Total RNA was isolated with Trizol reagent (Invitrogen Corp.) according to the

Transcription

1 Supplemental Materials and Methods Isolation and analysis of RNA Total RNA was isolated with Trizol reagent (Invitrogen Corp.) according to the manufacturer s instructions. For isolation of nuclear and cytoplasmic RNAs, cytoplasmic supernatant was separated from nuclear pellet after lyzing cytoplasmic membrane with NP-40 lysis buffer (10 mm Tris-HCl ph 7.4, 10 mm NaCl, 3 mm MgCl 2, 0.5 % NP-40, 1 mm DTT, and 400 U/ml RNasin RNase inhibitor from Promega Corp.). The nuclear pellet was washed once with the same buffer, resuspended with Trizol reagent and subjected to RNA preparation. The cytoplasmic supernatant was precipitated by an equal volume of isopropanol and the resulting pellet subjected to RNA isolation with Trizol reagent. Nuclear run-on assay was performed as described (Kim, H.K., Lee, Y.S., Sivaprasad, U., Malhotra, A., and Dutta, A Muscle-specific microrna mir-206 promotes muscle differentiation. J Cell Biol 174: ), with a DNA fragment spanning the first exon of HMGA2 as a probe (nucleotides in NM_ ). RLM-PCR was performed as previously described (Kim, H.K., Lee, Y.S., Sivaprasad, U., Malhotra, A., and Dutta, A Muscle-specific microrna mir-206 promotes muscle differentiation. J Cell Biol 174: ). Luciferase assay Luciferase assays were performed as described in (Kim, H.K., Lee, Y.S., Sivaprasad, U., Malhotra, A., and Dutta, A Muscle-specific microrna mir-206 promotes muscle differentiation. J Cell Biol 174: ). To generate the point

2 mutations in each predicted target site (Fig 3A and Table S2), the six nucleotides complementary to the seed sequence of let-7 were replaced by non-cognate nucleotides. Transfection of GL2 or let-7 duplex into H1299 was followed by transfection of the luciferase reporter plasmids. Renilla luciferase activity (Rr) was first normalized to the firefly (Photinus pyralis) luciferase activity (Pp) from the co-transfected pgl3-control vector (Promega Corp.) to obtain the Rr/Pp value. Rr/Pp value obtained from cells transfected with let-7 was divided by the Rr/Pp value from cells transfected with GL2 control, to calculate the extent of repression by let-7 as the relative Rr/Pp. prl-cmv does not contain a let-7 target site and so the relative Rr/Pp from prl-cmv vector is set as one. A relative Rr/Pp value of 0.5 therefore means that let-7 represses the corresponding reporter by a factor of 2.

3 Supplemental Figure Legends Figure S1. Control experiments for the RNAi knockdown of Dicer/Drosha and the sub-cellular fractionation A. The knockdown of Dicer or Drosha in Fig 1 was confirmed by RT-PCR amplification of the mrna (see Table S1 for the primers used). The result with β-actin and a representative result with no reverse transcriptase during cdna synthesis (-RT) are included as controls. Each band is labeled with its size in base-pairs (bp). B. Top panel; validation of fractionation by assaying the RNA from total (tot), nuclear (nuc), and cytoplasmic (cyt) fraction of HeLa cells by primer extension assays as previously described (Lee et al. 2005). snou38b (small nucleolar RNA U38b; X ) is a nuclear marker and 5S rrna is a loading control (Table S1 for details of primers). The extension products are indicated by arrows. Bottom panel; the pre- and mature mrna of HMGA2 in HeLa cells detected by RT-PCR with the fractionated RNAs. Signals from pre- and mature mrna were visualized after 30 cycles of amplification. Each amplified fragment is labeled with its expected size in bp. Figure S2. Overexpression or inhibition of let-7 A. Artificial or natural target sites of let-7. prl-let-7b_as and prl-let-7e_as contain perfectly complementary sites to let-7b and let-7e, respectively, downstream of the Renilla luciferase ORF in the prl-cmv vector. Nucleotides and of HMGA2 cdna (NM_ ; see also Fig 3A) are cloned downstream of Renilla

4 luciferase to generate prl-hmg and prl-hmg , respectively. Using the miranda program (Enright, A.J., B. John, U. Gaul, T. Tuschl, C. Sander, and D.S. Marks MicroRNA targets in Drosophila. Genome Biol 5: R1), each target mrna sequence was aligned with let-7b and let-7e, and the energy values of each interaction indicated. B. Luciferase assays to show repression by let-7 RNA duplex of artificial sites complementary to let-7b or let-7e and of natural sites in the HMGA2 mrna. Transfection of each sirna duplex into H1299 was followed by transfection of prl- CMV (plain bar) or its derivatives (indicated by the color at the right of the graph). Relative Rr/Pp values plotted: average and standard deviation of triplicate samples. C. Luciferase assays to show de-repression of let-7 targeted luciferase reporters after transfection of 2 -O-methyl antisense oligonucleotide into HeLa cells. D and E. Northern hybridization of HMGA2 and gapdh after transfection of RNA duplexes shows repression of HMGA2 mrna by indicated RNA duplexes in indicated cell lines. let-7 is an equimolar mixture of let-7b and -7e. Figure S3. Cleavage sites on HMGA2 mrna after let-7 transfection The RLM-PCR products in Fig 3D were cloned into pcr4-topo vector (Invitrogen Corp.) and individual clones sequenced to identify the 5 ends of degradation products of HMGA2. The RLM products from P1 and P2 in Fig 3D are represented in parts A and B, respectively. The sequence of HMGA2 mrna (NM_ ) is shown with the 5 ends of degradation products marked with downward and upward arrowheads for let-7 duplex and GL2 control duplex, respectively. Number of arrowheads indicates frequency

5 of cloning of a specific cleavage product. Boxes: predicted target sequences (see also Fig 3A, Fig S2A, and Table S2). The primer sequences used for the RLM-PCR are indicated by arrows (see also Table S1). Thick solid arrows, primers for cdna synthesis; dashed arrows, primers for the first-round PCR; thin solid arrows, primers for the second-round PCR Table S1. Primers used in this study Table S2. Target sites of let-7 in HMGA2 mrna The predicted target sites and their interactions with let-7 mirna are shown.

6

7

8

9 Lee_TableS1 Primer name Sequence (5 to 3 ) remarks HMGA2_RT_for CACTCCAAGTCTCTTCCCTTTCCAAGC RT-PCR amplification of HMGA2 mature and pre mrna HMGA2_RT_rev GGGGGTCTAGAGCGTCCTCTCTTCTGAGGCGCT RT-PCR amplification of HMGA2 mature mrna HMGA2pre_RT_rev TGCCCCCACCGCGCCCTCGTACTGA RT-PCR amplification of HMGA2 pre mrna Dicer_RT_for TTAACCAGCTGTGGGGAGAGGGCTG RT-PCR amplification of dicer mrna Dicer_RT_rev AGCCAGCGATGCAAAGATGGTGTTG RT-PCR amplification of dicer mrna Drosha_RT_for GATCACCATCTCTGGAAAGGTCCTAC RT-PCR amplification of drosha mrna Drosha_RT_rev TTTCTTGCCTGCTCCCCAACTCCT RT-PCR amplification of drosha mrna β-actin_rt_for TGAAGTGTGACGTGGACATCCGC RT-PCR amplification of β-actin mrna β-actin_rt_rev GCCAATCTCATCTTGTTTTCTGCGC RT-PCR amplification of β-actin mrna 5S rrna-ext GATCGGGCGCGTTCAGGGTGGTAT small RNA northern and primer extension assay for 5S rrna snou38b-ext AGAACTGGACAAAGTTTTCATCAC primer extension assay for snou38b let-7b_as ACCACACAACCTACTACCTCA small RNA northern for let-7 let-7e_as ACTATACAACCTCCTACCTCA small RNA northern for let-7 HMGA2_ GAGGTGTACACAGTGTTACACAC cdna synthesis for RNA ligase-mediated PCR (RLM-PCR) HMGA2_ ACACCGCGTTCTTCCTATATGAATG the first-round PCR reaction in RLM-PCR HMGA2_ TGCCCGACGTCACAAGTGTGACA the second-round PCR reaction in RLM-PCR HMGA2_ CACAGAGGCTGTTATGTTTATTGTGC cdna synthesis for RNA ligase-mediated PCR (RLM-PCR) HMGA2_ GCAGAACAGACAGTGATAATACACT the first-round PCR reaction in RLM-PCR HMGA2_ CTAGAGAAATATTTTCAACAAGCAAGCG the second-round PCR reaction in RLM-PCR

10 let-7b let-7e Predicted by 3' UUGG-UGU-G-UUGGAUGAUGGAGU 5' : : : : : 1146 CGCCAACGTTCGATTT-CTACCTCA 1169 Energy: kcal/mol 3' U-UGGUG-UGU-UGGAUG-AUGGAGU 5' : 2232 AGACC-TGA-ATACC-ACTTACCTCA 2254 Energy: kcal/mol 3' UUGGUGU-GU-UGG-AUGAUGGAGU 5' :: 2255 AATTA-AGCATA-TGTGTTACTTCA 2277 Energy: kcal/mol 3' U-U-GGUGUG-U-UG-GAUGAUGGAG-U 5' 2378 ATATCCCCACTACTCAATACTACCTCTG 2405 Energy: kcal/mol 3' UUGGUG-UGUU-GGAUGAUGGAGU 5' : 2745 TACC-CTCCAAGTCTG-TACCTCA 2766 Energy: kcal/mol 3' UUGGUGUGUUGGAU-GAUGGAGU 5' : : :: 2796 GACT-TGCAA-AGACCTACCTC 2815 Energy: kcal/mol 3' UUGGUGUGU-UG-GAUGAUGGAGU 5' : 3647 AATCA-AAACACACTACTACCTCT 3669 Energy: kcal/mol 3' UUGGUGUGUU-G-GAU-G-AUGGAGU 5' : : 3663 TACCTCTTAAGTCCCAGTATACCTCA 3688 Energy: kcal/mol 3' UG-AUAUGUUGGAGGAUGGAGU 5' : 1151 ACGT-T-CGA-TTTCTACCTCA 1169 Energy: kcal/mol 3' U-GAUAUGU-UGGAGGAUGGAGU 5' : 2234 ACCTG-A-ATACCACTTACCTCA 2254 Energy: kcal/mol 3' UGAUAU-GU-UGG-AGGAUGGAGU 5' : 2256 ATTA-AGCATA-TGTGTTACTTCA 2277 Energy: kcal/mol 3' UGAU-AUGUUGGAGGAUGGAG-U 5' 2386 ACTACT-CAA-T-ACTACCTCTG 2405 Energy: kcal/mol 3' UGAUAUGUUGGAGG-AUGGAGU 5' 2746 ACCCTCCAAG-TCTGTACCTCA 2766 Energy: kcal/mol 3' UGAUAUGUUGGAGGAUGGAGU 5' : 2797 ACT-TGCAAAGACCTACCTC 2815 Energy: kcal/mol 3' UGAUA-U-GU-UG-GAGGAUGGAGU 5' 3645 ACAATCAAAACACACTACTACCTCT 3669 Energy: kcal/mol 3' U-GA-UAUGUU-G-G-AGGAUGGAGU 5' : 3664 ACCTCTTA-AGTCCCAGTATACCTCA 3688 Energy: kcal/mol Lee_TableS2 Site number in Figure 3A miranda 1) 2) #1169 3) 1) Enright, A.J., B. John, U. Gaul, T. Tuschl, C. Sander, and D.S. Marks MicroRNA targets in Drosophila. Genome Biol 5: R1. 2) Krek, A., D. Grun, M.N. Poy, R. Wolf, L. Rosenberg, E.J. Epstein, P. MacMenamin, I. da Piedade, K.C. Gunsalus, M. Stoffel, and N. Rajewsky Combinatorial microrna target predictions. Nat Genet 37: ) Lewis, B.P., I.H. Shih, M.W. Jones-Rhoades, D.P. Bartel, and C.B. Burge Prediction of mammalian microrna targets. Cell 115: #2254 miranda #2277 miranda miranda miranda #2405 #2766 #2815 #3669 #3688