Linking structural assembly to gene expression: a novel mechanism for regulating the activity of a σ 54 transcription factor

Transcription

1 Blackwell Science, LtdOxford, UKMMIMolecular Microbiology X; Journal compilation 2005 Blackwell Publishing Ltd? Original ArticleRegulation of flagellar gene expression in C. crescentusr. J. Dutton, Z. Xu and J. W. Gober Molecular Microbiology (2005) 58(3), doi: /j x First published online 22 September 2005 Linking structural assembly to gene expression: a novel mechanism for regulating the activity of a σ 54 transcription factor Rachel J. Dutton, Zhaohui Xu and James W. Gober* Department of Chemistry and Biochemistry and Molecular Biology Institute, University of California, Los Angeles, Los Angeles, CA , USA. Summary In Caulobacter crescentus, the temporal and spatial expression of late flagellar genes is regulated by the σ 54 transcriptional activator, FlbD. Genetic experiments have indicated that the trans-acting factor FliX regulates FlbD in response to the progression of flagellar assembly, repressing FlbD activity until an early flagellar basal body structure is assembled. Following assembly of this structure, FliX is thought to function as an activator of FlbD. Here we have investigated the mechanism of FliX-mediated regulation of FlbD activity. In vitro transcription experiments showed that purified FliX could function as a repressor of FlbD-activated transcription. Transcription activated by a gain-of-function mutant of FlbD (FlbD-1204) that is active in vivo in the absence of an early flagellar structure, was resistant to the repressive effects of FliX. DNA binding studies showed that FliX inhibited the interaction of wild-type FlbD with enhancer DNA but did not effect FlbD-catalysed ATPase activity. DNA binding activity of FlbD-1204 was relatively unaffected by FliX indicating that this mutant protein bypasses the transcriptional requirement for early flagellar assembly by escaping FliX-mediated negative regulation. Gel filtration and co-immunoprecipitation experiments indicated that FliX formed a stable complex with FlbD. These experiments demonstrate that regulation of FlbD activity is unusual among the well-studied σ 54 transcriptional activators, apparently combining a two-component receiver domain with additional control imposed via interaction with a partner protein, FliX. Accepted 11 August, *For correspondence. gober@chem.ucla.edu; Tel. (+1) ; Fax (+1) Present address: Program in Biological and Biomedical Sciences, Harvard Medical School, Boston, MA, 02115, USA. Introduction In Caulobacter crescentus, an asymmetric cell division gives rise to two distinct progeny cells, a sessile stalked cell and a motile swarmer cell possessing a single polar flagellum (reviewed in Ausmees and Jacobs-Wagner, 2003; Ryan and Shapiro, 2003). One striking, distinguishing characteristic of this simple developmental programme is the cell cycle-regulated biogenesis of the flagellum. Flagellar biogenesis in Caulobacter requires approximately 50 genes, most of which are expressed at a distinct time in the cell cycle (reviewed in Gober and England, 2000; England and Gober, 2001). This temporal expression of flagellar genes is influenced both by the progression of the cell cycle and by flagellar assembly. The initiation of DNA replication in stalked cells results in the new synthesis and phosphorylation of the global transcription factor CtrA. CtrA activates the transcription of early flagellar genes (class II) which encode a cytoplasmic membrane-bound basal body comprised of an integral membrane MS-ring, the flagellar motor switch and a flagellum-specific type-three secretory system (TTSS) (Quon et al., 1996; Domian et al., 1997; Reisenauer et al., 1999) (Fig. 1). The successful assembly of this structure is required for the transcription of genes encoding the components of more cell-distal flagellar structures such as the rod, the outer membrane rings and the hook (class III) (Newton et al., 1989; Xu et al., 1989; Ramakrishnan et al., 1994; Mangan et al., 1995) (Fig. 1). The assembly of this class III-encoded flagellar structure is, in turn, required for the translation of genes encoding the flagellins of the filament structure (Mangan et al., 1995; Anderson and Newton, 1997; Mangan et al., 1999; Anderson and Gober, 2000). Thus, the regulation of flagellar gene expression in Caulobacter is governed by a hierarchy of assembly regulated checkpoints. The temporal and spatial transcription of the class III and class IV flagellar genes is regulated by the global transcription factor FlbD (Ramakrishnan and Newton, 1990; Wingrove et al., 1993; Benson et al., 1994a,b; Mullin et al., 1994; Wu et al., 1995). In addition to activating the transcription of these late flagellar genes, FlbD also represses the transcription of the early class II genes (Benson et al., 1994a; Mullin et al., 1994; Wingrove and Journal compilation 2005 Blackwell Publishing Ltd

2 744 R. J. Dutton, Z. Xu and J. W. Gober class II transcription class II assembly class III and IV transcription class III assembly class IV translation class IV assembly FliX FlbD (inactive) FliX FlbD (active) FliX FlbD (inactive) Fig. 1. FlbD and FliX play a central role in coupling early flagellar assembly to transcription. Shown is a schematic diagram depicting the progression of polar flagellar assembly in Caulobacter crescentus and its relation to FliX/FlbD activity. Flagellar gene expression initiates early in the cell cycle with the expression of early class II flagellar genes encoding the basal body MS-ring, the flagellar switch, and the flagellumspecific TTSS. The trans-acting factors FliX and FlbD, also encoded by class II flagellar genes, are inactive until the MS-ring/switch/TTSS basal body substructure is completed. At that time, through an undefined signalling process, both FliX and FlbD become active, resulting in the transcriptional activation of the σ 54 -dependent late class III and class IV flagellar genes. Following the successful assembly of the structure encoded by these genes (i.e. the remainder of the basal body, the hook, and filament), FliX and FlbD return to an inactive state. Genetic experiments have suggested that FliX transduces information regarding the status of flagellar assembly to the σ 54 transcriptional activator, FlbD. It is proposed that FliX represses FlbD activity until the class II-encoded basal body substructure is assembled. Following assembly FliX is envisioned to function as an activator of FlbD. This regulatory model is supported by the existence of gain-of-function mutants of both FlbD and FliX, which permit late flagellar gene expression in the absence of a class II-encoded structure. Note that a second assembly checkpoint, independent of FliX/FlbD, operates during flagellar biogenesis in Caulobacter, coupling the translation of flagellin mrna to hook assembly. Gober, 1994), and is required for the correct timing of the completion of cell division (Muir and Gober, 2001). During the course of the Caulobacter cell cycle, FlbD activity is restricted to the nascent swarmer cell-compartment of the predivisional cell (Wingrove et al., 1993; Wingrove and Gober, 1994; Muir and Gober, 2002), thus establishing an asymmetric pattern of flagellar gene expression. The polarly localized MS-ring/switch/TTSS basal body substructure is thought to be the spatial cue that activates FlbD in the swarmer cell-compartment of the predivisional cell (Muir and Gober, 2002). In support of this idea, mutant cells containing gain-of-function alleles of FlbD that remain active in the absence of an early flagellar structure exhibit a loss of swarmer cell compartment-specific activity (Mangan et al., 1995; Muir and Gober, 2002). FlbD belongs to the large family of proteins known as σ 54 transcription factors that activate transcription catalysed by RNA polymerase holoenzyme containing the σ 54 subunit (Ramakrishnan and Newton, 1990). These transcriptional activators are a diverse group of multidomain proteins that have in common the highly conserved AAA+ (ATPase Associated with various cellular Activities) ATPase domain (reviewed in Neuwald et al., 1999; Zhang et al., 2002; Studholme and Dixon, 2003). Proteins of the AAA+ superfamily are found in all kingdoms and generally regarded to possess chaperone-like activity. In addition to the ATP binding and hydrolysis determinants found in all AAA+ proteins, σ 54 activators contain a unique module, termed the GAFTGA motif, responsible for contacting the σ 54 subunit. This domain is usually accompanied by a DNA-binding domain, allowing the activator to recognize enhancer sequences upstream of σ 54 -dependent promoters (reviewed in Zhang et al., 2002; Studholme and Dixon, 2003). RNA polymerase containing σ 54 binds to specific promoter DNA sequences and forms a relatively stable, inactive closed promoter complex (reviewed in Buck et al., 2000). Activator binding to enhancer sequences, usually located approximately 100 bp upstream of the transcriptional initiation site, in combination with looping of the intervening DNA, allows the enhancer binding protein to come into contact with the sigma subunit of the RNA polymerase holoenzyme, resulting in the isomerization of the promoter closed complex to an open complex and consequently, the activation of transcription (reviewed in Buck et al., 2000). In general, this transcriptional activation event often requires that the activator oligomerize when bound to the enhancer sequences and hydrolyse ATP (Porter et al., 1993; Wyman et al., 1997; Neuwald et al., 1999; Zhang et al., 2002; Lee et al., 2003; Schumacher et al., 2004). Homologues of FlbD are found within the group α- proteobacteria that synthesize polar flagella (Muir and Gober, 2004). In addition to containing conserved AAA+ and DNA binding domains, these FlbD homologues also possess a relatively conserved amino-terminal, two-component receiver domain. In other σ 54 activators containing this amino-terminal response regulator domain, phosphorylation on a conserved aspartate residue is required for transcriptional activation. The bacteria possessing homologues of FlbD also contain the conserved regulatory protein, FliX (Muir and Gober, 2004). In Caulobacter, FliX has been shown to be required for FlbD-dependent gene expression and motility (Mohr et al., 1998; Muir et al., 2001). Strains with deletions in flix readily acquire motile suppressor mutations that map to the gene encoding FlbD, indicating that FliX functions as a trans-acting factor and is not an essential structural component of the flagellum (Muir and Gober, 2002). All of the flix motile

3 Regulation of flagellar gene expression in C. crescentus 745 suppressor mutations in flbd relieve the transcriptional requirement for a class II-encoded flagellar substructure suggesting that FliX functions to inhibit FlbD activity in the absence of flagellar assembly. Genetic evidence supports this idea, as a gain-of-function mutation in flix that permits FlbD-dependent gene expression in the absence of early flagellar assembly has also been isolated (Muir et al., 2001). Therefore, FliX transduces information regarding the status of flagellar assembly to FlbD (Fig. 1). Genetic data suggest that FliX is a potent repressor of FlbD in the absence of a class II-encoded structure and stimulates FlbD activity when assembly of this flagellar structure is complete (Muir and Gober, 2002; 2004). Protein stability assays and bacterial two-hybrid analysis indicate that FliX and FlbD physically interact with each other and may form a complex in Caulobacter cells (Muir and Gober, 2002; 2004). Direct interaction of a σ 54 activator containing a two-component receiver domain with a regulatory protein would represent a unique mechanism of controlling the activity of this class of transcription factor. Here we investigate the mechanism of FliX-mediated regulation of FlbD activity. Using purified components, we show that FliX can specifically inhibit FlbD-activated transcription from a σ 54 -dependent promoter in vitro. Interestingly, a gain-of-function FlbD mutant that is active in the absence of class II flagellar assembly is resistant to the repressive effects of FliX in an in vitro transcription assay. Furthermore, we present evidence that FlbD and FliX form a complex both in vitro and in vivo. The formation of this complex with FliX apparently impairs the ability of wildtype FlbD to bind enhancer sequences, and to activate transcription, but has no effect on the capacity of FlbD to catalyse ATP hydrolysis. Based on these results, we propose that FliX represses FlbD activity in vivo prior to the assembly of class II flagellar structures via a direct interaction. Results FliX inhibits transcriptional activation by FlbD Genetic experiments have indicated that FliX can function both as an activator and a repressor of FlbD activity in Caulobacter (Muir et al., 2001; Muir and Gober, 2002; 2004). This switch in FliX activity is dictated by the cell cycle-regulated assembly of an early flagellar basal body substructure. The mechanism of FliX-mediated regulation of FlbD is not known, but is likely to involve a direct physical interaction as indicated by bacterial two-hybrid experiments in Escherichia. coli and protein stability assays in Caulobacter (Muir and Gober, 2004). Here we wanted to determine whether FliX could influence FlbD activity in vitro using purified proteins. We chose the Caulobacter flik (hook operon) flagellar promoter as a template to assay FlbD-dependent transcriptional activation as it is the best experimentally characterized late flagellar gene promoter (Mullin and Newton, 1989; Gober and Shapiro, 1990; Gober et al., 1991; Wingrove et al., 1993). This promoter contains the conserved cis-acting elements found in all FlbD-dependent class III/IV flagellar promoters including at least two FlbD binding sites (i.e. ftr enhancers) located approximately 100 bp upstream, a binding site for the DNA bending protein, integration host factor (IHF), and a σ 54 promoter (Fig. 2A). FlbD has been shown to activate transcription catalysed by σ 54 -containing RNA polymerase from E. coli in vitro using several different Caulobacter flagellar promoter DNA templates, including flik (Benson et al., 1994b; Wu et al., 1995). In initial experiments, we were unable to demonstrate FlbD-activated transcription using reconstituted E. coli σ 54 -containing RNA polymerase in conjunction with either flik or fljk (25 kda flagellin) flagellar promoter templates (data not shown). Although both of these promoters possess the conserved and critical GG and GC ( 24 bp and 12 bp respectively) dinucleotides found in most σ 54 promoter sequences, there are significant differences in the DNA residues lying between these core promoter sequences (Fig. 2A). It has been shown that this intervening DNA sequence, while not essential for promoter recognition by σ 54 -containing RNA polymerase, may be an important factor in influencing the affinity of polymerase for promoter DNA (Morett and Buck, 1989; Hoover et al., 1990). We created a mutant flik promoter using site-directed mutagenesis, changing the CG at 16,15 bp to TT, thus making a portion of the intervening DNA between the core promoter sequence similar to that of the E. coli glnap2 promoter (Fig. 2B). In order to determine whether this mutant promoter (flik-5p) could function in directing gene expression, we constructed a transcriptional fusion to a promoterless lacz reporter gene. This fusion was introduced into Caulobacter cells and promoter activity, assayed as β-galactosidase activity, was compared with cells containing a wild-type flik-lacz fusion (Fig. 2B). Interestingly, the mutant flik-5p-lacz fusion generated approximately 60% more β-galactosidase activity (2124 versus 1326 units) than the wild-type flik-lacz fusion. Importantly, introduction of the mutant flik-5p-lacz fusion into class II flagellar and flbd::tn5 mutant strains showed that gene expression was still subject to regulation by flbd and flagellar assembly (data not shown). Based on these results, we speculate that the increase in flik-5p activity may be a consequence of an enhanced affinity of RNA polymerase in binding to this promoter sequence. We employed the mutant flik-5p promoter in singlecycle in vitro transcription assays (Fig. 3). FlbD readily activated transcription from a supercoiled plasmid containing this mutant promoter (Fig. 3A), and as previously

4 746 R. J. Dutton, Z. Xu and J. W. Gober A ftr IHF s54-rnap hook operon promoter (flikp) B glnap2 flikp flik-5p AGTTGGCACAGATTTCGCTTTA AGTTGGCCCGACCGTTGCTGAG TT b-galactosidase activity (units) Fig. 2. Construction of an up mutation in the Caulobacter class II flik promoter. A. Shown is a schematic diagram of the class III flik flagellar promoter highlighting the critical cis-acting elements. This promoter and all other class III and class IV flagellar promoters contain a number (2 4) of ftr enhancer elements (Mullin and Newton, 1989; Gober et al., 1991; Wingrove et al., 1993). located approximately 100 bp (i.e. 110) from the transcriptional start site (indicated by an arrow). These conserved ftr enhancers serve as binding sites for the FlbD transcriptional activator. FlbD bound to enhancer DNA interacts with σ 54 -containing RNA polymerase (σ 54 - RNAP) bound to conserved promoter sequences located at 24 and 12 bp (indicated here as two black rectangles immediately to the left of the arrow) from the transcription start site. Interaction between FlbD and σ 54 -RNAP is facilitated by the DNA bending protein, IHF (Gober and Shapiro, 1990; Muir and Gober, 2005), that binds to promoter DNA located between ( 75, 40) the enhancer sequences and the promoter. B. Shown is a comparison of the core promoter sequences of the E. coli σ 54 -dependent glnap2 promoter and the C. crescentus flagellar flik promoter. The conserved 24, 12 regions are underlined and the invariant GG and GC dinucleotides are indicated in bold. In order to use the flik promoter as a template for in vitro transcription with enteric bacterial σ 54 -RNAP, we mutated the CG at 16, 15 bp to TT, creating flik-5p. Based on previous experiments with nitrogenase (nif) promoters, enteric bacterial σ 54 -RNAP would be predicted to bind to this mutant promoter with higher affinity (Morett and Buck, 1989; Hoover et al., 1990) (see text for details). The in vivo promoter activity of flik-5p was compared with that of wild-type flik by constructing transcriptional fusions to a promoterless lacz reporter gene (Gober and Shapiro, 1992) and assaying β- galactosidase activity as previously described (Mangan et al., 1995). The units of β-galactosidase are indicated and represent the mean activity measured in triplicate from three independently grown cultures. The standard deviation in assayed activity for this experiment was less than 3%. A FlbD FlbD-1204 no activator [FliX] (mm) B relative activity (%) wt FlbD [FliX] (mm) C [FliX] (mm) 0 15 D [FliX] (mm) flik-5p glnap2 PspFDHTH FlbD PspFDHTH Fig. 3. Effect of FliX on FlbD-activated transcription. A. Single-cycle transcription assays were performed testing the effect of FliX on FlbD-activated transcription using the flik-5p promoter. Shown is the radioactive transcript from the phosphorimager scan of the dried electrophoresis gel. σ 54 RNA polymerase-catalysed transcription activated by wild-type FlbD (450 nm) was inhibited by increasing concentrations of FliX (0.87 μm, 1.85 μm and 3.25 μm). Transcription activated by the gain-of-function mutant FlbD-1204 was relatively resistant to the repressive effects of FliX. B. Graphical representation of the data from the in vitro transcription experiment shown in (A) comparing the effect of increasing FliX concentration on FlbD (black diamonds) and FlbD-1204 (gray squares) activity. The amount of radioactive transcript without added FliX is indicated as 100% relative activity. Note that the data points of calculated activity with the highest concentrations of FliX (4.33 μm and 6.5 μm) depicted here, are not shown in part (A). C. Effect of FliX on PspFΔHTH-activated single-cycle transcription using the Caulobacter flik-5p promoter as a template. The PspFΔHTH concentration used here was 1.5 μm and FliX was 15 μm. D. Effect of FliX on wild-type FlbD- (1.2 μm, final concentration) and PspFΔHTH-(1.5 μm, final concentration) activated single-cycle transcription using the E. coli glnap2 promoter as a template. FliX was added, as indicated, in 10-fold excess relative to the activator monomer concentration. Note that transcriptional activation by FlbD using glnap2 compared with the flik-5p promoter requires a higher protein concentration (see text for details).

5 Regulation of flagellar gene expression in C. crescentus 747 reported (Benson et al., 1994b; Wu et al., 1995), transcriptional activation did not require FlbD phosphorylation. When purified FliX was included in the reaction mixture, there was a corresponding decrease in FlbD-activated transcription that was proportional to the concentration of FliX (Fig. 3A). For example, at a FliX concentration (870 nm) that was approximately twice that of FlbD (450 nm), there was a 76% reduction in the amount of flik transcript synthesized (Fig. 3B). Maximal inhibition of FlbD-activated transcription was observed when the FliX concentration was eight to 10 times in excess of FlbD (Fig. 3B) with a K I of approximately 620 nm. This datum indicates that purified FliX functions as a repressor of FlbD-activated transcription when present in the assay mixture at concentrations within the same order of magnitude as the FlbD concentration. The data also suggest that as a default activity, FliX functions as a negative regulator of FlbD and hence, of late flagellar gene transcription. This view is supported by previous in vivo experiments showing that FliX inhibited late flagellar gene expression in Caulobacter cells when overexpressed from a multicopy plasmid (Muir and Gober, 2002; 2004). In Caulobacter cells, FliX-mediated inhibition of FlbDdependent transcription occurs in the absence of an early, class II-encoded flagellar structure. We have isolated mutants containing gain-of-function alleles of flbd (called bfa for bypass of flagellar assembly) that activate class III and IV flagellar genes in the absence of an early flagellar structure, thus evading negative regulation by FliX (Mangan et al., 1995; Muir and Gober, 2002). We next tested whether one of these mutant FlbD proteins (FlbD-1204, V17M) would be resistant to the repressive effects of FliX in an in vitro transcription assay. As was the case with wild-type FlbD, FlbD-1204 was able to activate transcription in the absence of phosphorylation, although the maximum rate of RNA synthesis was approximately two-thirds less compared with wild-type FlbD. However, at relatively low concentrations, FliX had only a minor effect on FlbD activated transcription compared with the effect observed with wild-type FlbD (Fig. 3A and B). Additionally, in contrast to wild-type FlbD, we were unable to observe a complete inhibition of transcriptional activation by FlbD even in the presence of very high concentrations of FliX (K I greater than 5 μm) (Fig. 3B). This datum is consistent with previous genetic experiments and suggests that FlbD-1204 bypasses the requirement for early flagellar assembly by escaping negative regulation via FliX. FliX could not inhibit transcription when the mutant FlbD-1204 was employed in this assay indicating that FlbD, and not RNA polymerase, was the probable target of FliX-mediated inhibition of transcription. We then tested the specificity of the FliX effect by assaying whether FliX could inhibit the activity of a different σ 54 transcriptional activator, the phage shock protein, PspF. We employed a variant of this protein, PspFΔHTH, that is missing the carboxyl-terminal helix turn helix DNA-binding domain, and thus activates transcription when not bound to DNA enhancer elements (Jovanovic et al., 1999). If FliX inhibited the activity of PspFΔHTH it would suggest that it acted through a general repression pathway for σ 54 transcriptional activators, as this mutant protein contains only the conserved central AAA+ ATPase/σ 54 interaction domain. PspFΔHTH was able to activate transcription when the Caulobacter flik-5p promoter was used as template DNA (Fig. 3C). When FliX was premixed with PspFΔHTH at a ratio that completely abolished FlbD-activated transcription (PspFΔHTH:FliX = 1:10), there was no discernible decrease in transcript synthesis (Fig. 3C), indicating that PspFΔHTH is resistant to FliX negative regulation. Lastly, we tested whether the negative effect of FliX required a Caulobacter flagellar promoter, by employing the E. coli glnap2 promoter in the in vitro transcription assay (Fig. 3D). FlbD could activate transcription from this promoter, but required a higher protein concentration (approximately threefold) in order to obtain rates of RNA synthesis that were comparable with those observed using the flik-5p promoter. We were unable to demonstrate FlbD binding to this promoter template DNA (data not shown) suggesting that FlbD, like PspFΔHTH, can activate transcription from this promoter when not bound to DNA. Interestingly, preincubation of FlbD with FliX at a ratio (FlbD:FliX = 1:10) that completely inhibited transcription with the Caulobacter flik-5p promoter, resulted in only a modest repression (approximately 60%) of FlbD-activated transcription from the glnap2 promoter (Fig. 3D). Again, FliX had no effect on the ability of PspFΔHTH to activate transcription from this promoter (Fig. 3D). These results indicate that negative regulation of transcription by FliX is specific for FlbD and requires a Caulobacter flagellar promoter to exert maximal inhibition. FliX inhibits binding of enhancer DNA by FlbD The in vitro transcription experiments indicated that one possible mechanism by which FliX may repress transcription is to inhibit FlbD binding to enhancer DNA sequences. In support of this idea, FliX could not effectively repress FlbD-activated transcription when the E. coli glnap2 promoter was used as a template. In this case FlbD apparently activates in the absence of any discernable specific interaction with DNA. In order to determine if FliX had an effect on the ability of FlbD to bind enhancer sites, electrophoretic mobility shift experiments were performed. In one set of experiments we used a double-stranded oligonucleotide DNA (42 bp) containing a single FlbD binding site from the flif flagellar promoter (Fig. 4A). As reported previously (Wingrove and Gober, 1994), FlbD bound to this oligonucleotide as indicated by retarded mobility upon

6 748 R. J. Dutton, Z. Xu and J. W. Gober A B [FlbD/FliX] bound probe free probe no protein FlbD (wt) - - FlbD :1 1:5 1:10 1:1 1:5 1: [FlbD/FliX] - FlbD (wt) FlbD :1-1:1-1:1-1:1 bound probe bound probe bound probe Fig. 4. FliX inhibits the binding of FlbD to ftrcontaining DNA. A. Electrophoretic mobility shift assays were performed using a [ 32 P]-labelled doublestranded 42 bp oligonucleotide containing a single FlbD binding site (ftr) from the flif promoter region (Wingrove and Gober, 1994). The protein concentrations incubated with radioactive probe were as follows: wild-type FlbD (800 nm) or FlbD-1204 (400 nm), and increasing concentrations of FliX as indicated. After incubation, loading dye was added and reactions were subjected to electrophoresis in a 6% non-denaturing polyacrylamide gel at 100 V. The arrows next to the phosphorimager scan indicate bound probe and free probe. Note that wild-type FlbD when bound to this DNA fragment forms a complex that does not resolve into a well-defined electrophoretic band. B. Electrophoretic mobility shift assays were performed using a [ 32 P]-labelled doublestranded 160 bp fragment containing a single FlbD binding site (ftr) within the entire flik promoter region (Wingrove et al., 1993). Either wild-type FlbD (lanes 1) or FlbD-1204 (lane 5) (400 nm) were incubated with radioactive probe. An equimolar concentration of FliX was added were indicated (lanes 2 and 6). This same basic experiment was repeated in the presence of the slowly hydrolysable ATP analogue, ATPgS with wild-type FlbD (lanes 3 and 4) or FlbD-1204 (lanes 7 and 8). After incubation, loading dye was added and reactions were subjected to electrophoresis in a 4.5% nondenaturing polyacrylamide gel at 100 V. The arrows next to the phosphorimager scan indicate bound probe and free probe. free probe free probe electrophoresis (Fig. 4A). Inclusion of FliX in the reaction mixture at concentrations that inhibited transcriptional activation, almost completely abolished the formation of a specific FlbD-DNA complex that migrated into the gel. There was, however, a fraction of labelled DNA probe that did not enter the gel, and remained in the well, suggesting the presence of an aggregated FlbD-DNA complex. We then tested whether FliX could inhibit the DNA binding activity of the gain-of-function FlbD-1204 protein. When FlbD-1204 was incubated with the labelled oligonucleotide, two well-resolved gel mobility shift complexes were observed (Fig. 4A). These protein DNA complexes were relatively resistant to the addition of FliX, with reduced, but significant, binding activity detectable even in the presence of high concentrations of FliX (Fig. 4A). Next we performed a similar experiment using a fragment (160 bp) of flik promoter DNA containing a single FlbD binding site (Fig. 4B). Most of the wild-type FlbD formed a relatively slow migrating complex with this DNA fragment (Fig. 4B, lane 1) that was completely abolished by the addition of an equimolar amount of FliX (Fig. 4B, lane 2). Faster migrating FlbD-DNA complexes that were significantly less abundant increased slightly in the presence of FliX. We also tested whether the presence of nucleotide could influence FlbD binding activity and/or the effect of FliX. The presence of the slowly hydrolysable analogue, ATPγS, resulted in a decrease (approximately twofold) in FlbD binding activity, but had no effect on the inhibitory effect of FliX (Fig. 4B, lanes 3 and 4). Similar results were obtained when ATP was included in the assay mixture (data not shown). We also performed this same type of experiment with the mutant FlbD-1204 (Fig. 4B, lanes 5 8). FlbD-1204 formed several differently migrating complexes with flik promoter DNA that were relatively resistant to the inclusion of equimolar FliX in the assay (Fig. 4B, lanes 5 and 6). Similar to wild-type FlbD,

7 Regulation of flagellar gene expression in C. crescentus 749 the presence of FliX increased the abundance of a faster migrating FlbD DNA complex (Fig. 4B, lane 6). The presence of nucleotide (ATPγS) had no effect on FlbD DNA binding or FliX activity. These results suggest that FliX inhibits FlbD-activated transcription by interfering with the binding to enhancer DNA. Furthermore, the data indicate that FlbD-1204-regulated transcriptional activation is unaffected by FliX as a consequence of possessing a DNA binding activity that is relatively resistant to the negative effects of FliX. FliX forms a stable complex with FlbD Previous experiments that included bacterial two-hybrid analysis and protein stability assays have indicated that FliX and FlbD interact in vivo (Muir and Gober, 2004). Here we wanted to determine whether we could detect whether FliX and FlbD formed a complex using sizeexclusion chromatography. First, we determined the native subunit composition of FlbD in the absence of FliX. Analysis of the native molecular weight of FlbD revealed the presence of a range of oligomers. The majority of FlbD in our preparation appeared to exist as a dimer (Fig. 5A). We also observed several species that eluted earlier, corresponding to an estimated molecular mass of tetramers and also, present in lesser amounts, hexamers and dodecamers. Analysis of FliX by sizeexclusion chromatography revealed the presence of a major peak eluting at a volume that would correspond to a dimer subunit composition (approximately 30 kda) (Fig. 5B). When FliX was mixed with FlbD at a ratio that inhibited transcription (FlbD:FliX = 1:3), the apparent higher molecular weight species of FlbD were no longer observed (Fig. 5C). Additionally, the apparent size of FliX increased, with FliX and FlbD appearing in the same eluted fractions. The shift in the apparent molecular weight of both FlbD and FliX suggests that they formed a stable complex. Another possibility is that each protein alters the oligomerization state of the other without forming an experimentally detectable complex. Although the size-exclusion chromatography experiment presented here cannot distinguish between these two scenarios, we favour the interpretation that at least a fraction of FliX and FlbD are in complex with each other. The elution volumes indicated that a range of different species were present including FliX monomers and homodimers, as A fraction # void 1100 kda 413 kda 115 kda 58 kda kda anti-flbd FlbD apparent FlbD subunit composition B fraction # anti-flix FliX apparent FliX subunit composition C fraction # anti-flbd anti-flix FlbD+ FliX apparent FlbD/FliX subunit composition Fig. 5. Size-exclusion chromatography indicates the FliX and FlbD physically associate. A. Purified wild-type FlbD was subjected to size-exclusion chromatography, 0.5 ml fractions were collected, and protein was precipitated by the addition of TCA (5% final concentration). Following centrifugation, the precipitated protein pellets were suspended in SDS sample buffer and subjected to electrophoresis followed by immunoblot analysis using anti-flbd antibody. The estimated molecular masses based on the elution volumes of protein size standards (Bio-Rad) are indicated above the immunoblot. Below the immunoblot is a schematic representation of the estimated subunit composition of FlbD present in the eluted fractions. B. Purified FliX was subjected to size-exclusion chromatography and the eluted fractions were treated as described in (A). FliX was detected following immunoblot using anti-flix antisera. The first lane on the left was loaded with pure FliX as a control. C. Purified FliX and wild-type FlbD were premixed (monomer ratio of FliX:FlbD = 3:1) and then analysed by size-exclusion chromatography as described above. FlbD and FliX were detected following immunoblot using anti-flbd and anti-flix antisera respectively. Each of the first lanes on the left were loaded with pure FlbD and FliX as controls.

8 750 R. J. Dutton, Z. Xu and J. W. Gober well as apparent monomers of FlbD, heterodimers of FliX and FlbD, and heterotrimers with an apparent composition of FliX 2 FlbD 1 (Fig. 5C). Next we employed the gain-of-function FlbD-1204 allele in this assay. FlbD-1204, when analysed by size-exclusion chromatography, predominantly existed as higher-order oligomers, the majority of the protein being in apparent dodecameric or hexameric forms, with lesser amounts of tetramers present (Fig. 6A). This was in contrast to wildtype FlbD in which most of the protein existed as dimers (Fig. 5A). Surprisingly, when FliX was added to FlbD- 1204, it had almost the identical effect as on wild-type FlbD. The presence of FliX resulted in a shift of almost all the FlbD-1204 from higher-order oligomers to species in apparent complex with either one or two molecules of FliX (Fig. 6B) suggesting that FliX apparently interacts with FlbD This result is surprising because this mutant allele of FlbD is still able to activate transcription and bind DNA enhancer sequences. We then tested whether wildtype and FlbD-1204 also interacted with FliX in Caulobacter cells. In order to accomplish this, cell extracts were prepared and either wild-type or mutant FlbD was immunoprecipitated using affinity-purified anti-flbd antibodies. The immunoprecipitated material was then subjected to SDS-PAGE, followed by immunoblot analysis using anti- FliX antibodies (Fig. 6C). A strain bearing a Tn5 insertion in flbd served as a negative control in this experiment. The anti-flbd antibodies were able to co-immunoprecipitate FliX from strains expressing wild-type FlbD or FlbD but not the flbd::tn5 strain (Fig. 6C). Interestingly, although the cellular levels of either FliX or FlbD in the flbd-1204 strain were identical to those in wild-type cells (Fig. 6C), significantly more FliX could be immunoprecipitated from the mutant cells. This result suggests that FliX A fraction # void 1100 kda 413 kda 115 kda 58 kda kda anti-flbd FlbD-1204 apparent FlbD subunit composition B fraction # anti-flbd anti-flix FlbD FliX apparent FlbD/FliX subunit composition C wild-type flbd::tn5 flbd-1204 wild-type flbd::tn5 flbd-1204 FlbD FliX FliX immunoblot immunoprecipitation Fig. 6. Interaction of FliX with the gain-of-function mutant FlbD A. Purified mutant FlbD-1204 was subjected to size-exclusion chromatography and the eluted fractions were treated as described in the legend to Fig. 5. The estimated molecular masses based on the elution volumes of protein size standards (Bio-Rad) are indicated above the immunoblot. Below the immunoblot is a schematic representation of the estimated subunit composition of FlbD present in the eluted fractions. FlbD was detected following immunoblot using anti-flbd antibody. B. Purified FliX and mutant FlbD-1204 were premixed (monomer ratio of FliX:FlbD = 3:1) and then analysed by size-exclusion chromatography. FlbD and FliX were detected following immunoblot using anti-flbd antibody and anti-flix antisera respectively. C. Co-immunoprecipitation of FliX with both wild-type FlbD and FlbD-1204 from Caulobacter cell extracts. Extracts of Caulobacter cells were prepared and subjected to immunoblot directly using anti-flbd and anti-flix antibodies (shown on left). Additionally, these extracts were mixed with affinity purified FlbD antibody, and following immunoprecipitation and SDS-PAGE, the samples were analysed by immunoblot using ant-flix antibodies. FlbD antibodies could coimmunoprecipitate FliX from strains containing wild-type FlbD and the mutant FlbD-1204 allele, but not a strain bearing a Tn5 insertion in flbd (flbd::tn5).

9 Regulation of flagellar gene expression in C. crescentus 751 might form a more avid interaction with FlibD-1204 than with wild-type FlbD. Effect of FliX on FlbD ATPase activity Experiments using σ 54 transcriptional activators NtrC and PspF demonstrated a strict requirement for ATP hydrolysis in the activation of transcription (Weiss et al., 1991; Porter et al., 1993; 1995; Schumacher et al., 2004). ATP binding and hydrolysis are necessary for a productive interaction with the σ 54 subunit and is influenced by the oligomerization state (Wyman et al., 1997; Schumacher et al., 2004). Additionally, in the case of NtrC, ATP hydrolysis is stimulated by phosphorylation of the receiver domain and thus, is a target for regulation of transcriptional activation. Therefore, we determined the kinetics of ATP hydrolysis catalysed by FlbD and then examined whether FliX influenced this activity. We found that purified FlbD readily catalysed ATP hydrolysis (Fig. 7A) in the absence of phosphorylation of the receiver domain, possessing a turnover of approximately 39 per minute, and an apparent Km for ATP of 414 μm (Fig. 7B). These values are similar to those obtained with other σ 54 activators such as PspF and the phosphorylated form of NtrC (Weiss et al., 1991; Schumacher et al., 2004), suggesting that FlbD does not require covalent modification (i.e. phosphorylation) for relatively robust ATP hydrolysing activity. To examine the effect of A picomoles ADP/min B log(v/(vmax-v) wtd wtd+flix (1:5) ATP (mm) Fig. 7. Effect of FliX on FlbD-catalysed ATP hydrolysis. A. FlbD (400 nm) was incubated with or without FliX (2 μm) for 10 min prior to the addition of α- [ 32 P]-ATP plus non-radioactive ATP to achieve the final assay concentration noted on the X- axis. Following the 15 min incubation, reactions were stopped by the addition of 10 volumes of cold 2 M formic acid. Two microlitres from each reaction were spotted on a PEI-cellulose thin layer chromatography plate and chromatographed using lithium-formate buffer. After autoradiography of the dried plates, the amount of ADP released as a result of ATP hydrolysis by FlbD were quantified by phosphorimager analysis. B. A function of the initial rate of ATP hydrolysis is plotted versus the log of the ATP concentration (Hill plot) for wild-type FlbD. The Km was approximately 414 μm and the turnover/ min = 39. The Hill coefficient (from the slope of the regression curve) was C. Time-course experiment comparing ATP hydrolysis catalysed by wild-type FlbD (FlbD-wt) and the mutant FlbD log(atp) -0.6 C nanomoles ADP FlbD- wt FlbD Time (min)

10 752 R. J. Dutton, Z. Xu and J. W. Gober FliX on FlbD ATPase activity, FliX was preincubated with FlbD prior to initiating the reactions. Interestingly, the inclusion of FliX had no significant effect on the ATPase activity of FlbD, even when present at a concentration (4.4 μm; FlbD:FliX = 1:5) that completely abolished transcriptional activation (Fig. 7A). Lastly, we compared the capacity of the gain-of-function FlbD-1204 allele to hydrolyse ATP with that of wild-type FlbD. In a time-course experiment, in the presence of a saturating ATP concentration, there was no significant difference between FlbD and wild-type FlbD in the rate of catalysed ATP hydrolysis (Fig. 7C). Discussion One key property of σ 54 transcriptional activators is their capacity to form stable oligomers, an activity required for binding to enhancer DNA and/or transcriptional activation (Porter et al., 1993; Wyman et al., 1997; Neuwald et al., 1999; Zhang et al., 2002; Lee et al., 2003; Schumacher et al., 2004). In C. crescentus, the σ 54 transcriptional activator FlbD regulates temporal and spatial expression of late flagellar genes. Because the expression of these genes must occur not only at the correct time in the cell division cycle, but also at an appropriate period for their products to be incorporated into the nascent flagellar structure, FlbD activity must be responsive to multiple cellular inputs. For example, one major influence on FlbD activity is the progression of flagellar assembly. The conserved FliX protein operates a checkpoint coupling this assembly process to FlbD activity. Genetic experiments have indicated that FliX inhibits FlbD activity until an early MS-ring/switch/TTSS basal body structure has completed assembly, at which time, FliX switches into an activator of FlbD (Muir et al., 2001; Muir and Gober, 2002; 2004). In this paper we have investigated the mechanism of FliX-mediated regulation of FlbD activity in vitro using purified components. We have found that FliX inhibits FlbD-activated transcription, but not transcription activated by the σ 54 activator, PspFΔHTH, demonstrating that FliX action is specific for FlbD. Additionally, we have demonstrated that FliX physically interacts with FlbD and inhibits the binding of FlbD to enhancer DNA sequences. The association of RNA polymerase with the σ 54 subunit results in a holoenzyme with the unique property of being able to form a transcriptionally inactive, stable closed complex with promoter DNA (reviewed in Rombel et al., 1998; Neuwald et al., 1999; Zhang et al., 2002). Interaction with a transcriptional activator bound to enhancer sequences usually located approximately 100 bp upstream changes the conformation of σ 54 -containing RNA polymerase that, in turn, results in the melting of the promoter DNA duplex. This remodelling of the conformation of the RNA polymerase holoenzyme requires energy in the form of nucleotide triphosphate hydrolysis. Members of the family of σ 54 transcriptional activators always contain an ATPase domain of the large family of AAA+ proteins that are generally regarded to function as chaperones, reconfiguring the conformation of target proteins. In addition they possess a less highly conserved DNA binding domain at the carboxyl terminus. In order to activate transcription, these proteins oligomerize, a process that creates the active site to catalyse ATP hydrolysis and subsequently stimulate open complex formation (Porter et al., 1993; Wyman et al., 1997; Neuwald et al., 1999; Zhang et al., 2002; Lee et al., 2003; Schumacher et al., 2004). The presumed physiological advantage afforded by σ 54 - RNA polymerase-directed transcription is a large dynamic range of promoter activities that can be regulated at a level of control that is not achievable with σ 70 promoters (Buck et al., 2000). Experiments with a few well-studied σ 54 activators have revealed a variety of mechanisms by which regulation of transcriptional activation in response to environmental or developmental signals can be accomplished. Many σ 54 transcriptional activators contain an additional sensory input domain that regulates activity (Studholme and Dixon, 2003). Often this is an aminoterminal response regulator domain that can be phosphorylated on a conserved aspartate residue. The best studied of this class of activator is the enteric bacterial NtrC protein. Phosphorylation of NtrC converts the protein from a dimer to higher-order oligomers, thus stimulating ATPase activity (Porter et al., 1993; Wyman et al., 1997; Lee et al., 2003). Remarkably, in activators of this type, phosphorylation of the relatively conserved amino-terminal receiver domain can function in two distinct ways to regulate activity. In the case of NtrC, phosphorylation acts positively on the AAA+ domain, promoting oligomerization, whereas in the DctD protein of rhizobia, the aminoterminal domain inhibits transcriptional activity unless it is phosphorylated (Huala et al., 1992; Gu et al., 1994). FlbD possesses an amino-terminal response regulator domain that diverges, in some respects, significantly from other receiver domains (Muir and Gober, 2004). Most notably, FlbD contains the conserved critical aspartate that is phosphorylated in other proteins, but lacks other key residues that have been shown to directly participate in phosphorylation and dephosphorylation (Volz, 1993). Although no corresponding cognate histidine kinase for FlbD has been identified, it was shown to exhibit a cell-cycle dependent phosphorylation pattern (Wingrove et al., 1993) and additionally, FlbD-activated in vitro transcription can be stimulated by the addition of high-energy phosphate donors (Benson et al., 1994b). The significance of FlbD phosphorylation is unclear, as experiments presented here, as well as those performed by others (Benson et al., 1994b; Wu et al., 1995), demonstrated that FlbD is active

11 Regulation of flagellar gene expression in C. crescentus 753 in the absence of phosphorylation. It is possible that in vivo phosphorylation of FlbD is required to enhance activity or fine-tune regulation in response to an additional environmental cue such as progression through the cell cycle. In support of this idea, cells expressing a FlbD allele that mimicked phosphorylation of the critical aspartate (i.e. D52E) exhibited enhanced FlbD activity (Wingrove and Gober, 1994). The activity of σ 54 transcriptional activators can also be influenced through the interaction with a regulatory partner protein that may, in some cases, associate with an amino-terminal sensory domain. For example, the σ 54 activator, PspF, is comprised of only two domains, the AAA+ and DNA-binding domains, and displays constitutive activity in vitro (Jovanovic et al., 1999). The activity of its AAA+ domain is repressed through a direct interaction with a partner protein, PspA, in response to the status of the integrity of the cytoplasmic membrane (Dworkin et al., 2000; Elderkin et al., 2002). PspA represses transcription by binding to the AAA+ domain and inhibiting ATP hydrolysis (Elderkin et al., 2002). Another well-studied σ 54 transcriptional activator-regulatory partner protein pair is NifA/ NifL. These regulators are found in a diverse group of nitrogen fixing bacteria, where NifA activates the transcription of σ 54 -requiring nitrogenase gene promoters, and NifL represses NifA activity in response to a high cytosolic redox state (reviewed in Martinez-Argudo et al., 2004). NifA not only possesses the conserved AAA+ and DNAbinding domains, but also a conserved, amino-terminal GAF sensory module that is required for NifL-mediated negative regulation (Martinez-Argudo et al., 2004). NifL has been shown to inhibit NifA-activated transcription by inhibiting ATPase activity and, possibly, interaction with σ 54 (Money et al., 1999; Barrett et al., 2001). Thus, FliX regulation of FlbD activity exhibits some striking similarities to PspA and NifL-mediated regulation of transcription. Our results indicate that FliX inhibits FlbDactivated transcription by disrupting interaction with enhancer DNA. In support of this idea, FliX was much less efficient at inhibiting transcription when the enteric glnap2 promoter that lacks a FlbD binding site was used as a template. Additionally, previous experiments have shown that FlbD-mediated repression of flif transcription, an effect that only requires FlbD to bind to operator sequences (Wingrove and Gober, 1994), is inhibited when FliX is overexpressed in Caulobacter cells (Muir and Gober, 2002, 2004). The in vitro transcription experiments also indicate that FliX regulation is specific for FlbD and thus is probably not a global regulator of σ 54 -directed transcription in Caulobacter. In solution, using size-exclusion chromatography, wildtype FlbD was found to exist predominantly as dimers, with some tetramers, and significantly less higher-order oligomers. NtrC in the inactive, unphosphorylated state, has also been shown to exist primarily in the dimeric form (Klose et al., 1994). Experiments have shown that the dimeric form of NtrC is converted to a higher-order oligomeric form upon phosphorylation (Porter et al., 1993; Wyman et al., 1997), an event that stimulates ATPase activity and transcriptional activation (Popham et al., 1989; Weiss et al., 1991). In contrast, we have found that FlbD is apparently competent to activate transcription efficiently without an abundance of higher-order oligomers present in solution. One likely possibility is that FlbD may oligomerize when bound to enhancer DNA. In the presence of FliX, we were unable to detect the existence of any higher-order oligomer of FlbD, including the tetrameric form. All of the FlbD present was in an apparently lower molecular weight form. As the apparent molecular mass of FliX also shifted, and appeared in the same column fractions as FlbD, we propose that FlbD and FliX form a complex consisting predominantly of monomeric FlbD in association with either one or two molecules of FliX. The co-immunoprecipitation experiments presented here indicate that it is likely that FlbD and FliX also form a complex in vivo. These complexes are apparently not competent to bind DNA and thus exhibit a marked inability to activate transcription. Does FliX alter the oligomerization state of FlbD in order to repress transcription? Both PspF and NtrC have been shown to require oligomerization for efficient ATP hydrolysis (Porter et al., 1993; Schumacher et al., 2004). Because the presence of FliX did not apparently affect FlbD-catalysed ATPase activity, we propose that FliX probably does not alter the oligomerization state of FlbD under the conditions of the ATPase and transcriptional activation assays. One possibility is that FliX may interact preferentially with the monomeric or dimeric state of FlbD, and the dilution effect of the gel filtration experiment shifted the equilibrium in favour of a lower subunit species. Genetic experiments first established FliX as a transacting factor that regulated FlbD-dependent gene expression in Caulobacter (Muir et al., 2001). One of the most compelling findings supporting this idea was the isolation of flbd mutants that suppressed the motility defect in strains containing deletions in flix (Muir et al., 2001; Muir and Gober, 2002). The presence of these mutant alleles of flbd restore not only motility in ΔfliX strains, but also late flagellar gene transcription in strains containing mutations in class II flagellar genes. The 18 independent gainof-function mutations in FlbD that have been mapped lie in the receiver domain, the AAA+ ATPase domain, or the carboxyl-terminal DNA binding domain (Muir and Gober, 2002). Thus, mutations in any one of the functional domains of FlbD can evade negative regulation by FliX. Here, we compared the effects of FliX on the activity of one of these, FlbD-1204 (V14M, in the receiver domain) to wild-type FlbD in the in vitro transcription assay. Tran-