Chapter 4 Preparation and Analysis of RNA

Transcription

1 Chapter 4 Preparation and Analysis of RNA

2 Preparation purpose: to isolate full-length RNA. Problem: contamination of RNase. RNase is everywhere and difficult to inactivate.

3 - Use freshly de-ionized H 2 O. - All solutions should be treated with DEPC, an RNase inhibitor. (Tris interact with DEPC and inactivate DEPC.) RNase inhibitor (eg. RNasin from Sigma) can also be used. - Glassware should be baked at 300 o C for 4 hrs, or rinsed with 0.5N NaOH followed by dh 2 O, then baked at 160 o C -180 o C for 4-9 hr. (Autoclaving does not work well.) - Plasticware (chloroform-resistant) should be rinsed with chloroform. (Fresh plasticware from bags are usually free of contamination.)

4 - wear gloves. - Do not votex. - Avoid using autoclaved H 2 O, as recycled steam in some autoclaves can introduce contaminants that might interfere PCR.

5 Extracting total RNA - Homogenizer, sonicator, glass bead, French press to mechanically break cells. - sarkosyl, SDS, phenol, guanidinium isothiocyanate, trizol, protease, RNase-free DNase I. - Many people use RNA isolation kits from Qiagen. - After ethanol precipitation, RNA is dissolved in DEPE-treated water or deionized formamide, incubate at 55 0 to 60 0 C for 15 min, and store at C.

6 RNA stored in deionized formamide is protected from degradation by RNase. - The RNA can be used directly in gel for Nothern hybridization. - For other uses, the RNA needs to be ethanol precipitated before use. - Preparation of deionized formamide: Stir with amberlite MB-1 (Sigma) for 30 min at 4 o C. Filter through whatman no.1 paper, store at -20 o C.

7 - Quantitate RNA by A260 and A OD 260 = 40 μg/ml RNA. - Check on denaturing formaldehyde/agrose gel. See two bright rrna bands. For mammalian cells: 28S and 18S rrna, corresponding to 4.5 and 1.9 kb, intensities are : 1. See a smear of mrna mammalian cells: between kb; non- mammalian cells: kb.

8 All cells have rrna, trna, and mrna. Eukaryotic cells have Poly(A) + RNA, which is highly enriched for mrna.

9 Preparation of Poly(A) + RNA - Use oligo(dt) cellulose powder (1 ml for 5-10 mg input RNA) in a silanized column. - equilibration buffer: buffer containing 0.5M LiCl. - RNA in 0.5M LiCl to load - Elution buffer: buffer without LiCl - Ethanol precipitation - Check on agarose gel, see a smear from 20 kb down, with no rrna band. (mrnas are usually 3-4 k bases.) or, check on denaturing formaldehyde/ agrose gel.

10 Northern hybridization - to detect the transcript of a gene - run on denaturing formaldehyde/agrose gel. - Slot blot for comparison. - probe can be stripped off after hybridization.

11 S1 mapping mapping of RNA 5 end, 3 end, and intron boundary - S1 degrades ss DNA - 5 end labeling of ssdna primer oligomer (needs to protect nt) (γ-p32)atp T4 polynucleotide kinase - 5 end labeled primer dntp Klenow denatured plasmid DNA - RE digestion

12 - run in alkaline low gelling gel (gel and running buffer are prepared in alkaline solution) - expose to X-ray film, and excise probe. - melt the gel, add trna, extract with phenol, and ethanol precipitation. - hybridize RNA with probe - S1 digestion, ethanol precipitation - run on denaturing polyacrylamide /urea gel to determine the size of the protected probe.

13

14 Primer extension assay mapping of RNA 5 end, and quantitate the amount of a given RNA. - 5 end labeling of ssdna primer primer : nt; extension product expected needs to be < 100 nt. - load onto mixed bed ion-exchange column ( to eluate the unincorporated nucleotide). - elute probe with buffer containing 600 mm NaCl. - hybridize RNA with probe - add RT and dntp - RNase treatment - ethanol precipitation. - run on denaturing polyacrylamide /urea gel to determine the size of the protected probe

15 Nuclear runoff technique identifying newly transcribed RNA, measuring specific gene transcription, or the relative number of active RNA polymerase molecules on a given gene.

16 - adherent, non-adherent, and fresh isolated cells. - NP-40 treatment. - check under phase microscope, see if free nuclei. - supernatant for isolation of total RNA. - freeze nuclei pellet in liquid N2. - thaw, add (αp32)-utp, and NTP. - proteinase K, DNaseI, phenol/ chloroform, ethanol precipitation. - hybridize with a NC membrane immobilized with cdna. - X-ray exposure.

17 Chapter 5 Library Construction

18 Many genomic and cdna libraries are available, try your best not to construct by yourself. If you have to, use kits

19 To screen a sequence from a library, N= ln (1-P) / ln (1- ( I/G)) I: size of the average cloned fragment G: size of the target genome N: number of independent clones that must be screened to isolate a particular sequence. P: probability. 5 X coverage: the total numbers of bps screened is 5-fold excess over G.

20

21 Genomic library construction : partial digestion with Sau3A Size fractionation fill-in with 1 or 2 bases vector filled-in to leaving compatible ends CIP of vector ligation Packaging Transform or transfect into recipient cells (phage vectors: kb, cosmid vectors: kb)

22 eg. Fosmid library production kit from Epicentre. CopyControl pcc1fos (8.1 kb) Cm r gene E. coli F-factor based partitioning and ori high copy oriv, requires trfa from E. coli host EPI300-T1 cos site for lambda packing and lambda-terminase cleavage P1 loxp site for Cre-recombinase cleavage T7 RNA polymerase promoter flanking cloning site trfa in E. coli host EPI300-T1r is under inducible promoter.

23

24 - Genomic DNA is sheared, and endrepaired. - Size fractionation (40kb) - Ligation - In vitro packaging and titer - Plate on EPI300-T1r (and screen) - Culture induce to high copy

25 E. coli genome is 4.7 Mb, inserts are 40 kb. In order to get the clone with 99% probability, one needs to only screen 461 clones. N= ln (1-0.99)/ ln (1-4 x 104 bp / 4.7 x 106 bp) = 461 clones.

26 cdna library construction eg. Creator SMART cdna library construction kit from Clontech.

27 - A point mutation in moloney murine leukemia virus (MMLV) reverse transcriptase (RT), no RNase activity, can synthesize longer cdna fragment than wt MMLV RT. - CDS III primer: oligo T with Sfi recognition site. ATTCTAGAGGCCGAGGCGGCCGACATG(T)30 N-1 N (N-1 : A, C or G; N: A, C, G, or T) - RT s terminal transferase activity add a few additional nucleotides, primary C, at end. - SMART IV oligo, basepair with (C)n. AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG - RT switch template and synthesize to the end.

28 - LD PCR (5 PCR primer: AAGCAGTGGTATCAACGCAGAGT, and CDS III) or primer extension (CDS III, and SMART IV). - Proteinase K digestion to inactivate RT. - Size fractionation - Cut with Sfi GGCCNNNNNGGCC - Clone into pdnr-lib. Cre-loxP recombination system for subcloning to an acceptor plasmid with loxp. sacb (Bacillus sucrase gene) allows for counter selection of the subclones.

29

30

31

32