Interplay between NS3 protease and human La protein---- by Ray and Das Supplementary fig 1. NS3 pro

Transcription

1 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES RNA ws UV-crosslinked to incresing concentrtions (0.1, 0.2 nd 0.4µM) in RNA inding uffer contining 140mM KCl. The protein-nucleotide complex ws resolved in 15% SDS-PAGE followed y phosphor imging nlysis. The position of the protein is indicted y n rrow. n n No protei No protei HCV IRES HCV 3 UTR UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES RNA (lnes 1-3) nd HCV 3 UTR RNA (lnes 4-6) were UV-crosslinked to incresing concentrtion (0.1 nd 0.2µM) of. The protein-nucleotide complex ws resolved in 15% SDS-PAGE followed y phosphor imging nlysis. The position of the protein is indicted y n rrow. c NS3-FL UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES ws UV crosslinked to incresing concentrtions (0.1, 0.2, 0.4 nd 0.8µM) of recominnt full length tein (lne1-4). The position of the full length tein is indicted y n rrow.

2 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig HCV IRES Polio IRES UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES (lnes 1-2) nd Polio IRES RNA (lnes 3-4) were UV-crosslinked to protein. The protein-nucleotide complex ws resolved in 15% SDS-PAGE followed y phosphor imging nlysis. The position of protein is indicted y n rrow. HCV IRES SLII SLIII SLIV No protein Control 200 fold 400 fold 200 fold 400 fold 200 fold 400 fold 200 fold 400 fold Competition UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES ws Competition UV crosslinking ssy: α[ P]UTP leled HCV IRES ws UV-crosslinked to. Unlelled cold HCV IRES (lnes 3-4), SLII (lnes 5-6), SLIII (lnes 7-8) nd SLIV RNA (lnes 9-10) were used for competition. Lne 2 is control without cold RNA competition. The proteinnucleotide complex ws resolved in 15% SDS-PAGE followed y phosphor imging nlysis. The position of protein is indicted y n rrow.

3 ro Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 3 C T A G C rns3 pr BSA G323 G328 G328 G328 G331 G331 G331 G335 G335 G335 G337 G337 G346 G346 G344 G344 G344 G328 G331 G335 G337 G344 G346 Pnel : Toe printing ssy. Unleled HCV5 -UTR RNA ws incuted in sence (lne 5) or presence of incresing concentrtion of purified recominnt (lnes 6-7) or BSA s non specific protein (lne 8) nd then nneled to n end leled primer. The RNA-protein complex ws reverse-trnscried. The cdna ws resolved on sequencing gel. In prllel to the cdnas, sequencing rection ws run (lnes 1-4) to indicte the position of RT puses. Mjor toe prints re indicted on the right of the pnel. Pnel : Schemtic representtion of SLIV + pseudoknot region (dopted from Brown et l, 1992) showing the positions of Toe prints (old) nd foot prints.

4 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 4 CGUG ATG A GCAC CUCA ATG A UAGU UGGC ATG A ACCG Wt HCV IRES UAGU mutnt ACCG mutnt M1 M2 Schemtic representtion of wild type nd the two mutnt SLIV (UAGU nd ACCG mutnts) constructs showing the positions of the muttions. N Wt N1 M1 N2 M UV crosslinking ssy: α[ 32 P] UTP leled HCV wild type (lnes 1-3), or M1 (lnes 4-6), nd M2 IRES (lnes 7-9) RNAs were UV-crosslinked to incresing concentrtions of. The proteinnucleotide complex ws resolved in 15% SDS- PAGE followed y phosphor imging nlysis. The position of protein is indicted y n rrow. N, N1 nd N2 represents no protein control.

5 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig (Wt) (Mut) Ser138 Ser139 Alignment of nucleotide sequence of wild type NS3 nd mutnt NS3 using NCBI BLAST Score = 815 its (441), Expect = 0.0 Identities = 445/447 (99%), Gps = 0/447 (0%) Strnd=Plus/Minus Query 346 TGCACCTGCGGCAGCTCGGACCTTTACCTGGTCACGAGACATGCTGATGTCATCCCGGTG 405 Sjct 207 TGCACCTGCGGCAGCTCGGACCTTTACCTGGTCACGAGACATGCTGATGTCATCCCGGTG 148 Query 406 CGCCGGCGGGGCGACACTAGGGGGAGCTTGCTCTCCCCTAGACCCATCTCCTACTTGAAG 465 Sjct 147 CGCCGGCGGGGCGACACTAGGGGGAGCTTGCTCTCCCCTAGACCCATCTCCTACTTGAAG 88 Query 466 GGCTCTTCGGGTGGTCCATTGCTCTGCCCCTCGGGGCACGTTGTGGGCATCTTCCGGGCT 525 Sjct 87 GGCGCTGCGGGTGGTCCATTGCTCTGCCCCTCGGGGCACGTTGTGGGCATCTTCCGGGCT 28 Query 526 GCCGTGTGCACCCGGGGGGTCGCGAAG 552 M m 26kD 19kD c Silver stined gel: Purified wild type nd mutnt were resolved in 15% SDS-PAGE followed y silver stining. Lne M represents the protein mrker. m UV crosslinking ssy: α[ 32 P]UTP leled HCV IRES RNA ws UV-crosslinked to or m (s indicted). The protein-nucleotide complex ws resolved in 15% SDS-PAGE followed y phosphor imging nlysis. The position of the respective proteins re indicted y rrows.

6 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig % Lucifers se ctivity ** ** 0 Control HCV icistronic construct ws trnsiently cotrnsfected with incresing concentrtions of mmmlin expression construct. DNA concentrtions were normlized using the empty vector DNA. 24 hours post trnsfection, cells were lysed nd luciferse ssy ws performed. Percent luciferse ctivities corresponding to Rluc (white r) nd Fluc (grey r) vlues were plotted ginst the protein concentrtions. Vlues which significntly differ from control (P vlue<0.001) re indicted s sterisks. % Trnsltion ** ** HCV luc Polio luc 0 In vitro trnsltion : HCV-IRES luc RNA nd Polio-IRES luc RNA were trnslted in vitro in rit reticulocyte lyste in presenceof incresingi concentrtions ti (0.2 nd 0.4µM) of protein. Vlues which significntly differ from control (P vlue<0.001) re indicted s sterisks.

7 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 7 6 hr 12hr 18hr 24hr 30hr 36hr HCV negtive strnd GAPDH Reltive nd intensity hr 2 12hr 3 18hr 4 24hr 5 30hr 6 36hr Semi quntittive RT-PCR: Huh7 cells were trnsiently cotrnsfected with 5µg of psgr JFH1/Luc RNA nd 500ng of vector using Lipofectmine 2000 s trnsfection regent. At 6 th,12 th,18 th,24 th,30 th nd 36 th hour of trnsfection, RNA ws isolted nd HCV negtive strnd RNA ws detected using semi quntittive RT PCR followed y densitometry of the nd intensities. GAPDH ws detected s internl control. Bnd intensities of the HCV negtive strnd mplifiction ws normlized with tht of GAPDH nd plottedwithtimepointsonxxis nd reltive nd intensity on Y xis

8 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 8 L overexpression 0 hr 6 hr 12 hr 18 hr 24 hr HCV negtive strnd GAPDH L HCV negtive strnd GAPDH c Endogenous L L L Actin Immunolot Huh 7 cells were trnsiently co-trnsfected with HCV dicistronic replicon (Kto et l 2005) long with L encoding plsmid. RNA ws isolted t different time points (s indicted) nd reverse trnscried with HCV 5 primer nd GAPDH 3 primer using MMLV RT (Promeg) for mplifiction of negtive strnd of HCV RNA. Resulting cdna ws used for PCR mplifiction corresponding to HCV IRES. The PCR products were run on 2% grose gel. GAPDH ws used s n internl control (ottom of ech pnel). Pnel : effect of L over expression on HCV negtive strnd synthesis t different time intervls. Pnel : effect of incresing concentrtions of L overexpressions t 18 hours post trnsfection. Pnel c: Western lot nlysis of the ove rections (descried in pnel ) to show over expression of L protein, ctin ws used s internl control

9 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 9 Fold chnge in HC CV (-) RNA Rel time RT-PCR 0 0hr 6hr 12hr 18hr 24hr c d Immunolot 6h 18h ctin Rel time RT-PCR: Huh7 cells were trnsiently cotrnsfected with 5µg of psgr JFH1/Luc RNA nd construct encoding either tese (lck r) or core (white r) or vector lone (grey r) using Lipofectmine 2000 s trnsfection regent. At 0, 6 th, 12 th, 18 th nd 24 th hour post trnsfection, RNA ws isolted nd HCV negtive strnd RNA ws detected using rel time RT PCR. GAPDH ws used s n internl control (pnel ). The dt ws nlyzed y ABI-Prism s s Rel time PCR mchine. Fold chnge in RNA level ws clculted tking 0 th hour time point s control. Pnel nd c: Representtive mplifiction plots for HCV IRES nd GAPDH respectively s otined in the rel time RT-PCR mentioned ove. Pnel d: Western lot nlysis to show over expression of in the trnsfected cells.

10 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig PCR: Possiility of DNA contmintion ws checked y PCR of the in vitro trnscried psgrlucjfh1 RNA for HCV IRES (Lne 1). Lne 2 is the positive control for the PCR where psgrlucjfh1 plsmid DNA ws used PCR: Strnd specificity of reverse (Lne 2) nd forwrd (Lne 3) HCV IRES primers ws checked y RT-PCR of the in vitro trnscried psgrlucjfh1 RNA for HCV IRES. Lne 1 is the positive control for the PCR where psgrlucjfh1 plsmid DNA ws used

11 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 11 NS4A core peptide NS3 (209) r ΔC- Δ N No protein ΔN- ΔC UV crosslinking ssy: [α 32 P] UTP leled HCV IRES RNA ws UV cross-linked with incresing concentrtions of HCV (lnes 2-3), ΔN- (lnes 4-5) or ΔC- (lnes 6-7) s indicted on the top of the lnes.

12 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 12 0h 6h 12h 18h 24h NS5B Actin Immunolot: Huh 7 cells were trnsiently co-trnsfected with HCV dicistronic replicon (Kto et l 2005) long with encoding plsmid. Western lot nlysis of the ove rections ws crried out using nti-ns5b ntiody to show levels of NS5B protein. Actin ws used s internl control

13 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 13 Mrker Huh7 S10 + No Huh7 S10 NS3pro protein p56 p54 p Huh7 S10 Anti-L ntiody p56 p54 p UV crosslinking ssy: Pnel : α[ 32 P] UTP leled HCV SLIV RNA ws UV-crosslinked to Huh7 S10 protein in sence nd presence of incresing concentrtion of. The protein-nucleotidenucleotide complex ws resolved in 12% SDS-PAGE followed y phosphor imging nlysis. The position of different cellulr proteins intercting with the SLIV RNA is indicted. Pnel. Similrly the RNA protein complex ws immuno precipitted using nti L ntiody nd resolved in SDS 15%PAGE. The direct inding of HCV SLIV with Huh7S10 ws run longside. The numers t the left of ech pnel represent the moleculr msses of mrker run longside

14 Interply etween tese nd humn L protein---- y Ry nd Ds Supplementry fig 14 Arg Try His Arg Trnsltion L Riosoml suunits L NS3 Trnsltion inhiition Repliction mchinery Promotion of repliction L protein stimultes HCV IRES medited trnsltion. NS3 inding competes out L from SLIV region. Dislodging of L leds to riosome unloding nd trnsltion inhiition. L inds to 3 UTR, repliction complex ssemles nd HCV RNA strts replicting.