Supplementary Figure 1a

Transcription

1 Supplementary Figure 1a Annotated pkc43 insertion without pkc26 pkc43 attp Genomic DNA C_Genomic_F pkc43_r ~1050bp PCR product Annotated pkc43 insertion with pkc26 pkc43 attl pkc26 attr Genomic DNA C_Genomic_F pkc26_r pkc43_r ~450bp PCR product In multiplex PCR, the short extension time prevents pkc43_r product forming

2 Supplementary Figure 1b Fig1. panel Non-annotated site PCR Annotated site PCR - 1,000 bp bp bp

3 Supplementary Figure 1 Diagnostic PCR scheme used in this study. (a) Schematic of the primer binding sites for the diagnostic PCR scheme. C_Genomic_F represents the forward primer anchored in genomic sequence (different primers required for the annotated or non-annotated pkc43 insertion site; primer sequences listed in Supplementary Methods), this primer is combined with pkc43_r which binds within pkc43, and pkc26_r which binds within pkc26. The binding site for pkc26_r is situated within the pkc26 vector such that the resulting product is the same whether a full, empty or truncated pkc26 vector has integrated into the pkc43 target. (b) Example gel showing the diagnostic PCR interrogating the occupancy of both pkc43 target sites for the flies described in Fig. 1b-f.

4 Supplementary Figure 2 Line with pkc26 insertion in both pkc43 sites C NC C NC Line (VDRC genetic background) Balancer line Balancer Marker C NC F1 Progeny C Parental Recombinant NC C NC C NC C NC Balancer Balancer Balancer Balancer I II III IV Distinguish by PCR then establish stock

5 Supplementary Figure 2 Backcrossing scheme to isolate single pkc26 integrations from KK lines in which both pkc43 targets have pkc26 integrations. Cross double integration lines to the VDRC s controlled genetic background (line in which both pkc43 targets are empty) and collect virgin female F1 progeny. Recombination occurs within the germline of these flies, creating recombinant progeny in which only a single pkc26 integration is present. Such flies can be most easily recovered by crossing the virgin F1 females to white eyed flies carrying a second chromosome balancer; the red eyed F2 progeny (representing both parental and recombinant flies) must then be distinguished by PCR before the establishment of a new clean line. By substituting line for the balancer line, the genetic homogeneity of the KK collection can be maintained in the resulting lines.

6 Supplementary Figure 3 A B C D A NA A NA A NA A NA Non Annotated pkc43 with integrated pkc26+shrna E F G Annotated pkc43 with integrated pkc26+shrna Annotated pkc43 with integrated empty pkc26 Annotated pkc43 with integrated truncated pkc26 Annotated pkc43 with no integrated pkc26 A NA A NA A NA

7 Supplementary Figure 3 Eye colors that result from different pkc26 integration events. (a) Occupancy of the non-annotated pkc43 site by a pkc26 vector with a complete hairpin results in strong mini-white expression. Occupancy of the annotated pkc43 target by a pkc26 vector containing a hairpin sequence also results in strong eye coloration in homozygotes (b), and a crescent coloration in heterozygotes (c); this is indistinguishable from the situation when an empty pkc26 occupies this site as a homozygote (e) or heterozygote (f). Occupancy of this site with a pkc26 vector containing a recombination-mediated deletion results in very limited, crescent expression of the mini-white marker (d), almost indistinguishable from the eye coloration of flies not carrying pkc26 integrations (g).

8 Supplementary Table 1 Supplementary table listing the VDRC 'KK' lines tested in this study. For each line tested the supplementary table lists the VDRC's Transformant and Contruct ID, the target gene and its synonyms, and the occupancy of each pkc43 target site within that line. Transformant ID pkc26 integrated at non-annotated pkc43 Construct ID Gene CG Number Gene Synonyms CG3630 EG:152A3.3,152A3.3 yes yes CG4236 caf1,caf-1,caf1,caf-... yes yes CG4143 mbf1,mbf1,mbf1,mbf-1... yes yes CG2913 EG:EG0002.1,oligopep... yes yes CG3620 CdkA,DIP2,MRE18,mRNA... yes yes CG4574 Phospholipase C at 2... yes yes CG12286 kar,karmoisin yes yes CG13057 CG33060,CG33061,reti... yes yes CG9674 yes yes CG11144 CAA _Dr,DmGluA... yes CG1171 dakh,drm-akh,hrth,hy... yes CG12264 CG12264-PA yes CG13164 Sip2,SIP2,Syntaxin I... yes CG1322 l(3)00865,zfh1,zfh-1... yes CG1349 DJ-1,DJ-1b,DJ-1B,dj-... yes CG1449 zfh2,zfh-2,zfh2,zfh-... yes CG14851 yes CG1555 cinnabar,cn,dmelcn yes CG17100 bhlhe49,clockworkora... yes CG2155 NP_511113,v,ver,Ver... yes CG2621 Dmsgg3,DMSGG3,DMZ3K2... yes CG3017 delta-aminolevulinat... yes CG3234 dtim,dtim,dtim,dtime... yes CG33336 CG10873,CG31325,dmp5... yes CG4314 scarlet,st yes CG6321 yes CG6646 DJ-1,DJ-1a,DJ-1A,DJ-... yes CG6950 yes CG7023 yes CG8430 BEST:GH07823,Glutama... yes CG8808 DmPdk,DmPDK,pdk,Pdk... yes CG8850 DmNAT4 yes CG9122 CT9937,DTRH,Trh,TRH... yes CG9542 yes CG1707 yes pkc26 integrated at annotated pkc43

9 CG5085 D.mel2,dSIRT2,Sirt2 yes CG8971 dfh,dfh,dfh,fh,frata... yes CG1086 Dmglut1,DmGluT1,DmGL... yes CG1461

10 Supplementary Methods Fly genetics. Male flies of the VDRC KK collection were crossed to virgin female GAL4 driver lines and the F1 progeny screened. This study used both P{GawB}elav c155 (BDSC stock 458) screened for the non-inflating wing phenotype, and P{Act5C-GAL4}17bFO1 (BDSC stock 3954) screened for F1 pupal lethality. Generation of recombinants for genome sequencing. We obtained flies from the VDRC s KK collection targeting CG2913 (VDRC stock ), and crossed them to the VIE-260B line (VDRC stock 60100) in which both pkc43 targets have no pkc26 integration. Female F1 progeny of this cross were again backcrossed to VDRC stock 60100, and the eye color of the F2 progeny was carefully examined to identify recombinant progeny. F2 flies displaying a crescent eye coloration (as in Fig. 1e) were collected for sequencing; later analysis revealed these to have a truncated pkc26 integration solely at the annotated site). Genome sequencing. Genomic DNA was extracted from the recombinant F2 flies described above using a Promega Maxwell Tissue DNA purification kit (product AS1030). BGI Hong Kong Co., Limited generated 500bp fragment libraries, and sequenced the library to 30x coverage depth using an Illumina HiSeq 2000 instrument (101bp paired end reads). Sequences were assembled using Bowtie2 3, analysed using Samtools 4, and visualised using both Tablet 5 and FlyBase 6. The novel pkc43 insertion lies between the bases chr2l: and (assembly dmel_r5.50). PCR. Primers were designed using Primer3 7 ; the forward primer was placed in the genomic region 5 of the annotated insertion (C_Genomic_F, GCCCACTGTCAGCTCTCAAC), and reverse primers placed such that successful integration of pkc26 into the annotated pkc43 insertion resulted in a ~450bp product (pkc26_r, TGTAAAACGACGGCCAGT), while the presence of pkc43 alone resulted in a ~1050bp product (pkc43_r, TCGCTCGTTGCAGAATAGTCC). For the non-annotated insertion, the NC_Genomic_F primer (GCTGGCGAACTGTCAATCAC) resulted in a ~600bp product with pkc26_r, and a ~1200bp product with pkc43_r. A single Genomic_F primer could be multiplexed with both reverse primers. A schematic of the PCR design is included in Supplementary Fig. 1. PCR was performed using KAPA Taq polymerase in a G-Storm thermal cycler with the following program: 95, 120 sec initial denaturation, 5 cycle touchdown (95 C 15 sec denaturation, 68 C 15 sec annealing, 72 C 50 sec extension; annealing temperature lowered 1 C per cycle), 29 cycle reaction (95 C 15 sec denaturation, 62 C 15 sec annealing, 72 C 50 sec extension), and a final 72 C, 120 sec extension. Microscopy. All fly eye images using a Canon 600D attached to a Nikon SMZ-U stereo dissection microscope. For Fig. 1 flies were aged approximately 1 week, for Supplementary Fig. 3 flies were photographed on the day of eclosion. Supplementary references 3. Langmead, B. & Salzberg, S. L. Nat. Methods 9, (2012).

11 4. Li, H. et al. Bioinformatics 25, (2009). 5. Milne, I. et al. Bioinformatics 26, (2010). 6. McQuilton, P., St Pierre, S. E., Thurmond, J. & FlyBase Consortium. Nucleic Acids Res. 40, D (2012). 7. Untergasser, A. et al. Nucleic Acids Res. 40, e115 (2012).