Optimization of the methods for efficient delivery and expression of the CRISPR/Cas9 components in wheat

Transcription

1 Optimization of the methods for efficient delivery and expression of the CRISPR/Cas9 components in wheat Pankaj Bhowmik 2 nd ISPF, Saskatoon September 8, 2017

2 Three D s for efficient CRISPR Design Better Deliver Faster Detect Cheaper Frequency of gene editing 2 of 32

3 Genome Editing Platform at the NRC Designing and Synthesis of targeting sgrnas Cloning onstructs, IVT sgrnas, RNPs and its validation PCR/RE genotyping of clones with targeted mutation Delivery of genome editing components Biolistic CPP PEG DNA sequencing of clones Screening of putative transformants Regeneration and selection of genetically improved plant with desired trait 3

4 Improving existing platform for GE Fielder Bobwhite It requires preparation of large number of scuttella Conventioanal Biolistics-mediated Transformation of wheat embryo (scuttella) : weeks Following inoculation with Agrobacterium, embryos are placed on a medium that allows for growth of both the embryos and the Agrobacterium. It is essential to use timentin for killing remaining A. tumefaciens cells after co-cultivation Conventional Agrobacterium-mediated Transformation: weeks Over all duration: weeks (with Hammerlindl and Kolenovsky) 4

5 Improving existing platform: Strong expression of the Cas9-dsRed plasmid 5

6 Improving existing platform: Strong expression of the Cas9-dsRed plasmid 6

7 Biolistic and Agro-mediated delivery Can be applied to a wider range of genotypes but limited by the inability to regenerate plants Regeneration response depends on particle type, size, quantity, DNA amount, tissue type, and pretreatment Efficient Agrobacterium-mediated transformation is typically limited to a narrow range of genotypes within a species Often, cells that are readily transformed can not be regenerated, and vice versa 7

8 Optimization of novel approaches 8

9 Delivery of CRISPR-Cas9 into wheat PEG Biolistic/Electroporation Biolistic/Agrobacterium 9

10 Optimization of Mesophyll Protoplast Isolation 10 of 32

11 Demonstration of successful delivery 11

12 Microspore system Wheat heads Anthers in blender cup Microspores ready for electroporation Cultured embryos Green shoots Plantlets Over all duration: weeks 12

13 Advantages of isolated microspores Millions of microspores can be easily isolated Economic and simpler Traits are "fixed" in a homozygous plant Microspores can be sorted and enriched using FACS 13

14 Gene editing using wheat microspores dsred expressing microspores dsred knocked out (with Masaki Endo) 14

15 Regeneration of microspore edited plants Challenges: albino plants; chromosome doubling colchicine treatment 15

16 Gene editing in wheat B12 TaLOX 75 G07 TaLOX 84 B12 TaLOX 75 WT GTGCCGCGCGACGAGCTCTTCGG GTGCCGCGCGACGAGCTCTTCGG WT C9 C12 C10 Example chromatograms and representative sequences identified from pooled calli, microspores and T0 plants. Red letters indicate the substitution, insertion or deletion of nucleotides (with Caixia Gao and co-workers) 16

17 Take home messages 1. Remember, one of the 3 D s - efficient delivery of CRISPR components is essential for any GE experiment 2. Failure to express either the grna or Cas9 in your target explants will result in a failed experiment 3. CRISPR components can be expressed stably or transiently depending on the objective of your experiment 4. Delivery method and explants have to be selected accordingly 5. Main goals of our research is to improve delivery and regeneration efficiency Planning GE experiment? 6. Efficiency depends on plasmid size, DNA quality and number of plasmids (other reagents) co-delivered 17

18 Acknowledgements Research team and the gene editing working group: Sateesh Kagale Brittany Polley Manoj Kulkarni Halim Song Venkatesh Bollina Sandra Polvi Patricia Polowick Kishore Rajagopalan Collaborators: Tim SHARBEL (GIFS) Masaki ENDO (NIAS, Japan) Caixa GAO (IGDB, China) Bing Yang (ISU) Dan VOYTAS (UMN) Brett Dalman (Thermo Fisher) Funding: National Research Council of Canada Gibco Grant Program (Thermo Fisher Scientific)

19 Thank you Pankaj Bhowmik, Research Officer Pankaj.