DNA Microarray probe selection. Oksana Lukjancenko, CBS DTU June 2011, KMUTT

Transcription

1 DNA Microarray probe selection Oksana Lukjancenko, CBS DTU June 2011, KMUTT

2 Bacterial Pan-Genome Definition by Tettelin et al.: Pan-genome is a complete collection of various genes located within populations at a particular taxonomic level, commonly within a species.

3 Bacterial Pan-Genome Pan-genome includes: Core-genome Genes that are missing in one or more strains Genes that are unique to each strain

4 Bacterial Pan-Genome New genes New gene families Core genome Pan genome 1 : Mycobacterium_avium_assembled_All 2 : Mycobacterium_avium_104 3 : Mycobacterium_avium_subsp_avium_ATCC_ : Mycobacterium_avium_subsp_paratuberculosis_K 10 5 : Mycobacterium_abscessus 6 : Mycobacterium_bovis_AF2122_97 7 : Mycobacterium_bovis_BCG_str_Pasteur_1173P2 8 : Mycobacterium_bovis_BCG_str_Tokyo_172 9 : Mycobacterium_gilvum_PYR GCK 10 : Mycobacterium_leprae_TN 11 : Mycobacterium_marinum_M 12 : Mycobacterium_smegmatis_str_MC2_ : Mycobacterium_sp_JLS 14 : Mycobacterium_sp_KMS 15 : Mycobacterium_sp_MCS 16 : Mycobacterium_sp_Spyr1 17 : Mycobacterium_tuberculosis_CDC : Mycobacterium_tuberculosis_F11 19 : Mycobacterium_tuberculosis_H37Ra 20 : Mycobacterium_tuberculosis_H37Rv 21 : Mycobacterium_tuberculosis_KZN_ : Mycobacterium_ulcerans_Agy99 23 : Mycobacterium_vanbaalenii_PYR 1 24 : Rhodococcus_equi_103S 25 : Nocardia_farcinica_IFM_ : Corynebacterium_efficiens_YS

5 DNA Microarray A DNA microarray is a collection of microscopic DNA spots attached to a solid surface. Each DNA spot contains picomoles of a specific DNA sequence, known as probes. ese can be a short section of a gene or other DNA element that are used to hybridize target (cdna or crna sample) under highstringency conditions.

6 Microarray analysis pipeline Probe Design Hybridization to Array Blood Sample Array Scan and Analysis DNA Purification and cdna labeling

7 Examples of Microarray Use Compare and characterize the genomic content of unknown bacterial isolates typing In epidemiological investigations and clinical diagnostics In human screenings for the determination and genotyping of bacterial strains. In human cancer to genotype cell lines by determination of gene loss and copy number variations

8

9

10

11

12

13

14 OligoWiz at CBS predichon server URL: h"p://

15

16

17 Purpose of DNA Microarray DNA microarray probe should, as a minimum, meet the following criteria: ere should be good discrimination between the intended target and all other targets in the target pool (specificity). e probe should detect differences in target concentration under the given hybridization conditions (responsiveness).

18 Specificity Avoid probes that cross-hybridize Evaluate all possible probes along the target by aligning the entire pool of sequences available for hybridization Probes resulting in the strongest discrimination between the target and alternative targets identified as suitable probes

19 Responsiveness Probes with very high affinity may saturate and result in reduced response; whereas probes with very low sensitivity may not show signal distinguishable from the background signal

20 Probe length and number of probes per target Longer probes are more specific than short probes e choice will typically be made on the basis of technology and/or funds available.

21 Probe suitability scores Cross-hybridization Folding (self-annealing) Probe suitability Position (within the transcript) T m Low-complexity

22 Cross-hybridization To prevent hybridization to unintended targets, the input sequence is screened for similarity against the entire genome (for prokaryotes and small eukaryotes) or transcriptome. Default threshold used in OligoWiz is 98% similarity over at least 80% of the input sequence.

23 T m - melting temperature changes 1. Introducing length intervals 2. Calculating Δ T m scores Evaluates how deviant the T m of a potential probe is from the mean T m of all potential probes

24 Folding Strong probe folding may result in increased specificity it will reduce target affinity OligoWiz estimates the free energy potential of secondary structures within the probes by aligning the probe against itself

25 Low-complexity To avoid picking up background signal, probes that are composed of subsequences that occur very commonly in the genome should be avoided Oligo with low-complexity: AAAAAAAGGAGTTTTTTTTCAAAAAACTTTTTAAAAAAGCT TTAGGTTTTTA Oligo without low-complexity: CGTGACTGACAGCTGACTGCTAGCCATGCAACGTCATAGTA CGATGACT

26

27

28

29