Online Data Supplement Airway specific inducible transgene expression using aerosolized doxycycline

Transcription

1 Online Data Supplement Airway specific inducible transgene expression using aerosolized doxycycline Purushothama Rao Tata, Ana Pardo-Saganta, Mythili Prabhu, Vladimir Vinarsky, Brandon M. Law, Benjamin A. Fontaine, Andrew M. Tager, Jayaraj Rajagopal

2 Supplementary materials and methods: Mouse models Rosa26-rtTA, Col1a1-tet(O)H2BGFP knock-in mice were kindly provided by Hanno Hock (MGH, Boston, MA) and these mice were previously described (25). CK5-rtTA transgenic mouse were previously generated by cloning the rtta coding sequence downstream of the bovine CK5 promoter (21). The tet(o)h2bgfp mouse strain was obtained from the Jackson Laboratory (Tg(tetO-HIST1H2BJ/GFP)47Efu/J; stock #514). This transgenic mouse expresses the human histone 1 and GFP fusion protein, HIST1H2BJ/GFP, under the control of a tetracycline-responsive promoter element (TRE; teto) (24). We mated the CK5-rtTA mouse to the tet(o)h2bgfp mouse to generate a doubletransgenic mouse that contains both transgenic elements to drive GFP expression upon doxycycline administration. Tet(O)Cre and R26-LSL-NICD mice were purchased from Jackson Laboratory (Bar Harbor, ME). All mice were maintained in a pathogen free environment and supplied with food and water ad libitum. Animal studies were approved by the Subcommittee on Research Animal Care at the MGH in accordance with NIH guidelines. In each experiment at least 4 mice were used and each experiment was repeated at least 2 times. Immunofluorescence and cell quantification: Trachea, lungs, skin, heart, liver, pancreas and spleen were dissected and fixed in 4% PFA for 2 hours at 4 C followed by two washes in, and then embedded in OCT. Cryosections (6 micrometers) were permeabilized with.1% Triton X-1 in, blocked in 1% BSA for 3 minutes at room temperature, incubated with primary antibodies for 1 hour at room temperature, washed, incubated with secondary antibodies diluted in blocking buffer for 1 hour at room temperature, washed, and counterstained with DAPI. Primary antibodies: goat anti-cc1 (1:5; kindly provided by Barry Stripp); mouse IgG1 anti-muc5a/c (1:25; MS-145, Thermo Scientific); mouse IgG1 anti-

3 FoxJ1 (1:5; , ebioscience), rabbit anti-cytokeratin 5 (1:1; ab53121, Abcam), Rat anti-epcam (1:2; ebioscience), Rat anti-pecam (1:2; ebioscience) and Rabbit anti-asma (1:5, Abcam). BrdU incorporation was detected using Amersham Cell Proliferation Kit (RPN2, GE Healthcare). All secondary antibodies were Alexa Fluor conjugates (488 and 594) and used at 1:5 dilution (Life Technologies). Images were obtained using Olympus IX81 Inverted microscope (Olympus, Center Valley, PA) and processed them using Image J software ( Cells were manually counted based on immunofluorescence staining of markers for each of the respective cell types. We used the basement membrane as a boundary mark to quantify the number of reporter-expressing cells in the airway and non-airway cells from the trachea and lungs. The percentages of cells were calculated based on the ratio of reporterexpressing cells to the total number of DAPI cells counted. Quantitative RT-PCR: Total RNA was extracted from airway epithelial cells to analyze gene expression by RT-PCR. A Papain Dissociation System (Worthington Biochemical Corporation, Lakewood, NJ) was used to isolate airway epithelial cells of each animal (n=3 per experiment). Total RNA was extracted using an RNeasy mini kit (Qiagen), and 2 μg of RNA was treated with DNase I (Invitrogen, Life technologies) prior to reverse transcription with Superscript-III Reverse Transcriptase (Invitrogen, Life technologies) in the presence of RNaseOUT (Invitrogen, Life technologies). RT-PCR was performed using Taq DNA polymerase (Sigma). Primer sequences are as follow: Gapdh: Forward 5 aactttggcattgtggaagg 3 and reverse 5 acacattgggggtaggaaca 3 ; GFP: Forward 5 gttcatctgcaccaccggcaag 3 and reverse 5 cttgaagaagatggtgcgctcctg 3 ; Flow cytometry

4 In order to isolate airway epithelial cells and non-airway epithelial cells from R26- H2BGFP mice we have performed sequential double enzymatic cell dissociation. In the first phase, epithelial cells from R26-H2BGFP mice were isolated using the Papain Dissociation System (Worthington Biochemical Corporation, Lakewood, NJ) for 9 minutes at 37 C on a rocker. Dissociated cells were filtered through 75 micron cell strainers (75 microns) and collected into a falcon tube. In parallel, rthe emaining tissues were collected into a tube and use for a second enzymatic digestion as described below. Dissociated cells were incubated with ovo-mucoid inhibitor as per the manufacturer s instruction for 2 mins at 4C on a rocker. Then cells were washed in 5%FCS/ and antibody staining was performed as described below. To liberate non-airway epithelial cells, the remaining tissue from above was treated with.1%trypsin with 1.6µM EDTA for 3 mins at 37 C on a rocker. Then the dissociated tissues were filtered as described above and washed with 5%FCS/. Dissociated cells were stained with EpCAM-PECy7 (1:5; , ebiosciences) for 3 min in 2.5% FBS in on ice. After washing, EpCAM+ GFP+ cells were acquired using LSRII flow cytometer (BD, San Jose, CA). Data were analyzed on Flowjo (9.2 version). Mouse BAL Mouse lungs were lavaged with six successive.5-ml aliquots of with.6 mm EDTA (3 ml in total). These BAL samples were centrifuged at 54 g, at 4 C, for 5 minutes. The BAL supernatants were transferred into siliconized, lowbinding microcentrifuge tubes (Fisher Scientific) for subsequent analysis. The BAL cell pellets were resuspended in for determinations of cell count and cytospin analysis. BAL cell counts BAL total cell counts were determined using a Cellometer Auto T4 (Nexcelom, Lawrence, MA) cell counter. Total leukocytes (obtained by excluding the percentages of red blood cells) and percentages of mononuclear cells and

5 granulocytes were determined in preparations of cells centrifuged with a Cytospin 3 (Shandon/Thermo Scientific, Rockford, IL) and stained with Hema 3 stain (Millipore, Billerica, MA). Supplementary figure legends: Supplementary figure-1: Continuous inhalation of doxycycline activates transgenes in non-airway epithelial cells. (A), (B) and (C) show GFP expression in lung sections from R26-H2BGFP mice that were given aerosolized doxycycline for 1 hour continuously. GFP expression was observed in non-airway EpCAM+ epithelial cells (A) and PeCAM+ endothelial cells (B) and asma+ smooth muscle cells (C). Arrows indicate the co-expression of GFP (in green) with either Epcam (red) (A) or PeCAM (red) (B) or alpha smooth muscle actin (red) (asma) (C). Scale bar, 2µm. Supplementary figure-2: Systemic activation of transgene expression after prolonged inhalation of aerosolized doxycycline in R26-H2BGFP mice. H2BGFP expression in heart (A and B), liver (C and D), skin (E and F) and spleen (G and H) after a 2-hour continuous inhalation of aerosolized doxycycline. Scale bar, 2µm. Supplementary figure-3: Comparison of doxycycline administration through drinking water and inhalation in R26-H2BGFP mice. (A), (B), (E) are the representative cross sections of heart, liver and skin, respectively, which show expression of H2BGFP in transgenic mice, R26-H2BGFP, that were given doxycycline through drinking water. (B), (D) and (F) are the representative pictures from cross sections of heart, liver and skin, respectively, which show no H2BGFP expression in transgenic mice that were given aerosolized doxycycline by inhalation using 5mg/ml doxycycline in three 2-minute exposures that were separated by 2 minute intervals. (G-J) Quantification of H2BGFP expressing cells on sections from esophagus, skin, liver and heart from mice that were given

6 different concentrations, doses, and routes of doxycycline adminstration. =doxycycline. Scale bar, 2µm. Supplementary figure-4: Short term persistence of transgene expression after aerosolized doxycycline in the airway epithelium in R26-H2BGFP mice. RT-PCR analysis of RNA isolated from dissociated tracheal airway epithelial cells collected 24, 72, and 12 hours after doxycycline inhalation using R26-H2BGFP mice. PCR bands indicate the expression of GFP (upper panel) and GAPDH (lower panel). Supplementary figure-5: Inhaled doxycycline does not induce an inflammatory response. C57bl/6 and mice were administered (grey bars) or ycycline (, black bars) and Bronchoalveolar lavage was collected at 24 hours (A, B, C and D) and 72 hours post inhalation (E, F, G and H), and assessed for total protein amount (A and E), total leukocyte count (B and F), mononuclear cell count (C and G) and granulocyte count (D and H). Experimental variation was calculated for - and doxycycline-treated mice and is represented as standard error mean.

7 Supplementary Figure 1 H-GFP Epcam DAPI Aerosolized ycycline H-GFP Pecam DAPI H-GFP asma DAPI A B C

8 Supplementary Figure 2 H2BGFP H2BGFP/DAPI Spleen Skin Liver Heart A B C D E F G H

9 Supplementary Figure 3 Heart Liver Skin - Nebulized - drinking water A C E B D F G H Esophagus Skin I Liver J Heart

10 Supplementary Figure H2 H2BGFP GAPDH

11 Supplementary Figure 5 A C E BAL total protein (mg/ml) BAL mononuclear cells (1*5) BAL protein (mg/ml) B 24 hrs post inhalation 24 hrs post inhalation D 24 hrs post inhalation 24 hrs post inhalation F 72 hrs post inhalation 72 hrs post inhalation BAL leukocytes (1*5) BAL leukocytes (1*5) BAL leukocytes (1*5) G BAL mononuclear cells (1*5) H 72 hrs post inhalation 72 hrs post inhalation.2 BAL granulocytes (1*5)