Central Research Institute for Dryland Agriculture Santosh Nagar, Hyderabad 500 059 G.G.S.N.RAO,V.U.M. RAO and A.V.M.S.RAO Weather based Agro advisory Research Programs in ICAR Importance of Agro advisory

More information

Submitting proposal for the certificate course of mushroom production within one week period. Submission of training proposal on seed production

Submitting proposal for the certificate course of mushroom production within one week period. Submission of training proposal on seed production Summary of Action Points/Recommendations of the XXIII Meeting of ICAR Regional Committee No. IV held during August 26-27, 2016 at, Patna, Bihar Crop husbandry: 1. Enhancement of fodder 2. Training on combine

More information

RFD (Results Framework Document) Targets for the period Indian Institute of Pulses Research Kanpur

RFD (Results Framework Document) Targets for the period Indian Institute of Pulses Research Kanpur RFD (Results Framework Document) Targets for the period 2012-13 Indian Institute of Pulses Research Kanpur 208 024 Indian Institute of Pulses Research Kanpur 208 024 Section 1: Vision, Mission, Objectives

More information

Conferences, Workshops, Meetings, Seminars and Annual Day Organized

Conferences, Workshops, Meetings, Seminars and Annual Day Organized Conferences, Workshops, Meetings, Seminars and Annual Day Organized Dr. Ajit As Organizing Secretary organized the Eighteenth National Conference of Agricultural Research Statisticians at ICAR-Indian Institute

More information

LIST OF RESEARCH PROJECTS

LIST OF RESEARCH PROJECTS Annexure-I LIST OF RESEARCH PROJECTS DEVELOPMENT AND ANALYSIS OF EXPERIMENTAL DESIGNS FOR AGRICULTURAL SYSTEMS RESEARCH ICAR National Professor Scheme 1. Designs for single factor and multi-factor experiments

More information

Remote Sensing for Agricultural Applications

Remote Sensing for Agricultural Applications Remote Sensing for Agricultural Applications Shibendu S. Ray Mahalanobis National Crop Forecast Centre Department of Agriculture, Cooperation & Farmers Welfare, New Delhi shibendu.ncfc@gov.in GeoSmart

More information

Muhammad Musa, Ph.D. Senior Program Specialist (Crops) SAARC Agriculture Centre, Dhaka Bangladesh

Muhammad Musa, Ph.D. Senior Program Specialist (Crops) SAARC Agriculture Centre, Dhaka Bangladesh Agriculture Centre SAARC Muhammad Musa, Ph.D. Senior Program Specialist (Crops), Dhaka Bangladesh Challenges Food production situation in South Asia population vis-à-vis production levels Poverty (37%)

More information

FASAL: The Operational Programme for Crop Assessment in India

FASAL: The Operational Programme for Crop Assessment in India FASAL: The Operational Programme for Crop Assessment in India 23 Jul, 17 Aug, 11 Sep 2015 13 Jul, 7 Aug, 1 Sep 2014 Neetu Mahalanobis National Crop Forecast Centre Ministry of Agriculture & Farmers Welfare,

More information

Biofortification in selected crops for nutritional security. Coordinator: Project Director, Directorate of Rice Research

Biofortification in selected crops for nutritional security. Coordinator: Project Director, Directorate of Rice Research ICAR Agri-Consortia Research Platforms (Agri-CRP) Biofortification in selected crops for nutritional security Coordinator: Project Director, Directorate of Rice Research Billions of people around the world

More information

Citizen s/client s Charter. for. Crop Science Division ( )

Citizen s/client s Charter. for. Crop Science Division ( ) Citizen s/client s Charter for Crop Science Division (2014-2015) Address: Indian Council of Agricultural (ICAR) Krishi Bhawan, Dr. Rajendra Prasad Road New Delhi - 110001 Website ID : www.icar.org.in Date

More information

Space Technology for Decision Support in Agriculture

Space Technology for Decision Support in Agriculture Space Technology for Decision Support in Agriculture Shibendu Shankar Ray Department of Agriculture, Cooperation & Farmers Welfare New Delhi 110 012, India www.ncfc.gov.in, shibendu.ncfc@nic.in Indian

More information

Crop Assessment using Space, Agro-Meteorology & Land based observations : Indian Experience

Crop Assessment using Space, Agro-Meteorology & Land based observations : Indian Experience Crop Assessment using Space, Agro-Meteorology & Land based observations : Indian Experience Shibendu S. Ray Mahalanobis National Crop Forecast Centre Department of Agriculture, Cooperation & Farmers Welfare,

More information

Chapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction

Chapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction Chapter 1 Molecular Genetic Approaches to Maize Improvement an Introduction Robert T. Fraley In the following chapters prominent scientists will discuss the recent genetic improvements in maize that have

More information

Strengthening biosafety compliance among public sector institutions in India: A SABP Initiative. Dr. Vibha Ahuja, Chief General Manager, BCIL

Strengthening biosafety compliance among public sector institutions in India: A SABP Initiative. Dr. Vibha Ahuja, Chief General Manager, BCIL Strengthening biosafety compliance among public sector institutions in India: A SABP Initiative Dr. Vibha Ahuja, Chief General Manager, BCIL Structure of presentation Biosafety Regulations in India South

More information

India, Agriculture and ARD

India, Agriculture and ARD India, Agriculture and ARD Global Conference on Agricultural Research for Development S.K. Datta Deputy Director General Indian Council of Agricultural Research Everything can wait but not agriculture

More information

Name : Dr. Sanjeev K Banyal Designation : Assistant Professor Qualification : Ph. D. Discipline : Horticulture

Name : Dr. Sanjeev K Banyal Designation : Assistant Professor Qualification : Ph. D. Discipline : Horticulture Name : Dr. Sanjeev K Banyal Designation : Assistant Professor Qualification : Ph. D. Discipline : Horticulture Specialization : Fruit Science Contact details Phone (M) : 9418059914 Email: skbanyal@gmail.com

More information

Biosafety Issues and Bt cotton A case study. O. P. GOVILA Retd. Professor Genetics IARI

Biosafety Issues and Bt cotton A case study. O. P. GOVILA Retd. Professor Genetics IARI Biosafety Issues and Bt cotton A case study O. P. GOVILA Retd. Professor Genetics IARI Introduction Classical plant breeding is limited to the introduction of required characters into plant by genetic

More information

Ensuring Remunerative Prices to Farmers Challenges and the Way Forward

Ensuring Remunerative Prices to Farmers Challenges and the Way Forward Ensuring Remunerative Prices to Farmers Challenges and the Way Forward Surabhi Mittal, P K Joshi, Avinash Kishore and Suresh Pal * Background Doubling farmers income by 2022 is a paradigm shift in transforming

More information

Results-Framework Document (RFD) for

Results-Framework Document (RFD) for Results-Framework Document (RFD) for Horticulture Division (1 st April, 11-31 st March, 12) INDIAN COUNCIL OF AGRICULTURAL RESEARCH KRISHI BHAWAN, NEW DELHI 110 114 Section 1: Vision, Mission, Objectives

More information

Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco

Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS. Texas A&M AgriLife Research and Extension Center at Weslaco Texas A&M AgriLife Research LOWER RIO GRANDE VALLEY REGION RESEARCH GOALS AND IMPACTS Texas A&M AgriLife Research and Extension Center at Weslaco 2015 GOAL Protect water quality and increase the amount

More information

Project Proposal. Establishment of Seed Processing Infrastructure Facilities for Vegetable Crops

Project Proposal. Establishment of Seed Processing Infrastructure Facilities for Vegetable Crops 123 Project Proposal on Establishment of Seed Processing Infrastructure Facilities for Vegetable Crops Under National Horticulture Mission Lucknow, Uttar Pradesh By M/s ------------------------------------------------------------------

More information

Government of India s Perspective and Initiatives on Integration of Future Smart Food in Rice-Fallows

Government of India s Perspective and Initiatives on Integration of Future Smart Food in Rice-Fallows Government of India s Perspective and Initiatives on Integration of Future Smart Food in Rice-Fallows Dr. B. Rajender, Joint Secretary (Crops & Oilseeds) Department of Agriculture, Cooperation & Farmers

More information

HIND AGRICULTURAL RESEARCH AND TRAINING INSTITUTE

HIND AGRICULTURAL RESEARCH AND TRAINING INSTITUTE Role of ICAR in Indian Agricultural Development RASHTRIYA KRISHI Volume 12 Issue 1 June, 2017 49-59 e ISSN 2321 7987 Article Visit us : www.researchjournal.co.in Role of ICAR in Indian Agricultural Development

More information

The test results of a new sowing app for groundnut. New sowing application increases yield by 30% January 2017, No

The test results of a new sowing app for groundnut. New sowing application increases yield by 30% January 2017, No Happenings Newsletter January 2017, No. 1737 Feature Stories New sowing application increases yield by 30% Photo: S Punna, ICRISAT Rameswari Devi at her field in Devanakonda, Andhra Pradesh. The test results

More information

13. Agricultural Economics, Marketing and Statistics

13. Agricultural Economics, Marketing and Statistics 13. Agricultural Economics, Marketing and Statistics 76 Challenges to ensuring global food security through wheat: Technological breakthrough in wheat, popularly known as green revolution technology, and

More information

Sreedhar Patil 5/30/2013

Sreedhar Patil 5/30/2013 Farming in India Sreedhar Patil 5/30/2013 Location of India in World Map States in India Bangalore, Karnataka, INDIA 28 states and seven union territories Annual Rainfall in India Rivers in India River

More information

Future Action Plan of Biotechnology in Sri Lanka

Future Action Plan of Biotechnology in Sri Lanka Future Action Plan of Biotechnology in Sri Lanka Prof. Rohan Rajapakse, Executive Director Sri Lanka Council for Agricultural Research Policy Contents Project Objectives National Agricultural Biotechnology

More information

Legumes are the 3 rd largest family of flowering plants

Legumes are the 3 rd largest family of flowering plants What s a Pulse? Legumes are the 3 rd largest family of flowering plants Second only to grasses in agricultural importance Keystone family for nutrition Pulses are legumes of which we eat the seed Why legumes?

More information

Food Security through Rice bean Research in India and Nepal (FOSRIN) Dr. Naveen Kumar

Food Security through Rice bean Research in India and Nepal (FOSRIN) Dr. Naveen Kumar Food Security through Rice bean Research in India and Nepal (FOSRIN) Dr. Naveen Kumar Scientist Agronomy Fodder Production and Grassland Management Centre CSKHPKV, Palampur Distt. Kangra (HP) India-176

More information

Sustainable Agricultural Mechanization in India Strategy and Long-term Policies

Sustainable Agricultural Mechanization in India Strategy and Long-term Policies Sustainable Agricultural Mechanization in India Strategy and Long-term Policies Dr. Kanchan K. Singh A.D.G. (Engg.) Indian Council of Agricultural Research New Delhi, INDIA 5 th Regional Forum on Sustainable

More information

Rice bean in India with Particular Emphasis on the Himalayan Region

Rice bean in India with Particular Emphasis on the Himalayan Region Rice bean in India with Particular Emphasis on the Himalayan Region M. Dutta Prof & Head, Dept. of Crop Improvement and TPL, Plant Breeding, AICRN on UC (ICAR) GBPUAT, Hill Campus, Ranichauri, Uttarakhand,

More information

Indo Swiss Collaboration in Biotechnology (ISCB)

Indo Swiss Collaboration in Biotechnology (ISCB) Indo Swiss Collaboration in Biotechnology (ISCB) The Indo-Swiss Collaboration in Biotechnology (ISCB) was established in 1974 as a capacity building programme supported by the Swiss Agency for Development

More information

India Organic Food Market Forecast & Opportunities, 2017

India Organic Food Market Forecast & Opportunities, 2017 Organic Food Market Market Size Organic food market in India is likely to treble in four years organic food market in India at $0.36 billion in 2014 According to India Organic Food Market Forecast & Opportunities,

More information

Human Resource Development of Agricultural Mechanization in India: Policy and Status. K. K. Singh

Human Resource Development of Agricultural Mechanization in India: Policy and Status. K. K. Singh Human Resource Development of Agricultural Mechanization in India: Policy and Status K. K. Singh Director ICAR-Central Institute of Agricultural Engineering Nabi Bagh, Berasia Road, Bhopal-462038.India

More information

GOVERNMENT OF INDIA MINISTRY OF AGRICULTURE AND FARMERS WELFARE DEPARTMENT OF AGRICULTURAL RESEARCH & EDUCATION

GOVERNMENT OF INDIA MINISTRY OF AGRICULTURE AND FARMERS WELFARE DEPARTMENT OF AGRICULTURAL RESEARCH & EDUCATION GOVERNMENT OF INDIA MINISTRY OF AGRICULTURE AND FARMERS WELFARE DEPARTMENT OF AGRICULTURAL RESEARCH & EDUCATION LOK SABHA UNSTARRED QUESTION NO. 2715 TO BE ANSWERED ON 02/08/2016 AGRICULTURAL ENGINEERING

More information

Science to Support Plant Protection for Horticulture AAFC s Science & Technology Branch

Science to Support Plant Protection for Horticulture AAFC s Science & Technology Branch Science to Support Plant Protection for Horticulture AAFC s Science & Technology Branch Crop, Plant Protection and the Environment Committee March 15, 2018 Dr. Della Johnston Outline Strategic direction

More information

From Genotype to Phenotype

From Genotype to Phenotype From Genotype to Phenotype Johanna Vilkki Green technology, Natural Resources Institute Finland Systems biology Genome Transcriptome genes mrna Genotyping methodology SNP TOOLS, WG SEQUENCING Functional

More information

Indian Seed Sector : The Way Forward 1

Indian Seed Sector : The Way Forward 1 Indian Seed Sector : The Way Forward 1 R.S. Paroda Former Director General, ICAR and Secretary, DARE, Govt. of India Dear Members of NSAI, It gives me immense pleasure to be with your again this evening.

More information

Central Institute of Brackishwater Aquaculture, Indian Council of Agricultural Research 75, Santhome High Road, R.A.Puram, Chennai

Central Institute of Brackishwater Aquaculture, Indian Council of Agricultural Research 75, Santhome High Road, R.A.Puram, Chennai Introduction Central Institute of Brackishwater Aquaculture, Indian Council of Agricultural Research 75, Santhome High Road, R.A.Puram, Chennai 600028 Strategic Plan 2010-2015 for RFD of CIBA 2010-2011

More information

Outline of Presentation

Outline of Presentation Seed Production Systems in Pulse Crops in India- Community based perspectives, Outline of Presentation Dr J S Sandhu Agriculture Commissioner Ministry Of Agriculture Government Of India Email- ag.comm@nic.in

More information

Construction of an Integrated Database on Biosafety and use of GMOs in India

Construction of an Integrated Database on Biosafety and use of GMOs in India FINAL TECHNICAL REPORT Construction of an Integrated Database on Biosafety and use of GMOs in India Principal Investigator : Dr. T. R. Sharma Coordinator : Prof. K.R. Koundal Co- Investigators: Dr. K.

More information

U.S. Government Funding for Prebreeding: Role of the Private Sector. Nora Lapitan and Jennifer Long US Agency for International Development

U.S. Government Funding for Prebreeding: Role of the Private Sector. Nora Lapitan and Jennifer Long US Agency for International Development U.S. Government Funding for Prebreeding: Insights, Forecast and the Role of the Private Sector Nora Lapitan and Jennifer Long US Agency for International Development Outline How US Federal funding agencies

More information

Improving methods for estimating post harvest losses

Improving methods for estimating post harvest losses Broad Topic Sub Topics/ Papers Reviewed Report Improving methods for estimating post harvest losses Post Harvest Food Losses Estimation - Development of Consistent Methodology by Jaspreet Aulakh and Anita

More information

Impact Assessment of Agricultural Extension Reforms in Bihar. K.M. Singh 1, M.S. Meena 2 and A.K. Jha 3 ABSTRACT

Impact Assessment of Agricultural Extension Reforms in Bihar. K.M. Singh 1, M.S. Meena 2 and A.K. Jha 3 ABSTRACT 110 Indian Res. J Ext. Edu. 9 (2 ), May 2009 Impact Assessment of Agricultural Extension Reforms in Bihar K.M. Singh 1, M.S. Meena 2 and A.K. Jha 3 1. Head, 2. Sr.Scientist (Agril. Ext.), Division of Socio

More information

14 Indian Res. J. Ext. Edu. 11 ( 3 ), September, Issues Related to Low Productivity of Maize in Haryana

14 Indian Res. J. Ext. Edu. 11 ( 3 ), September, Issues Related to Low Productivity of Maize in Haryana 14 Indian Res. J. Ext. Edu. 11 ( 3 ), September, 2011 Issues Related to Low Productivity of Maize in Haryana V.K. Yadav 1, P. Supriya², Shailesh Kumar 3 and C.Y. Manikanhaiya 4 1. Sr. Scientist (Agril.

More information

Study-IQ education

Study-IQ education Science & Tech Target- 2018 (Series-7) BIOTECHNOLOGY By Dr. Ravi P. Agrahari - Scientist in IIT Delhi - Author of Mc Graw Hill Publication for Science & Technology - last 17 years teaching experience for

More information

Class IX Chapter 15 Improvement in Food Resources Science

Class IX Chapter 15 Improvement in Food Resources Science What do we get from cereals, pulses, fruits and vegetables? (i) Cereals provide us with carbohydrates. Also, they are a rich source of energy. (ii) Pulses give us proteins. (iii) Fruits and vegetables

More information

Question 1: What do we get from cereals, pulses, fruits and vegetables? (i) Cereals provide us with carbohydrates. Also, they are a rich source of energy. (ii) Pulses give us proteins. (iii) Fruits and

More information

Importance of Gramin Krishi Mousam Sewa in Hill Region of West Bengal

Importance of Gramin Krishi Mousam Sewa in Hill Region of West Bengal International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 03 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.703.284

More information

Bioinformatics, in general, deals with the following important biological data:

Bioinformatics, in general, deals with the following important biological data: Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,

More information

Biofortified Varieties: Sustainable Way to Alleviate Malnutrition

Biofortified Varieties: Sustainable Way to Alleviate Malnutrition Biofortified Varieties: Sustainable Way to Alleviate Malnutrition Indian Council of Agricultural Research New Delhi 110 001 Biofortified Varieties: Sustainable Way to Alleviate Malnutrition Indian Council

More information

Biofortified Varieties: Sustainable Way to Alleviate Malnutrition

Biofortified Varieties: Sustainable Way to Alleviate Malnutrition Biofortified Varieties: Sustainable Way to Alleviate Malnutrition Indian Council of Agricultural Research New Delhi 110 001 Biofortified Varieties: Sustainable Way to Alleviate Malnutrition Indian Council

More information

Class IX Chapter 15 Improvement in Food Resources Science

Class IX Chapter 15 Improvement in Food Resources Science Class IX Chapter 15 Improvement in Food Resources Science Question 1: What do we get from cereals, pulses, fruits and vegetables? (i) Cereals provide us with carbohydrates. Also, they are a rich source

More information

INTRA AND INTER CLUSTER STUDIES FOR QUANTITATIVE TRAITS IN GARLIC (Allium sativum L)

INTRA AND INTER CLUSTER STUDIES FOR QUANTITATIVE TRAITS IN GARLIC (Allium sativum L) SAARC J. Agri., 11(2): 61-67 (2013) INTRA AND INTER CLUSTER STUDIES FOR QUANTITATIVE TRAITS IN GARLIC (Allium sativum L) R. K. Singh *, B. K. Dubey and R. P. Gupta National Horticultural Research and Development

More information

National Vegetable Initiative for Urban Clusters

National Vegetable Initiative for Urban Clusters Operational Guidelines for MANAGEMENT SUPPORT GROUP FOR National Vegetable Initiative for Urban Clusters SMALL FARMERS AGRIBUSINESS CONSORTIUM Department of Agriculture & Cooperation 1. INTRODUCTION 1.1.

More information

Paper No.: 02. Paper Title: PRINCIPLES OF THE FOOD PROCESSING & PRESERVATION

Paper No.: 02. Paper Title: PRINCIPLES OF THE FOOD PROCESSING & PRESERVATION Paper No.: 02 Paper Title: PRINCIPLES OF THE FOOD PROCESSING & PRESERVATION Module 01: Scope of Food Processing in India with National and International Perspective Paper Coordinator: Dr. P. Narender Raju,

More information

Information Support to Stakeholders through ATIC S Web Pages

Information Support to Stakeholders through ATIC S Web Pages Vol.3 No. 2, 47-53 (2014) Received: Feb.2014; Accepted: Oct, 2014 Information Support to Stakeholders through ATIC S Web Pages D.S. Sheoran 1 and Jogender Singh 2 1.Department of Extension Education, CCSHAU,

More information

Champions of the Poor of the Semi-Arid Tropics

Champions of the Poor of the Semi-Arid Tropics ICRISAT and Partners Champions of the Poor of the Semi-Arid Tropics William D. Dar Director General, ICRISAT This presentation The context Our research heartland Major outputs and impacts Moving into the

More information

1.0 VISION 2.0 MISSION 3.0 OBJECTIVES 4.0 BIOTECHNOLOGY

1.0 VISION 2.0 MISSION 3.0 OBJECTIVES 4.0 BIOTECHNOLOGY 1.0 VISION Uttar Pradesh to become more prosperous State through utilizing modern tools of biotechnologybringing prosperity to farmers, generating employment in rural areas, food for all, Good health and

More information

Results-Framework Document (RFD)

Results-Framework Document (RFD) Results-Framework Document (RFD) for National Centre for Agricultural Economics and Policy Research (2012-2013) P.B.No.11305, Dev Prakash Shastri Marg, Pusa, New Delhi 110 012 www.ncap.res.in Page 1 of

More information

Molecular Techniques to Assess Microbial Community Structure and identification. January 2-9, 2017

Molecular Techniques to Assess Microbial Community Structure and identification. January 2-9, 2017 Molecular Techniques to Assess Microbial Community Structure and identification January 2-9, 2017 INTRODUCTION Microbes make up most of the biodiversity on Earth, and several of the processes which microorganisms

More information

RFD. Results Framework Document For. Central Rice Research Institute ( )

RFD. Results Framework Document For. Central Rice Research Institute ( ) RFD Results Framework Document For Central Rice Research Institute ( 2012) Vision Section 1: Vision, Mission, Objectives and Functions Food and nutritional security through sustainable rice. Mission To

More information

RECRUITMENTS OF SCIENTISTS: DIRECT RECRUITMENT OR ON DEPUTATION. Areas of specialization as essential qualifications: [Advt. No.NABI/02/2017/Rectt.

RECRUITMENTS OF SCIENTISTS: DIRECT RECRUITMENT OR ON DEPUTATION. Areas of specialization as essential qualifications: [Advt. No.NABI/02/2017/Rectt. National Agri-Food Biotechnology Institute (NABI) (Department of Biotechnology, Ministry of Science and Technology, Govt of India) Knowledge city, Sector-81, Mohali, (Punjab), India-140306 Web: www.nabi.res.in

More information

Chapter 15: Improvement in Food Resources Science

Chapter 15: Improvement in Food Resources Science Chapter 15: Improvement in Food Resources Science Page No: 204 1. What do we get from cereals, pulses, fruits and vegetables? Cereals provide us with carbohydrates. Also, they are a rich source of energy.

More information

13. Agricultural Economics, Marketing and Statistics

13. Agricultural Economics, Marketing and Statistics 13. Agricultural Economics, Marketing and Statistics The principles of economics as applied to production of crops and livestock are mainly focused on maximizing yields while maintaining a good ecosystem.

More information

Data science and precision farming

Data science and precision farming Data science and precision farming Agriculture and Earth Observation workshop 4 5 July 2017 Dutch Ministry of Economic Affairs The Hague, The Netherlands Prof. Jakob de Vlieg Applied Data Science, JADS

More information

Annexure-I Terms of Reference for consultant to assist in preparation of a draft report on the State of Indian Agriculture

Annexure-I Terms of Reference for consultant to assist in preparation of a draft report on the State of Indian Agriculture Annexure-I Terms of Reference for consultant to assist in preparation of a draft report on the State of Indian Agriculture 2013-14 1. The draft report on the State of Indian Agriculture should be prepared

More information

Agriculture. List of Tables

Agriculture. List of Tables Agriculture List of Tables 7.1: Area Production and yield of Agricultural Crops in Sikkim (Part-A) 7.2: Area Production and yield of Agricultural Crops (Part-B) 7.3: Area Production and yield of Agricultural

More information

Drought Monitoring & Management An Indian Experience

Drought Monitoring & Management An Indian Experience Drought Monitoring & Management An Indian Experience Ravinder Kaur Project Director Water Technology Center Indian Agricultural Research Institute, New Delhi Email: pd_wtc@iari.res.in Spatial and Temporal

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

1 What are three cropping seasons of India? Explain any one in brief. 2 Discuss three main impacts of globalization on Indian agriculture.

1 What are three cropping seasons of India? Explain any one in brief. 2 Discuss three main impacts of globalization on Indian agriculture. 1 What are three cropping seasons of India? Explain any one in brief. 2 Discuss three main impacts of globalization on Indian agriculture. 3.Distinguish between rabi and kharif season? 4. What is Horticulture?

More information

Plant cultivation on moving field conveyer system and various imaging platforms in Nanaji Deshmukh Plant Phenomics Centre at ICAR-IARI, New Delhi

Plant cultivation on moving field conveyer system and various imaging platforms in Nanaji Deshmukh Plant Phenomics Centre at ICAR-IARI, New Delhi Hon ble Prime Minister Shri. Narendra Modi dedicated the "Nanaji Deshmukh Plant Phenomics Centre" at ICAR-IARI, New Delhi to the Nation on 11 th October 2017 Development of climate resilient crop varieties

More information

Acharya.N.G.Ranga Agricultural University, Rajendranagar, Hyderabad. Course No: AGRO 101

Acharya.N.G.Ranga Agricultural University, Rajendranagar, Hyderabad. Course No: AGRO 101 Acharya.N.G.Ranga Agricultural University, Rajendranagar, Hyderabad. 1 Course No: AGRO 101 Course Title: Principles of Agronomy and Agricultural Meteorology Credit Hours: 3(2+1) Dr.A. Pratap Kumar Reddy,

More information

Pulses strategy for sustainable food and nutritional security in SAARC region. Mohan C. Saxena

Pulses strategy for sustainable food and nutritional security in SAARC region. Mohan C. Saxena Pulses strategy for sustainable food and nutritional security in SAARC region Mohan C. Saxena Outline Importance of pulses Availability of pulses in SAARC region & its nutritional implications Challenges

More information

Eradicating hunger & malnutrition

Eradicating hunger & malnutrition Eradicating hunger & malnutrition The biggest challenge of our time Agricultural biodiversity is a prerequisite for sustainable agriculture and food security 2 Agriculture Facing its biggest challenge

More information

Indian Institute of Soil Science

Indian Institute of Soil Science Indian Institute of Soil Science Bhopal Courses 1. Farmers Resource Based Site Specific Nutrient Management in Different Production Systems 2. Advanced Methods of Soil and Plant Analysis 3. Recent Advances

More information

10. BIOTECHNOLOGY (Code No. 045)

10. BIOTECHNOLOGY (Code No. 045) 10. BIOTECHNOLOGY (Code No. 045) An unprecedented growth of human knowledge in the field of Biological Sciences coupled with equally significant developments in the field of technology have brought significant

More information

Phone: (o) Vegetable Breeding

Phone: (o) Vegetable Breeding Name : Dr. Deepa Sharma Designation : Assistant Scientist Qualification : Ph. D. Fellowship/Awards : Highest OGPA during M.Sc. Gold Medal recipient in Ph. D. Merit scholarship during B.Sc. programme Discipline

More information

A Study on the performance of agricultural sector in India

A Study on the performance of agricultural sector in India Indian J. Agric. Res., 51 (3) 2017 : 282-286 Print ISSN:0367-8245 / Online ISSN:0976-058X AGRICULTURAL RESEARCH COMMUNICATION CENTRE www.arccjournals.com/www.ijarjournal.com A Study on the performance

More information

AGRICULTURE. Agriculture and Crop Production. Genetics, Plant Breeding and Microbiology 15. Livestock Production 5 Scope and Importance

AGRICULTURE. Agriculture and Crop Production. Genetics, Plant Breeding and Microbiology 15. Livestock Production 5 Scope and Importance AGRICULTURE Course Structure Part Section Unit Topics Marks A Agriculture and Crop Production I 1 Scope and Importance 2 Physical Environment 3 Agriculture Economics 30 B Genetics, Plant Breeding and Microbiology

More information

Plant Breeding as an integral part of Sustainable Agriculture

Plant Breeding as an integral part of Sustainable Agriculture 2 Plant Breeding as an integral part of Sustainable Agriculture Dr. Dirk Zimmermann Sustainable Agriculture Campaigner Greenpeace Germany International Cotton Conference, Bremen, 17.03.2016 dirk.zimmermann@greenpeace.de

More information

VISION ICAR Zonal Project Directorate, Zone II. Bhumi Vihar Complex, Block GB, Sector III Salt Lake City Kolkata

VISION ICAR Zonal Project Directorate, Zone II. Bhumi Vihar Complex, Block GB, Sector III Salt Lake City Kolkata VISION 2050 ICAR Zonal Project Directorate, Zone II Bhumi Vihar Complex, Block GB, Sector III Salt Lake City Kolkata 700097 1 The context Agriculture is a critical sector of the Indian economy. Contribution

More information

SOCIO-ECONOMIC PROFILE OF WOMEN GOAT KEEPERS AND REARING CHALLANGES IN GOAT IN NADIA DISTRICT OF WEST BENGAL

SOCIO-ECONOMIC PROFILE OF WOMEN GOAT KEEPERS AND REARING CHALLANGES IN GOAT IN NADIA DISTRICT OF WEST BENGAL International Journal of Science, Environment and Technology, Vol. 4, No 2, 2015, 331 336 ISSN 2278-3687 (O) 2277-663X (P) SOCIO-ECONOMIC PROFILE OF WOMEN GOAT KEEPERS AND REARING CHALLANGES IN GOAT IN

More information

Chapter 4 Agriculture

Chapter 4 Agriculture Chapter 4 Agriculture Types of Farming Primitive Subsistence Farming Practiced on small patches of land. Involves family/community labour. Uses primitive tools such as hoe, digging sticks etc. Predominance

More information

Dr K C Bansal, Director, NBPGR made a presentation on PGR Management: Current status, future strategies and thrust areas for the 12 th Five Year Plan.

Dr K C Bansal, Director, NBPGR made a presentation on PGR Management: Current status, future strategies and thrust areas for the 12 th Five Year Plan. Proceedings of the 1 st Meeting of the National Advisory Board on Management of Genetic Resources, December 13, 2011and held at NBPGR, New Delhi -110012 The 1 st meeting of the National Advisory Board

More information

Promoting Women in Science

Promoting Women in Science Promoting Women in Science Initiatives of Department of Biotechnology Department of Biotechnology Ministry of Science & Technology Government of India Department of Biotechnology Set up in 1986 Focus Research

More information

DIRECTORATE OF SEED RESEARCH. cht vuqla/kku funs kky; VISION 2030

DIRECTORATE OF SEED RESEARCH. cht vuqla/kku funs kky; VISION 2030 DIRECTORATE OF SEED RESEARCH cht vuqla/kku funs kky; VISION 2030 (Indian Council of Agricultural Research) Kushmaur, Kaithauli, Mau 275 101(U.P.) www.dsr.org.in VISION 2030 Kushmaur, Kaithauli Mau 275

More information

Development of Climate Resilient Villages

Development of Climate Resilient Villages Development of Climate Resilient Villages Alok Sikka, YG Prasad, Ch. Srinivasa Rao Indian Council of Agricultural Research, New Delhi, India Montpellier March 16 18, 2015 Climate Change Projections India

More information

Indian Institute of Soil Science

Indian Institute of Soil Science Indian Institute of Soil Science Bhopal Courses 1. Farmers Resource Based Site Specific Nutrient Management in Different Production Systems 2. Advanced Methods of Soil and Plant Analysis 3. Recent Advances

More information

Page 1 of 6. Agriculture. I. Answer the Following

Page 1 of 6. Agriculture. I. Answer the Following Agriculture Page 1 of 6 I. Answer the Following Q1. What is the importance of agriculture in the Indian economy? Ans. Two-thirds of India s population is engaged in agricultural activities. Agriculture

More information

Preclinical Toxicology of GM Crops. Dr. B. Sesikeran, MD, FAMS Director National Institute of Nutrition (ICMR) Hyderabad

Preclinical Toxicology of GM Crops. Dr. B. Sesikeran, MD, FAMS Director National Institute of Nutrition (ICMR) Hyderabad Preclinical Toxicology of GM Crops Dr. B. Sesikeran, MD, FAMS Director National Institute of Nutrition (ICMR) Hyderabad 500 007 1 Status of genetic modification of crops Existing: Simple modifications

More information

Harnessing Biotechnology for Food Security in the Asia-Pacific Region

Harnessing Biotechnology for Food Security in the Asia-Pacific Region Technical Conference on Agricultural Biotechnologies in Developing Countries: Options and opportunities in crops, forestry, livestock, fisheries and agro-industry to face the challenges of food insecurity

More information

Sunil Jain, Sankarsana Sahoo, Kumar Sundaram, Pramod Kumar

Sunil Jain, Sankarsana Sahoo, Kumar Sundaram, Pramod Kumar Sunil Jain, Sankarsana Sahoo, Kumar Sundaram, Pramod Kumar Plan of Presentation Methodology of GVA Estimation of Crop Sector Methodology for GVA of Crop sector on Financial Year basis. Methodology for

More information

Indian Chem 2018 Indian Agrochemical Market Scenario and opportunities. Mr. Harsh Dhanuka Vice President, Dhanuka Agritech Ltd.

Indian Chem 2018 Indian Agrochemical Market Scenario and opportunities. Mr. Harsh Dhanuka Vice President, Dhanuka Agritech Ltd. Indian Chem 2018 Indian Agrochemical Market Scenario and opportunities Mr. Harsh Dhanuka Vice President, Dhanuka Agritech Ltd. 1 CONTENTS India - Country Of Vast Opportunity Indian Agriculture Global Outlook

More information

Bioengineered Crops as Tools for Colombian Agricultural Development

Bioengineered Crops as Tools for Colombian Agricultural Development Bioengineered Crops as Tools for Colombian Agricultural Development Opportunities and Strategic Considerations Peter Gregory, Ph.D pg46@cornell.edu Agricultural Biotechnology Consultant International Professor

More information

6.3 Farmers rights, their scope and legal protection in India

6.3 Farmers rights, their scope and legal protection in India 6.3 Farmers rights, their scope and legal protection in India S.P. Bala Ravi Farmers contributions to the development of plant genetic resources Today, we understand and appreciate the importance of plant

More information