Unit 4 - Molecular Genetics. Recall Notes on DNA!

Transcription

1 Unit 4 - Molecular Genetics Recall Notes on DNA!

2 Complete Lab Exercise 4.1.1: Evidence of Hereditary Material

3 DNA Replication and Repair During cell division in eukaryotic cells, the replicated genetic material in the nucleus is. It is important that each has an of the parent cell s DNA.

4 DNA replication is

5 Steps to Replication 1. Replication begins at a on the DNA known as the.

6 The two strands of DNA are held together by and are twisted to form a. To expose a, the DNA must be. 2. The the double helix by breaking the between base pairs. 3. Base pairs want to, so bind to the exposed DNA single strands and

7 4. is an enzyme that relieves any brought about by the of the DNA (bacteria) both strands of DNA, allowing them to, then the cut strands.

8 Replication begins in from the origin(s) are built as soon as an area of the DNA has been unwound. Where two strands of DNA are unwound, where they are joined is called DNA replication moves

9

10 are the three enzymes known to function in. requires a template to start synthesizing a new complementary DNA strand. 5. The enzyme lays down that will be used by as a starting point to build

11 6. DNA polymerase III adds the appropriate to the of the new strand using the template strand as a guide.

12 is built continuously the replication fork. (5' to 3') composed of short segments of DNA, known as, is built in pieces from the replication fork.

13 7. excises the and replaces them with the appropriate deoxyribonucleotides. 8. joins the gaps in the by the creation of a bond. 9.. If mistakes are found the act as an, excising incorrectly paired nucleotides and replacing.

14 DNA Organization In the nucleus, the human genome is organized into Chromosomes consist of DNA wrapped around protein - called Every nucleotides, the DNA is coiled around a core group of, known as. (+ve histones attracted to -ve charged DNA. = nucleosome coil into chromatin fibres. Chromatin fibres then into chromatin Chromatin coils again to form a

15

16 Different organisms have different # of chromosomes. of DNA codes for proteins. of the human genome is.

17

18 Noncoding regions are filled (repeating sequences - TAGTAGTAGTAG) The have long sequences of repetitive noncoding DNA, known. Repetitive DNA sequences are also found in the region of the, which play a role. Chromosomes also contain. (sequence similar to a functioning gene ). Two types - LINEs SINEs The function of LINEs and SINEs is not clear.

19 Protein Synthesis experiments with garden peas laid the foundation for genetics. His results led to the idea that were responsible for the patterns of inheritance Today these are known as, and they direct the production of.

20 Garrod s Hypothesis The physician Archibald Garrod was the first to hypothesize that in 1909

21 George Beadle and Edward Tatum Thirty-three years later, these 2 were able to demonstrate the relationship. Summarized this relationship as the.

22 Vernon Ingram Now known as the (genes also code for ) V.I. demonstrated the relationship while studying the of hemoglobin from individuals with.

23 Even though this an effective way to think of genes, science has recently and found that there seem to be "only" about. The problem is humans produce at least different!! The research is still ongoing today, but it looks like a can code for. (More later)

24 So how are proteins made? DNA contains the, but their seem to be many complications if it is the DNA that gives rise to protiens: - DNA is too to be allowed out of the. - Only of DNA in a cell: Protein is required. Proteins need to be The answer is. DNA is into an RNA message and then

25

26 Transcription Transcription can be divided into three sequential processes: Initiation Transcription begins when the binds to the segment of DNA that is to be and It binds to the DNA molecule of the gene to be transcribed. This region is a sequence on one strand of DNA called the. In most genes it looks like

27

28 binds to the which is the strand of DNA that is used as a to build The other strand of DNA is the and is transcription. It will be identical in sequence to

29 2. Elongation -The opens the double helix - It starts building in the direction of. - RNA polymerase. - The itself does not. - The process is similar to that of.

30 AGCTTCCGAGATACAGTAATAGC

31 3. Termination Elongation continues until recognizes the end of the gene -. At the, the newly synthesized mrna disassociates, and the RNA polymerase released.

32 Posttranscriptional Modifications The mrna (known as ) needs to be before leaving the nucleus. A is added to the start of the primary transcript. This protects the as it exits the nucleus. It also plays a role in the. A string of approximately are added to the

33 Genes also contain regions ( ) and regions (known as ). The are interspersed among ; must be removed. The are removed by. cut out the and join the remaining.

34 The. Unlike DNA replication, there is enzyme. This results in more. Genes are transcribed, so compared to DNA replication.

35 Only genes??? T I M E

36 mrna TRANSLATION Once in the the mrna it can be. is the process of of the mrna into ind to the mrna, recognizing the in eukaryotes. The ribosome consists of two subunits,. The two subunits clamp around the mrna and proceed along the mrna in the to the growing polypeptide chain

37

38 Reading Code There are but only in mrna. To code for, a sequence of is used for each amino acid. Each is called a. Each and more than one can code for a. This redundancy minimizes that may lead to. One serves as the and others serve as The mrna is

39

40

41 Using the genetic code, decipher the following mrna sequence: 5' - GGCAUGGGACAUUAUUUUGCCCGUUGUGGUGGGGCGUGA - 3'

42 The genetic code is. The same is used for translation in from with only a few isolated exceptions. trna In order to synthesize the the ribosome requires the to be delivered to it..

43 trna's structure resembles a where one arm of trna, a sequence of recognizes the The other arm carries the

44 Every trna carries only (aminoacyl-trna) Therefore at least different are required, but means possible different types of It has been observed that sometimes of an anticodon are needed. For example the anticodon which both code for. This flexibility makes it possible for to be added despite of mrna.

45 The first codon is the. This means that every The ribosome has two sites for trna: Here is how it works: 1. The trna that carries. 2. The next trna. 3. is bonded to the. 4.Next the ribosome.

46

47 This process continues, growing the The trnas that have been released are recycled by The ribosome will eventually reach.

48 A protein known as a release factor recognizes that the ribosome has stalled and releases the polypeptide chain from the ribosome by releasing the 2 subunits of the ribosome. Final modifications may include sugars (glycosylation) or phosphate being added to some of the amino acid residues and the peptide may also be cleaved at specific places

49

50

51

52 Control of Gene Expression Cells have developed methods by which they can control the of genes - called Genes that are (always being ) are known as Other genes can be turned on and off by turn genes on when required. Regulation occur at :

53

54 The lac Operon use to control gene expression. An is composed of a cluster of, a, and, between these two regions, a short sequence of bases known as an. The lac operon uses to control the of the gene, the enzyme used to break down lactose

55 1. Made of three genes,. 2. The is a that blocks the transcription of the gene by binding to the, which covers part of the promoter and therefore gets in the way of the

56 3. Lactose acts as an (controls specific ). If lactose, it binds to the changing its shape. (Signal molecule ) 4. RNA can now transcribe the

57 The trp operon In contrast to the lac operon, the trp operon is The is the.

58 1. When tryptophan levels, the amino acid binds to the, altering its shape. 2. The trp repressor complex can now bind to the. Tryptophan is called a. 3. When the level of this, the protein (lack of the corepressor). 4. The trp repressor. 5. The is free to (increasing in tryptophan production)

59

60 Mutations Mutations are Mutations may cause for an organism. Hemophilia can be caused by a mutation that changes the!

61 Lactose Tolerance The domestication of plants and animals roughly 10,000 years ago profoundly changed human diets, and it gave those individuals who could best digest the new foods a selective advantage. The best understood of these adaptations is lactose tolerance (Sabeti et al., 2006; Bersaglieri et al., 2004). The ability to digest lactose, a sugar found in milk, usually disappears before adulthood in mammals, and the same is true in most human populations. However, for some people, including a large fraction of individuals of European descent, the ability to break down lactose persists because of a mutation in the lactase gene (LCT). This suggests that the allele became common in Europe because of increased nutrition from cow's milk, which became available after the domestication of cattle. This hypothesis was eventually confirmed by Todd Bersaglieri and his colleagues, who demonstrated that the lactase persistence allele is common in Europeans (nearly 80% of people of European descent carry this allele). Indeed, lactose tolerance is one of the strongest signals of selection seen anywhere in the genome. Sarah Tishkoff and colleagues subsequently found a distinct LCT mutation also conferring lactose tolerance, in this case in African pastoralist populations, suggesting the action of convergent evolution (Tishkoff et al., 2007).

62 Malaria Resistance The development of agriculture also changed the selective pressures on humans in another way: Increased population density made the transmission of infectious diseases easier. That role is reflected in the traces left by selection in human genetic diversity; multiple loci associated with disease resistance. In most cases, the resistance is to the same disease malaria (Kwiatkowski, 2005). Malaria's power to drive selection is not surprising, as it is one of the human population's oldest diseases and remains one of the greatest causes of morbidity and mortality in the world today, infecting hundreds of millions of people and killing 1 to 2 million children in Africa each year. In fact, malaria was responsible for the first case of positive selection demonstrated genetically in humans. In the 1940s and 1950s, J. B. S. Haldane and A. C. Allison demonstrated that the geographical distribution of the sickle-cell mutation (Glu6Val) in the beta hemoglobin gene (HBB) was limited to Africa and correlated with malaria endemicity, and that individuals who carry the sickle-cell trait are resistant to malaria (Allison, 1954). Since then, many more alleles for malaria resistance have shown evidence of selection, including more mutations in HBB, as well as mutations causing other red blood cell disorders (e.g., a- thalassemia, G6PD deficiency, and ovalocytosis) (Kwiatkowski, 2005). Malaria also drove one of the most striking genetic differences between populations. This difference involves the Duffy antigen gene (FY), which encodes a membrane protein used by the Plasmodium vivax malaria parasite to enter red blood cells, a critical first step in its life cycle. A mutation in FY that disrupts the protein, thus conferring protection against P. vivax malaria, is at a frequency of 100% throughout most of sub-saharan Africa and virtually absent elsewhere; such an extreme difference in allele frequency is very rare for humans.

63 Diploid organisms have ; hence, if an error is made. Each of us may have. Types of Mutations have on the operation of the cell. - occur in the - can also change a. Both (mistake effect of the mutation will go unnoticed (silent). arises when a change in the base sequence of DNA ex. cystic fibrosis

64

65 1000 different mutations that have been found in patients with cystic fibrosis. Each of these mutations occurs in a huge gene that encodes a protein (of 1480 amino acids) called the cystic fibrosis transmembrane conductance regulator (CFTR). The protein is responsible for transporting chloride ions through the plasma membrane. The gene encompasses over 6000 nucleotides spread over 27 exons on chromosome 7. The numbers in the mutation column represent the number of the nucleotides affected. Defects in the protein cause the various symptoms of the disease. Unlike sickle-cell disease, no single mutation is responsible for all cases of cystic fibrosis. People with cystic fibrosis inherit two mutant genes, but the mutations need not be the same.

66 Sickle Cell Anemia

67 - occurs when a change in the DNA sequence causes

68 is caused by a nonsense mutation within the protein dystrophin. is a lethal condition for boys that causes a devastating musclewasting condition which leads to difficulty walking, breathing. By their late teens the condition is so serious, it leads to an early death. arise from the

69 Some mutations cause a, where one or more nucleotides are Ex. if the from: AUG GGA UUC AAC GGA AUA, the codon sequence becomes:. This results in a This type of can also be caused by the. An insertion or deletion of 2 bases would also be negative but an event involving 3 may not be as detrimental. Why?

70 All of the previous mutations belong to a category known Mutations involving large segments of DNA are known as. They involve the

71 2 fragments on 2 different chromosomes (nonhomologous), sometimes disrupting the normal structure of genes. Can result in a. Some types of are associated with translocations.

72

73 Some fragments of DNA are consistently on the move. These or " are pieces of DNA that continually in the genome.

74 Another type of mutation is when an. This happens when a chromosomal

75 Causes of Genetic Mutations of cells are known as. Other mutations are caused by exposure

76 Cancer is considered a because it is always a result of. Mutations result in, which are mutant versions of genes that. You read section 5.7 and make note of the: " Key Differences Between Eukaryotes and Prokaryotes"

77 Biotechnology Biotechnology involves the New vaccines to prevent disease; Genetically modified plants with resistance to pests; Repair of damaged organs and tissues and improved detection of diseases; Treatments for human infertility; Bacteria capable of cleaning up oil spills; and Environmentally friendly biofuels. Biotechnology is also referred to as

78 Many biotech processes involve. This makes it possible to move forming what is called.

79 A number of the tools are used to An example of a biotech tool are Bacteria use these to cut up They do this by recognizing called sites.

80 Most recognition sites are Most are a sequence Ex. EcoRI 5'- 3'- -3' -5'. EcoRI scans DNA for its. Once bound, it disrupts a between the breaking the DNA strand into 2.

81 Different restriction enzymes.

82 Molecular biologists can use these If two fragments of, they will naturally if " are present. To reform the between the backbones of the is used.

83

84 Gel Electrophoresis Once a piece of DNA has been, it must be. This is done using the of DNA in a process called The properties used are: -. (1- / phosphate) - The (almost).

85 This means that each nucleotide. The only difference then, between fragments, This can be used. The gel used is. The rate at which fragments move through the holes is! The shorter the fragment is,.

86 agarose or polyacrylamide

87 fluoresces under UV light

88 Gel Electrophoresis

89 Plasmids Many times the goal of cutting out genes. This requires all the. Bacteria are a as they contain Plasmids are independent of the

90

91

92

93 The Polymerase Chain Reaction Before PCR was developed in the late 1980s, it was of a desired gene fragment unless it was inserted into a plasmid. PCR is closely related to In PCR, the strands of DNA are separated DNA is heated Once separated, the

94 In PCR, DNA primers. The temperature is brought down to, a DNA polymerase, can build complementary strands at. When the complementary strands have been built, Results in an. After about 30 cycles, more than of the targeted area will exist ( ).

95

96

97 PCR

98 Restriction Fragment Length Polymorphism

99