Mice genotyping for FAK flox, deletion (Δ), and KD alleles as well as GFP, Cre and

Transcription

1 Supplementary Methods Mice genotyping Mice genotyping for FAK flox, deletion (Δ), and KD alleles as well as GFP, Cre and PyMT alleles were performed using the following primers: FAK Flox/WT: 5 - GCTGATGTCCCAAGCTATTCC and 5 -TGGCCTGCTATGGATTTCGC; FAK Δ: 5 - GCTGATGTCCCAAGCTATTCC and 5 -AGGGCTGGTCTGCGCTGACAGG; FAK KD: 5 - TCAACAGCATGTAACTTCCC and 5 -GGCATTCCAGTGCAAAACAC; CRE: 5 - CGCAGAACCTGAAGATGTTCGCGATTA and 5 - TCTCCCACCGTCAGTACGTGAGATATC; GFP: 5 -GTAAACGGCCACAAGTTCAGC and 5 -TCCTTGAAGAAGATGGTGCG; PyMT: 5 -GGAAGCAAGTACTTCACAAGGG and 5 - GGAAAGTCACTAGGAGCCAGGG. Preparation and culture of MaECs, mammary tumor cells and cancer cell lines The thoracic and abdominal virgin glands of 2-3 month-old mice and mammary tumors (around 10x12 mm) from Ctrl-MT, MFCKO-MT and MFCKD-MT mice were used. To prepare MaECs or tumor cells from normal mammary glands or primary tumors, the normal glands or tumor tissues were cut and incubated in DMEM/F12 supplemented with 5% FBS, 1x antibioticantimycotics, gentamycin (20 µg/ml) (all from Invitrogen), collagenase (300 units/ml), and hyaluronidase (100 units/ml)(worthington Biomedical) for 2-4 h at 37 o C. They were then centrifuged at 400 g for 10 min, and the pellets were washed with PBS, and suspended in 0.05% trypsin/0.025% EDTA (Invitrogen) and incubated for 5 min for further digestion to generate single-cell suspensions. An equal volume of DMEM/F12 containing 5% FBS and DNase I (20 units/ml, Roche) was then added to stop the digestion. After filtering 2 times through 40µm 1

2 nylon meshes (BD Biosciences), the cells were collected by centrifugation at 400g for 5 min and re-suspended in DMEM/F12 (with 0.06 mmol/l calcium) supplemented with dispase (5 units/ml)(stemcell Technologies). To remove red blood cells, the cells were treated with 0.8% ammonium chloride solution. The human MaECs were prepared from normal breast tissue in a similar manner to obtain single cell suspensions as described for the preparation of mouse MaECs in the previous section. SUM159 and SUM149 cells were cultured in Ham's F-12 (Invitrogen) supplemented with 5% FBS (Thermo Fisher Scientific, Pittsburgh, PA), 5 µg/ml insulin, and 1 µg/ml hydrocortisone (both from Sigma, St. Louis, MO), 10 µg/ml gentimycin, and 1% antibioticantimycotic (both from Invitrogen). MDA-MB231 cells were maintained in DMEM medium (Invitrogen) supplemented with 10% FBS, 1% antibiotic-antimycotic. HCC1954 cells were maintained in RPMI1640 medium (Invitrogen) supplemented with 10% fetal bovine serum, 1% antibiotic-antimycotic, and 5 µg/ml insulin (Sigma-Aldrich, St Louis, MO). Lentiviral/Adenoviral Infection Primary human MaECs or breast cancer cell lines were infected with lentiviruses encoding FAK shrna/gfp (5'-GAACCTCGCAGTCATTTATTTCAAGAGAA TAAATGACTGCGAGGTTC) or scrambled sequence/gfp (5'-GTCTCCGAACGTGTCACGT TTCAAGAGAACGTGACACGTTCGGAGAC) (gifts from Dr. David Schlaepfer). The cells were then sorted for GFP-positive cells and used for mammosphere assays. MaECs isolated from Ctrl (FAK f/f ) mice were cultured in 0.1% rat tail collagen (Sigma- Aldrich)-coated dishes in completed serum-free mammary epithelial basal medium (MEBM; Cambrex) supplemented with B27 (Invitrogen), 10ng/mL EGF and 10ng/mL bfgf (BD 2

3 Biosciences), antibiotic-antimycotics (Invitrogen), 20 µg/ml gentamycin (Invitrogen), 1 µm hydrocortisone, 5 µg/ml insulin, and 50 µm β-mercaptoethanol (Invitrogen) at 37 C in 5% CO2. After one-day culture, MaECs were infected with Ad-Cre or Ad-lacZ (Gene Transfer Vector Core, University of Iowa) for overnight. Cells infected with Ad-Cre or LacZ were subjected to mammosphere assay as well as transplantation in cleared mammary fat pads of FVB mice using 20,000 cells/injection. For in vitro rescue assay, MaECs isolated from MFCKO mice were infected with recombinant adenoviruses expressing FAK WT or FAK mutants with GFP as well as GFP alone (negative control). Cells with adenoviral infection were sorted for GFP + cells and subjected to mammosphere/acini formation assays. To test if FAK KD mutant rescue mammary regenerative potential in vivo, cultured MaECs from MFCKO-GFP mice were infected with recombinant adenoviruses expressing FAK or KD/FAK as well as GFP alone, and transplanted into cleared FVB recipients using 20,000 cells/injection. Antibodies and Chemicals The following antibodies are used: FAK (C20, Santa Cruz Biotechnology), phospho- Y397 FAK (Invitrogen Inc.), Phospho-Pyk2 (Y402, Cell signaling Technologies), keratin 8/18 (American Research Products), keratin 5 (Covance), Ki67 (Spring Bioscience), PCNA and CyclinD1 (Santa Cruz), cleaved Caspase-3 (Cell Signaling Technologies), and β-actin (Sigma). FITC-conjugated goat anti-guinea pig IgG (1:200) or anti-rabbit IgG (1:200), Texas Redconjugated goat anti-rabbit IgG (1:200) were used as secondary antibodies for immunofluorescent labeling (all from Vector Laboratories). Antibodies used for flow cytometry include Ter119-APC, CD45-APC, CD31-APC (Biolegend), CD24-PE (BD Biosciences), CD29-3

4 FITC (Biolegend), and biotin-conjugated anti-mouse/rat CD61 (BD Biosciences). Carmine and aluminum potassium sulfate were purchased from Sigma-Aldrich. Cell Labeling, Flow Cytometry and Sorting Isolated MaECs or mammary tumor cells were suspended in Hank s Buffered Salt Solution (HBSS) supplemented with 2% heat-inactivated FBS and DNase I with a concentration of 1x10 7 cells/ml. To label different lineages, isolated cells were incubated with conjugated antibodies for lineage markers including CD45-APC, CD31-APC, and Ter119-APC, MaEC markers including CD24-PE, CD29-FITC, and CD61-biotin, followed by staining with streptavidin conjugated to APC-Cy7 (Biolegend). Cells were suspended in 2µg/mL PI (sigma) to discriminate live from dead cells. Flow cytometry analysis and sorting were performed on a FACSVantage SE-dual laser, 3-line flow cytometer (Becton Dickinson) or FACSCanton (BD Biosciences). Lin - cells were obtained by gating out CD45, CD31 and Ter119 positive cells. Mammosphere and Acinar Colony Formation For mammosphere culture of mouse MaECs, primary human MaECs or human breast cancer cells, single cells were plated in six-well ultralow attachment plates (Corning) at a density of 20,000 cells/ml in primary culture and 5,000 cells/ml in subsequent passages. For tumorsphere formation, human breast cancer cells were plated at density of 2000 cells/ml at presence of vehicle (DMSO) or FAK inhibitors (PF and PF562271, Pfizer). Cells were grown in completed serum-free MEBM for 7 to 10 days. To count mammospheres, spheres were collected, pooled, and transferred to a regular 96-well flat-bottomed plate. Mammospheres settled in these conditions were counted under a microscope at low magnification. For 3D acinar 4

5 colony assay, unsorted or sorted MaECs were suspended in chilled 100% Matrigel and the gels allowed to set at 37 o C for 15 min before covering with mouse completed EpiCult -B medium (StemCell Technologies) supplemented with 10 ng/ml EGF and 10 ng/ml bfgf (BD Biosciences), 4 μg/ml heparin (StemCell Technologies), 20 µg/ml gentamycin (Invitrogen) and 5% FBS (Invitrogen). In some cases, unsorted or sorted MaECs were also tested by placing on top of preset Matrigel and cultured for 7-10 days. Acini samples with Matrigel were removed, embedded in OCT compound (Tissue-Tek) and frozen for cryo-sectioning. Apoptosis, Cell Proliferation and Immunoblotting Apoptosis in acinar colonies or cultured breast cancer cells following FAK inhibitor treatment was examined by In situ Cell Death Detection kit, TMR red (Roche) or immunolabeling of the cleaved Caspase-3. To detect cell proliferation, cryosections of acini samples and primary tumors as well as cultured human breast cancer cells following FAK inhibitor treatment were fixed in 4% PFA and examined by Ki67 or PCNA immunofluorescence. For immunofluorescent staining of luminal, basal/myoepithelial, and mammary stromal cells, FACS-sorted cells were subjected to cytospin onto glass slides, fixed in 4% PFA in PBS, and labeled with different antibodies including CK8/18, CK5 and FAK. All samples were mounted with VECTASHIELD mounting medium with DAPI (Vector Laboratories). Slides were examined under a BX41 microscope (Olympus) using UplanF1 20x-40x/0.5 objective lenses at RT. Images were captured with a DP70 camera with DP Controller version (Olympus). For Western blotting, cells and primary tumor samples were lysed in RIPA buffer (10mM Tris.Cl, 100mM NaCl, 2mM EDTA, 20mM NaF, 5 mm Na 3 VO4, 0.5% sodium deoxycholate, 0.1% SDS, 1% Triton X-100) supplemented with protease inhibitor cocktail 5

6 (Sigma). Cell lysates were subjected to 10% SDS-PAGE, transferred to nitrocellulose membrane and probed with different antibodies as described in the Antibodies and Chemicals section above. Mammary Fat Pad Transplantation and Analysis The recipient mice were anesthetized with ketamine/xylazine (80-120mg/kg and 10mg/kg respectively), and half of the No. 4 mammary fat pad from the forth nipple to the middle lymph node was removed to clear the endogenous mammary epithelium. Unsorted or sorted MaECs in different dilutions were suspended in PBS supplemented with 20% fetal calf serum (FCS), 25% Matrigel and injected in 10 µl volumes into the cleared mammary fat pad of recipient mice. The recipient glands were excised for evaluation after 7 weeks post transplantation. An outgrowth was defined as an epithelial structure comprising ducts arising from a central point, with lobules and/or terminal end buds. Frequency of mammary repopulating unit (MRU) following limiting dilution transplantation was calculated using the ELDA software (Walter + Eliza Hall Bioinformatics, Institute of Medical research). To induce pregnancy, mice received transplantation after 4 weeks were mated with FVB male. At p18.5 or day 1 after delivery, they were euthanized, and recipient glands were subjected to whole mount examination or histological analysis. Mammary Whole Mounts, Histology, and Immunofluorescence To examine mammary ductal elongation or outgrowth after transplantation, the fourth abdominal mammary glands were excised and fixed with Carnoy s solution containing 60% ethanol, 30% chloroform, 10% glacial acetic acid for 4h. After washed with 70% ethanol twice, mammary glands were stained with carmine aluminum (Sigma) for 14h. Stained tissues were 6

7 gradually washed in 70%, 95%, and 100% ethanol for 30min each, cleared in xylene (Fisher Scientific) twice for 30min each, and mounted with Permount SP Toluene Solution (Fisher Scientific). Mammary whole mounts were observed under a Leica S6D dissecting microscope (Leica Microsystems, Germany). To examine outgrowth derived from GFP-marked MaECs, the recipient glands were removed, spread between two glass slides squeezed together by two 2-inch office binder clips, and examined for GFP fluorescence by a Leica MZFLIII fluorescent stereo microscope (Leica Microsystems, Germany). All digital images were recorded using a SPOT FLEX color digital camera (Diagnostic Instruments, Inc. Sterling Heights, MI) coupled with a SPOT software package at room temperature (RT). For mammary gland histology of virgin or pregnancy/lactation mice, the fourth abdominal mammary fat pads were harvested and processed for H&E staining and immunofluorescence. Briefly, unstained tissue sections were first deparaffinized in xylene (3 times, 5 min each), rehydrated in graded ethanol solutions (100, 95, and 70%), and stained with H&E. For immunofluorescence, mammary gland sections were first subjected to antigen retrieval (model Retriever 2000, PickCell Laboratories, Holland), stained with different antibodies including CK8/18, and Ki67 as well as CK5 and PCNA as described in Antibodies and Chemicals section above, and mounted with VECTASHIELD mounting medium with 4,6- diamidino-2-phenylindole (DAPI) (Vector Laboratories). The slides were examined under an Olympus BX41 microscope (Olympus, Japan) with UplanF1 x20/0.5 objective lenses at RT. The images were captured using a DP70 camera (Olympus) with DP Controller version

8 Supplementary Figure Legends Supplementary Figure S1. Characterization of distinct cellular populations for expression of luminal marker CK8 and basal marker CK5 using immmunofluorescence. A. Sorted luminal, basal and mammary stromal cells from Ctrl mice were examined for expression of luminal marker CK8 and basal marker CK5 (Bar: 100 μm). B. Sorted R9 (subpopulation of basal cells [R7], and enriched in MaSCs) and the rest of R7 (excluding R9) from Ctrl mice were examined for expression of luminal marker CK8 and basal marker CK5 (Bar: 200 μm). Supplementary Figure S2. Acinar colony and mammasphere formation for MaECs deleted of FAK in vivo or in vitro. A. Unsorted MaECs isolated from Ctrl and MFCKO mice at age of 2-3 months were plated on top of Matrigel and cultured for 6-10 days. Acini formation at day 6 for Ctrl and MFCKO MaECs were counted and plotted. Bar: 100 mm. **, P<0.01. B. Unsorted MaECs isolated from Ctrl (FAKf/f) mice were infected with adenoviruses expressing LacZ or Cre. The efficiency of FAK deletion following adenoviral infection was examined by Western blotting using FAK antibodies (left), and mammosphere formation from adenovirus infected cells were examined and plotted (right). **, P<0.01. Supplementary Figure S3. Genotyping of recipient mammary fat pads following transplantation as well as TUNEL assay for luminal and basal acini sections derived from Ctrl, MFCKO, and MFCKD mice. A. Genotyping of recipient mammary fat pads after transplantation of 20,000 Ctrl (FAKf/f) MaECs infected with adenoviruses expressing LacZ or Cre. 2 out of 6 transplants (line 1 and 2) in f/f +Ad-LacZ group generate complete outgrowths 8

9 with FAKf/f genotype. In f/f +Ad-Cre group, 3 complete and 1 tiny outgrowths were produced out of 12 transplants. However, only the tiny outgrowth (Line10) has FAKΔ/Δ genotype, while three complete outgrowths (line7-9) have FAKf/Δ genotype, the WT alleles are from recipient mice. a, b: samples of FAKf/f MaECs infected with Ad-LacZ and Ad-Cre respectively. B. Acini derived from luminal and basal MaECs from Ctrl, MFCKO, and MFCKD mice were sectioned, and analyzed by TUNEL assay. Arrows in the top and low panels mark the apoptotic cells falling in the lumen (representing cells that had detached from the extracellular matrix) and the cells in basal acini respectively. Bar: 100μm. Supplementary Figure S4. PyMT-induced tumor cells have a luminal cellular origin and FAK inhibitor treatment does not induce significant apoptosis in SUM149 and SUM159 breast cancer cells. A. Tumor cells isolated from Ctrl-MT, MFCKO-MT, and MFCKD-MT mice have a CD24 hi CD29 lo signature that co-resides with the luminal epithelial population in corresponding mice of each genotype without PyMT oncogene expression. B. SUM149 and SUM 159 cells were treated with FAK inhibitors PF228 (5 μm) and PF271 (3μM) for 24h, and stained for cleaved Caspase-3 for apoptosis. Bar: 200μm. 9