Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of

Transcription

1 Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff, Robert H. Brown, Eric A. Johnson, Wei-Dong Yao, Su-Chun Zhang and Min Dong Supplementary Figures S1-S11 Supplementary Methods 1

2 Supplementary Figure S1. Assays for detecting BoNT/C-induced neurodegeneration. (a) Neurons were fixed at the indicated time after exposure to BoNT/C (0.3 nm). Axon degeneration was assayed by immunostaining using an antibody for neurofilament (Ab: SMI 312, 1:1000). Death of cell bodies was assayed by examining nuclear condensation with the DNA dye Hoechst (H-33342). Neurons with condensed and fragmented nuclei were counted as apoptotic cells, as indicated by arrows. Fragmented axons and cell debris were gradually cleared by 2

3 activated glial cells as described in a previous study 8. Scale bars in all applicable panels represent 20 µm. (b) The illustration of a semi-automated method for quantifying axon degeneration. Error bars in all applicable panels represent SEM. (c) Quantification of axon degeneration for the experiments described in panel a. Significant levels of axon fragmentation occur within 24 hrs after exposure to BoNT/C. (d) Quantification of apoptotic cells identified by Hoechst for the experiments described in panel a. (e) Neurons were fixed at the indicated time (hrs) after exposure to BoNT/C (0.3 nm). Immunostaining was carried out using the NeuN antibody that specifically recognizes neuronal nuclear antigen. Representative images are shown (left panel). The number of remaining NeuN-positive cells at each time point was counted using ImageJ software and was normalized as the percentage of control samples (right panel). Exposure to BoNT/C caused a gradual decrease of NeuN-positive cells, but only became detectable after 24 hrs. (f) Neurons were fixed at the indicated time (hrs) after exposure to BoNT/C (0.3 nm). Immunostaining was carried out using the MAP-2 antibody to detect dendrites. Representative images are shown (left panel). The total area with MAP-2 signals at each time point was measured using ImageJ software and was normalized as the percentage of control samples (right panel). BoNT/C caused a gradual decrease of MAP2 immunostaining signals, but only became detectable after 24 hrs. (g) Death of neurons was monitored using the LDH (lactate dehydrogenase) release assay at the indicated time points (hrs) after exposure to BoNT/C (0.3 nm). LDH is a stable cytosol enzyme and is released into the medium upon death of cells. Significant increase of LDH release occurs between 24 and 48 hrs after exposure to BoNT/C. 3

4 Supplementary Figure S2. BoNT/E can induce death of neurons. (a) Neurons were exposed to BoNT/E (3 nm) and fixed at the indicated time points. Axon fragmentation and nuclear condensation were analyzed as described in Supplementary Fig. S1a. Scale bars in all applicable panels represent 20 µm. (b) Axon fragmentation in panel a was quantified. Error bars in all applicable panels represent SEM. (c) Nuclear condensation in panel a was quantified. 4

5 Supplementary Figure S3. BoNTs other than C and E do not induce axon degeneration in rat and human motor neurons. (a) Cultured rat motor neurons were exposed to the indicated BoNTs for 12 hrs. Cell lysates were analyzed by western blot detecting Syx 1, SNAP-25, and Syb. Actin served as the loading control. All seven BoNTs were able to enter rat motor neurons and cleave their target proteins. (b) Rat motor neurons were exposed to BoNT/A, D, B, F, and G, respectively, for 48 hrs. Cells were then fixed and their axons were examined by immunostaining. Scale bars in all applicable panels represent 20 µm.(c) Human motor neurons derived from embryonic stem cells were exposed to BoNT/E, C, and A for 24 hrs. Cell lysates were subjected to immunoblot blot analysis. All three toxins were able to enter human motor neurons and cleave their target proteins. (d) Human motor neurons were exposed to BoNT/A, D, B, F, and G for 96 hrs. Cells were then fixed and their axons were examined by immunostaining. 5

6 Supplementary Figure S4. Expressing LCs of BoNT/C and E has no effects on survival of non-neuronal cells. (a) LCs of BoNT/A, C, and E were expressed in Neuro-2A cells via transfection (transfection efficiency in Neuro-2A cells was > 90%). Cell lysates were assayed 48 hrs later by immunoblot analysis, detecting endogenous Syx 1 and SNAP-25. (b) LCs of BoNT/A, C, or E were expressed in Neuro-2A cells via transfection. To facilitate cell morphology analysis, cells were co-transfected with GFP. Cell death was analyzed by propidium iodide (PI) staining. Methanol-induced cell death was utilized as a positive control. Expressing LCs of BoNT/A, C, and E did not affect survival of Neuro-2A cells. Scale bars in all applicable panels represent 20 µm.(c) Cell lysates of primary cultured rat glial cells were subjected to immunoblot analysis. Rat hippocampal neuron lysates were assayed in parallel as a control. Glial cells do not express detectable levels of Syx 1, SNAP-25, or Syb. (d) LCs of BoNT/A, C, and E were co-transfected with GFP into rat glial cells. Cells were fixed 48 hrs later. Cell death was examined by PI staining. Methanol-induced cell death was used as a control. Expressing LCs of BoNT/A, C, and E did not affect survival of glial cells. 6

7 Supplementary Figure S5. Syx 1A/CR and SNAP-25ER prevent toxin-induced degeneration of neurons. (a) Syx 1A/CR was expressed in neurons. Neurons were exposed to BoNT/C (0.3 nm, 96 hrs). Axon degeneration and cell body apoptosis were assayed as described in Supplementary Fig. S1a. Scale bars in all applicable panels represent 20 µm. (b) SNAP-25/ER was expressed in neurons. Neurons were exposed to BoNT/E (3 nm, 96 hrs) and assayed as described in Supplementary Fig. S1a. (c) Axon degeneration (left panel) and apoptosis of cell bodies (right panel) were quantified as described in Supplementary Fig. S1b-d. Error bars in all applicable panels represent SEM. 7

8 Supplementary Figure S6. SNAP-23 expression is undetectable in mature hippocampal neurons. (a) RT-PCR revealed that SNAP-23 mrna is detectable in developing neurons at DIV 3 and 7, but became undetectable in mature neurons (DIV14). Actin served as a control. The relative intensity of SNAP-23 bands was quantified using ImageJ software (right panel). (b) In order to determine whether SNAP-23 can be cleaved by BoNTs, we co-expressed HA-tagged SNAP-23 with the indicated BoNT LCs in HEK293 cells. Here we used a strong promoter (CMV) for toxin LCs and a weak promoter (synapsin) for SNAP-23 to maximize the protease to substrate ratio. Under this assay condition, HA-tagged rat SNAP-23 was cleaved by cotransfected LCs of BoNT/A and E, but not BoNT/C in HEK293 cells. (c) Full-length human SNAP-23 (hsnap-23) and a truncation mutant lacking the last nine amino acids (hsnap-23-δ9) were expressed in neurons via lentiviral transduction. Neurons were exposed to BoNT/E (3 nm) and cell lysates were subjected to immunoblot analysis using an anti-snap-23 antibody. Expression of endogenous SNAP-23 was not detectable in mature hippocampal neurons. Both full-length SNAP-23 and SNAP-23-Δ9 are resistant to BoNT/E in neurons. 8

9 Supplementary Figure S7. BoNT-resistant Syx 1 and SNAP-25/23 prevent degeneration of neurons transfected with BoNT LCs. (a) Syx 1A/CR, but not Syx 1A WT, prevented degeneration of neurons induced by co-transfected BoNT/C-LC. BoNT/A-LC did not affect survival of transfected neurons. The constructs expressing toxin LCs also contain a second separate promoter driving co-expression of DsRed, which serves as a marker for toxin LC expression (lower panel). GFP was co-transfected to facilitate morphology analysis (upper panel). Scale bars in all applicable panels represent 20 µm. (b) SNAP-25/ER, rat and human SNAP-23, and human SNAP-23-Δ9, but not WT SNAP-25, prevented degeneration of neurons induced by co-transfected BoNT/E-LC. 9

10 Supplementary Figure S8. Syx 1A/CR and SNAP-25/ER prevent toxin-induced degeneration of rat and human motor neurons. (a) Syx 1A/CR and SNAP-25/ER were expressed in cultured rat motor neurons via lentiviral transduction. Cells were exposed to the indicated toxins and fixed 48 hrs later. Axon degeneration was assayed as described in Supplementary Fig. S1a. Scale bars in all applicable panels represent 20 µm. Error bars in all applicable panels represent SEM. (b) Human motor neurons derived from embryonic stem cells were co-transfected with constructs expressing indicated proteins. Cells were fixed for immunostaining of choline acetyltransferase (ChAT), which is a marker for differentiated motor neurons (indicated by arrows). GFP is used to analyze the cell morphology. DsRed is coexpressed to mark toxin LC expression. Co-expressing Syx 1A/CR prevented degeneration of neurons induced by BoNT/C-LC, and co-expressing SNAP-25/ER prevented degeneration of neurons induced by BoNT/E-LC. 10

11 Supplementary Figure S9. BoNT/E can induce degeneration of inhibitory neurons. (a) Inhibitory neurons in rat hippocampal neuron culture were identified using an antibody against glutamic acid decarboxylase (GAD67, shown in red). Scale bars in all applicable panels represent 20 µm. (b) Hippocampal neurons were transfected with GFP (upper panel), BoNT/A- LC (middle panel), or BoNT/E-LC (lower panel). Cells were fixed 96 hrs later and subjected to immunostaining using the GAD67 antibody. All inhibitory neurons transfected with BoNT/E-LC degenerated. (c) Quantification of degenerated neurons for the experiments described in panel b. Error bars represent SEM. 11

12 Supplementary Figure S10. The minimal toxin concentrations that can induce neurodegeneration. (a-b) Two sets of cultured neurons were exposed to indicated concentrations of BoNT/C (panel a) or BoNT/E (panel b). One set of cells was harvested 12 hrs later for immunoblot analysis to confirm the cleavage of SNARE proteins. The other set was followed for two weeks for the occurrence of neurodegeneration by monitoring neuron morphology using a phase-contrast microscope (data not shown). Toxin concentrations were labeled on the representative immunoblots as non-toxic and toxic, based on whether they induced degeneration of neurons within two weeks. It was determined that BoNT/C at and below 10 pm (left panel) and BoNT/E at and below 100 pm (right panel) did not induce degeneration of neurons within two weeks. 12

13 Supplementary Figure S11. Dominant negative mutants of dynamin, AP180, and EPS15 all block endocytosis of transferrin. Neurons transfected with dominant negative mutants of dynamin (dynamin-dn, K44A), AP180 (AP180-C), or EPS15 (EPS15-DIII) were exposed to fluorescent labeled transferrin (Tf) for 15 min. Cells were washed and fixed. Transfected cells were marked by co-expressed GFP. All three mutants blocked uptake of Tf into neurons, as indicated by arrows. The scale bar represents 20 µm. 13

14 Supplementary Methods Hoechst staining: Neurons were fixed, permeabilized, and stained with the fluorescent dye Hoechst (10 µg/ml, 30 min). Images were collected using a confocal microscope (Leica TCS SP5). Neurons with condensed and fragmented nuclei were counted as apoptotic cells. NeuN staining: Neurons were subjected to immunostaining using a monoclonal NeuN antibody (1:1000). Images were collected using a florescence microscope (Olympus IX81). NeuN positive cells were counted using the Particle Analyzer module in ImageJ. MAP-2 staining: Neurons were subjected to immunostaining using a polyclonal MAP-2 antibody (1:500). Images were collected using a florescence microscope (Olympus IX81). The total MAP-2 signals across the entire field of view were quantified using ImageJ software. LDH release assay: Neurons were exposed to toxins for the indicated time. Cell media were collected and LDH activity in media was measured using a LDH assay kit (Abcam, MA). PI staining: Cells were incubated with 50 µg/ml PI for 30 min at 37 C in culture media, washed three times with PBS, and fixed. Images were collected using a confocal microscope. Methanol treatment (100%, 10 min) was used as a control, which permeabilizes cell membranes and results in nuclear staining by PI. Transferrin internalization and Syt I N antibody uptake assays: Neurons were incubated for 30 min in a serum-free medium containing 50 µg/ml Alexa546-conjugated transferrin (Invitrogen) at 37 C, followed by washing with a low ph (ph 4.0) modified HBSS buffer to remove transferrin on the cell surface. Neurons were then fixed for imaging using a confocal microscope. For Syt I N antibody uptake assays, neurons were exposed to Syt I N antibody (1:200) for 5 min in high K + buffer (PBS with 56 mm KCl and 1 mm CaCl 2 ). Cells were washed and fixed for immunostaining. RT-PCR analysis: SNAP-23 mrna levels were analyzed using semi-quantitative reverse transcription PCR. Briefly, RNA extractions were carried out from cultured hippocampal neurons (DIV3, 7 and 14) using the RNeasy mini kit (Quiagen) following the manufacturer s instructions. RNA was reverse transcribed to cdna using SuperScript III First-Strand Synthesis kit (Invitrogen). The following primers were used: ATGGTCAGCCTCAGCAGACT and CAATGCGATTCTTGTTGGTG for detecting SNAP-23, and CACCCGCGAGTACAACCTTC and CCCATACCCACCATCACACC for actin. Gel images were quantified using ImageJ. 14