Supporting Online Material for

Transcription

1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom correspondence should be addressed. (R.I.G.); (G.Q.D.) Published 21 February 2008 on Science Express DOI: /science This PDF file includes: Materials and Methods Figs. S1 to S8 Table S1 References

2 Supporting Online Material Materials and Methods Plasmids and Cloning. Full-length mouse Lin-28, hnrnpa1, hnrnpl, and Msi-2 cdnas were purchased from Open Biosystems and open reading frames were subcloned into pflag-cmv2. Lin-28 was subcloned into petduet (Novagen) for bacterial expression. Pri-let-7g and pri-mir-15a/16-1 substrates were amplified from CD-1 mouse genomic DNA and cloned into the PCR-4-Topo vector (Invitrogen) for direct use in in vitro transcription. For transfection experiments, pri-mirnas were subcloned into pcdna3. Cell Culture and Transfection. ES cell culture and embryoid body differentiation were as described (1). P19 cells were cultured in αmem supplemented with 10% FCS. Transient transfections were performed using Lipofectamine 2000 (Invitrogen) per manufacturer s instructions. Flag-tagged proteins were produced by transient transfection of 293T cells. Quantitative PCR. Levels of mature mirna species were measured by quantitative PCR using commercially available Taqman probes (Applied Biosystems) per manufacturer s instructions with sno142 RNA or U47 RNA used as an internal standards for normalization. Quantiative PCR of gene expression was done using SYBR green using beta-actin as an internal standard for normalization. Relative fold changes were calculated using the ΔΔC t method (2). 1

3 Northern Blotting. 20 μg total RNA from each sample was used for Northern blotting as previously described (3). Probes for mirna detection were antisense, end-labeled DNA oligonucleotides to the mature mirna sequence. RNA Gel-Shift Assay. RNA Gel-shift assays were conducted using 2 x 10 5 cpm endlabeled pre-let-7g probe, 1.5 μg cell extract, and 100 pmol cold pre-let-7g competitor. Binding reactions were conducted in 10 μl total volume with 160 ng trna competitor and 5 μg/μl heparin. Binding buffer contained 60 mm KCl, 10 mm HEPES, ph 7.6, 3 mm MgCl2, 5% glycerol, and 1 mm DTT. RNA-protein complexes were resolved on native 5% polyacrylamide gels. In vitro Processing Assays. Processing reactions were performed as described previously (4). 10,000 cpm pri-mirna was pre-incubated on ice with cell extracts, rlin- 28, or Flag-immunoprecipitates for 60 min. Flag-Drosha IP was then added and processing reaction was performed at 37 o C for 90 min. Samples were resolved on a 15% TBE-Urea gel and visualized by autoradiography. Affinity Purification. Synthetic pre-let-7g (Dharmacon) was conjugated to agarose beads and incubated with 30 mg of P19 whole cell extract as described (5). After pulldown, eluate was subjected to SDS-PAGE, followed by colloidal blue staining and mass spectroscopic sequencing of bands. Recombinant His-Lin-28 was expressed in BL-21 E. coli and purified by standard procedures (4). 2

4 RNA Interference. plko.1-shrna plasmids targeting Lin-28 were from the Broad-TRC collection (Sigma-Aldrich). TRC numbers for hairpins used are: sh1 (TRCN ), sh2 (TRCN ), and sh3 (TRCN ). The sequence of Lin-28 sirna was as previously described (Lin-28 SI-2) (6). For knockdown experiments, 1 μg shrna plasmid or control shrna plasmid targeting GFP was transiently transfected into P19 cells. Total RNA was collected at 60 hours post-transfection. Knockdown was quantitated by quantitative PCR for Lin-28 with beta-actin as an internal standard. Primer sequences are available in Table S1. Protein knockdown was also verified by immunoblotting using anti-lin-28 antibody (R&D). Supporting References 1. M. Kyba, R. C. R. Perlingeiro, G. Q. Daley, Cell 109, (2002). 2. J. M. Thomson et al., Genes Dev. 20, (2006). 3. R. I. Gregory, T. P. Chendrimada, N. Cooch, R. Shiekhattar, Cell 123, (2005). 4. R. I. Gregory et al., Nature 432, (2004). 5. M. Caputi, A. Mayeda, A. R. Krainer, A. M. Zahler, EMBO J. 18, (1999). 6. A. Polesskaya et al., Genes Dev. 21, (2007). Supplementary Figure Legends Figure S1. P19 and ES Cells Possess a Unique Band-Shift. Pre-let-7g was used in a Gel-Shift assay with cell extracts from P19 Cells, ES cells, or MEFs. A unique shift 3

5 (arrow) was observed with P19 and ES cell extract, and was specifically competed away with 100 pmol cold pre-let-7g. This band-shift was not observed using MEF cell extract. Figure S2. Purification of pre-let-7g associated factors. a, pre-let-7g was conjugated to agarose beads and used for affinity purification from 30 mg P19 whole cell extract. Eluted proteins were separated by SDS-PAGE and the gel was stained with colloidal blue as shown. Bands in the lane were processed for mass spectroscopic sequencing as the three samples indicated by boxes. b, a partial list of proteins identified by mass spectroscopy in each of the samples. Proteins in bold font were also identified during Flag-affinity purification of Drosha-containing complexes (3). Figure S3. Lin-28 Binds pri-let-7g and pre-let-7g in vitro. Pri-let-7g (produced by in vitro transcription) or pre-let-7g (synthetic) was conjugated to agarose beads and used in a co-sedimentation assay from P19 whole cell extract. Eluate was separated by SDS- PAGE and western blot was done with α-lin-28 antiserum. Figure S4. Lin-28 selectively blocks the processing of let-7g. 293T cells were either untransfected or co-transfected with pri-let-7g (a) or pri-mir-15a/16-1 (b) and either empty vector (pcmv) or pflag-lin-28. RNA was collected at 40h post-transfection and amount of mature let-7g (a) or mir-15a (b) was measured by quantitative PCR. Fold primirna induction over untransfected 293T cells was first calculated, and values for Lin- 28 co-transfected samples were then normalized to values for the corresponding pcmv co-transfected samples. Values are given as average +/- S.E.M. with N=3. 4

6 Figure S5. Immunoblot using anti-flag antibody showing comparable expression of Flag-Lin-28 and Flag-tagged control RNA-binding proteins when expressed in 293T Cells. Figure S6. Knockdown of Lin-28 relieves mirna Processing Block in ES Cells. a, Depletion of Lin-28 protein upon transfection of Lin-28 knockdown constructs into feeder-free J1 ES cells. Immunoblot was performed on whole cell extracts using anti- Lin-28 antibody b, Knockdown of Lin-28 as assessed by qpcr using Lin-28-siRNA in a feeder free V6.5 mouse embryonic stem cell line. c, induction of mature let-7g upon Lin- 28 knockdown as measured by qpcr. Figure S7. Global mirna Profiling. Global mirna profiling was comerically performed (Exiqon) on RNA samples from P19 cells transfected with either control sirna (scrambled sequence) or Lin-28 sirna. Both total RNA and small-rna-enriched fractions were used for analysis. Scatterplot shows ratio of mirna expression in the Lin-28 sirna sample condition to the scrambled sirna control for both total RNA and small-rna enriched samples. Expression of let-7 mirnas is shown in pink while all other mirnas are shown in blue. The data show that let-7a and let-7d are the most differentially regulated following sirna knock-down of Lin-28. Because of the modest dynamic range of sensitivity for this assay, more subtle degrees of mirna up-regulation may not be revealed. Figure S8. Lin-28B also blocks let-7 Processing. a, Schematic of naturally occurring long and short Lin-28B isoforms. The cold-shock domain is shaded in black while the 5

7 two CCHC motifs are shaded in grey. b, Immunoblot using anti-flag antibody showing comparable expression of Flag-tagged RNA-binding proteins used in c. c, 293T cells were either untransfected or co-transfected with pri-let-7g and either empty vector (pcmv) or plasmid encoding Flag-tagged Lin-28, Lin-28B-L, Lin-28B-S, or Msi-2. RNA was collected at 40h post-transfection and amount of mature let-7g was measured by quantitative PCR. Fold pri-mirna induction over untransfected 293T cells was first calculated, and values for Flag-tagged protein co-transfected samples were then normalized to value for the pcmv co-transfected sample. Table S1. Primer Sequences Primer Name Sequence Comment Let-7gF GTACGGTGTGGACCTCATCA For amplification of pri-let-7g as described in ref. (5) Let-7gR TCTTGCTGTGTCCAGGAAAG For amplification of pri-let-7g as described in ref. (5) ActinF CAGAAGGAGATTACTGCTCTGGCT RT-PCR Primers ActinR TACTCCTGCTTGCTGATCCACATC RT-PCR Primers Lin28qPCRF AGGCGGTGGAGTTCACCTTTAAGA RT-PCR Primers Lin28qPCRR AGCTTGCATTCCTTGGCATGATGG RT-PCR Primers IVPlet7gF CTCCAAATATGGTAAAGATGAGGCAAATGTGTGG For detection and cloning of pri-let-7g IVPlet7gR GACAACCACAATGCATTTCTGGTTATTCTAGTGCC For detection and cloning of pri-let-7g 6

8 IVP15a/16-1F IVP15a/16-1R GGAAATACTTTTTATTCTGCTGAAAGCCTATAAAATT ATGC GTATTGCCAACCTTACTTCAGCAGCACAGTCAATAC TGG For cloning of pri-mir- 15a/16-1 For cloning of pri-mir- 15a/16-1 7

9 8

10 9

11 10

12 11

13 12

14 13

15 14

16 15