7.012 Review Session 10/29/06

Transcription

1 7.012 Review Session 10/29/06 1a) On your lab s most recent trip to Mars, you discover a new type of alien virus. You find that this virus carries nucleic acids, proteins and lipids. You also observe that this virus can infect E. coli cells making it easy to study in the laboratory. i) You grow this virus with one of the following radioisotopes: 32 P, 3 H, or 35 S. Which of the viral macromolecules will be labeled with 32 P? Which of the viral macromolecules will be labeled with 3 H? Which of the viral macromolecules will be labeled with 35 S? ii) You analyze the nucleic acid and find the following. Percentage A G T C U What nucleic acid is the virus carrying. Why? b) Because this is an alien virus, you want to determine which of the macromolecules (nucleic acids, proteins and lipids) is the hereditary material. Explain how you would do this? 1

2 2a) You are examining DNA replication of another alien virus (one which uses doublestranded DNA as its hereditary material) to determine if it is similar to DNA replication on earth. You want to construct an in vitro system for DNA replication. i) What are four components you should include in your system? ii) Prior to replication, all the template DNA is labeled with 15 N. Where is nitrogen found in DNA? iii) You repeat the Meselson-Stahl experiments. On the diagram below, draw the results expected at each round for both conservative and semi-conservative replication. conservative 14 N labeled DNA 14 N labeled DNA 15 N labeled DNA 15 N labeled DNA round 1 round 2 template DNA semi-conservative 14 N labeled DNA 15 N labeled DNA 2

3 b) You have invented a Nanoscopic Imager that allows you to examine an origin of DNA replication. The computer returns the following picture. From this origin, replication is occurring on both strands and the two forks are moving away from each other. 3' 5' GTTCC A 5' 3' 5' 3' C 5' 3' B GTTCC 3' 5' Okasaki fragments origin Origin or of replication i) Label the 3 and 5 ends of the five DNA strands shown. ii) What enzyme is required at C in the diagram above? iii) To which site (A or B or both) can the primer, 5'-CAAGG-3' bind to initiate replication? iv) For each site chosen (in iii), what is the direction of elongation (left or right) of the daughter DNA strand? v) For each site chosen (in iii), is DNA synthesis performed in a continuous or a discontinuous fashion relative to the nearest replication fork? 3

4 c) Crap. You notice that some members of your crew are beginning feel sick from some sort of viral infection. While pondering this medical crisis, you notice that none of the Martian scientists (who have been kindly helping you with experiments up to this point) are ill. You talk with your Martian colleagues, and they agree to give you a sample of their cells. You then decide to mix the virus with the Maritan cells and follow the infection cycle in the Martian blood cells. When you analyze the Martian cells, you notice that their DNA is highly modified with methyl groups on certain bases, and there is a peculiar nuclease in Martian cells that disassembles regular, unmodified DNA. Can you propose a model to explain this immunity? 3. Biologists often borrow the machinery of the bacterium E. coli and use it to make a protein of interest for study in the lab. To cause bacteria to make tons of protein, a promoter called the T7 promoter is often used. The sequence of T7 promoter is as follows: 5 -TAATACGACTCACTATA-3 3 -ATTATGCTGAGTGATAT-5 T7 RNA polymerase recognizes this sequence within the double-stranded DNA below and begins making mrna 5 to 3 at the base immediately following the TATA of the top strand of the promoter sequence. Base pair position GCTTGAGATGAAGCTAATACGACTCACTATAAGGTATTATGGCCATTTTTCTAGGTGTGT CGAACTCTACTTCGATTATGCTGAGTGATATTCCATAATACCGGTAAAAAGATCCACACA TGAGCGGAACCCTGAATTGGCATGCGTACATAGTTCGACTTTTGTCTATCTGAAATATCT ACTCGCCTTGGGACTTAACCGTACGCATGTATCAAGCTGAAAACAGATAGACTTTATAGA-5 a) What will the first 10 nucleotides, from 5 to 3, of the transcribed RNA be? 4

5 b) What will the first 5 amino acids of the resultant translated protein be, from N to C terminal? c) If there were a point deletion at position 51 in this DNA how long will the resulting polypeptide be? d) What would be the effect on the protein product if there were a point deletion at position 35 in this DNA? Explain your answer. e) What would be the effect on the protein product if there were a point deletion at position 25 in this DNA? Explain your answer. 4. The diagram below represents the genomic organization of a hypothetical enzyme involved in red eye pigment production in mice. Within this gene are four exons that are spliced together to form the wild-type mrna, which is then translated to produce the enzyme. Biochemical analysis has revealed that the active site of the enzyme is located in the C-terminal portion of the protein. The length of each exon and intron in the gene is given in nucleotides (nts). ATG start of transcription stop codon stop codon stop codon stop codon GT AG AG GT AG 5' GT ' 999 nts 3000 nts 2001 nts 402 nts 300 nts 246 nts 501 nts In this gene, the dinucleotide sequence GT represents the 5' splice site and the dinucleotide sequence AG represents the 3' splice site. Both the 5' and the 3' splice sites must be present for correct splicing to occur. Assume that the first and second stop codons are located soon after the first and second 5' splice sites, respectively; the third and fourth stop codons are located at the 3' end of exons 3 and 4, respectively. These four stop codons are in frame with the start codon. ***NOTE: In eukaryotes, the RNA splicing machinery recognizes signals in the unprocessed RNA that specify the splice sites. Introns nearly always begin with GU and end with an AG that is preceded by a short pyrimidine-rich region. This consensus sequence, shown below, is part of the signal for splicing. 5' Splice site 3' Splice site 5' Exon 1 GU Pyrimidine rich region AG Exon 2 3' 5

6 a) i) If all of the splice sites in this gene are used in wild-type mouse cells, what will the resulting mrna transcript look like? Using a similar format as above, draw the fully processed wild-type mrna and indicate the approximate length (in nucleotides) of the mrna, not including the the cap and the polya tail. ii) How many amino acids will be present in the wild-type protein produced from this mrna? b) Suppose you isolate a mutant mouse which has white eyes. When you examine the size of the eye pigment enzyme produced by this mouse, you see that it is 400 amino acids long. Sequence analysis reveals that the AG sequence (3' splice site) which is adjacent to the 5' end of exon 3 has been changed to a CC. i) Draw the fully processed mrna that is produced as a result of this mutation and indicate its approximate length (in nucleotides). ii) How does this account for the change in the size of the enzyme? 5. The enzymes TrpA, TrpB, TrpC, TrpD, TrpE and AroH are all required for tryptophan synthesis in E. coli. In the presence of tryptophan, wild-type bacteria do not synthesize any of these enzymes; however, in the absence of tryptophan, all of these enzymes are synthesized at high levels. a) If synthesis of the above enzymes is negatively regulated... i) what change to the repressor protein could cause the enzymes to be synthesized even in the presence of tryptophan? 6

7 ii) what change in the operator sequence could cause the enzymes to be synthesized even in the presence of tryptophan? b) If the synthesis of the above enzymes is positively regulated... i) what change in the activator protein could cause the enzymes to be synthesized even in the presence of tryptophan? ii) what change in the operator sequence could prevent synthesis of the enzymes, even i n the absence of tryptophan? c) By mutational analysis you identify two regions of DNA that are important in the regulation of tryptophan synthesis. The first of these regions, called trpr, is a gene that encodes a DNA-binding protein. The second region is a DNA sequence to which the trpr gene product binds, called trpo. Analysis of three bacterial strains with different genotypes at the trpr and trpo loci yields the following results. mrna levels of trpa, trpb, Strain growth medium trpc, trpd, and trpe trpr+trpo+ with tryptophan 0.1% without tryptophan 100% trpr trpo+ with tryptophan 100% without tryptophan 100% trpr+trpo with tryptophan 100% without tryptophan 100% i) Is the control of tryptophan synthesis likely an example of positive or negative regulation? negative positive can t tell ii) The protein encoded by the trpr gene is a/n activator operator promoter repressor 7

8 6) You are a molecular biologist working for a hair product company whose previous environmental negligence has incurred the EPA's wrath. The company is very interested in the repairing of ozone damage caused by its hair care products in the 1980s. You have a plasmid (pcfc28) that carries the OSN gene from an aquatic species of bacteria. OSN encodes the enzyme "ozone synthase" that converts oxygen into ozone. Your job is to clone the OSN gene into plasmid p7012. You will use this new plasmid to transform the atmospheric bacteria E. atmosi so that it will express ozone synthase when released into the atmosphere and thereby repair the ozone hole. Like its cousin E. coli, E. atmosi can grow on agar for laboratory manipulation. Note that pcfc28 contains no promoter and p7012 contains an E. Atmosi promoter. Both pcfc28 and p7012 contain an origin of replication and the gene Amp R that confers antibiotic resistance to the host cell carrying the plasmid. EcoRI stop Xba I 0.2 EcoRI Xba I Amp R pcfc kb 0.9 OSN Amp R p7.012 p kb 0.3 ATG XhoI ori EcoRI ori indicates a promoter a) The plasmid pcfc28 carries the OSN gene. Why wouldn't you use pcfc28 to transform E. Atmosi so that it will express ozone synthase? You begin by cutting pcfc28 with the restriction enzyme EcoRI. You run the digested plasmid DNA on an agarose gel to separate the fragments by size, and isolate the DNA from the band running at 1.2 kb. Then you cut p7012 with EcoRI, mix in the 1.2 kb fragment from pcfc28 and perform a ligation reaction. This reaction will give the following plasmids: 8

9 EcoRI XbaI stop EcoRI ATG XhoI Amp R p7012a OSN XhoI Amp R p7012b OSN ATG EcoRI stop XbaI EcoRI XbaI E. atmosi promoter EcoRI Xba I XbaI Amp R p7012c b) You transform the ligation mixture into E. atmosi and grow the bacteria on ampicillin-containing agar. Why is it necessary to grow the bacteria on ampicillin? c) The E. Atmosi bacteria containing which of these plasmids will express ozone? Explain your reasoning. 9

10 You then pick individual colonies that have grown on the ampicillin-containing agar, isolate plasmid DNA from each, and perform a restriction analysis to screen each colony for the identity of the plasmid that transformed it. You run the fragments on an agarose gel that separates DNA by size. molecular markers in base pairs XbaI XbaI and XhoI XbaI XbaI and XhoI XbaI XbaI and XhoI (kb) colony 1 colony 2 colony 3 plasmid: p7012b p7012c p7012a d) Which colony corresponds to p7012a, p7012b, and p7012c? e) Given the restriction maps above for pcfc28 and p7012, devise an alternative cloning strategy that results in a directional insertion of the OSN gene into p7012. f) After your first round of experiments, the company gives you a soluble oxygen analog that is toxic to the bacterial cell unless ozone synthase breaks it down to produce an inactive analog. Using this reagent, design an alternative approach to determine which colonies express ozone synthase? 10

11 7) A colleague of yours has done extensive studies on the molecular biology of DNA repair in E. coli. She has identified a particular gene (SPF) encoding the protein "protectin" that is required to repair UV damaged DNA in E. coli. When wild-type cells are irradiated with UV light they survive. However, when cells with a mutations in the SPF gene (spf - cells)are irradiated, they die. You are interested in studying similar proteins in mice because you suspect that mutations in SPF homologs in mammals could lead to a higher risk of cancer. You decide to clone the mouse SPF homolog. a) You already have a library of mouse DNA carried on plasmids in E. coli. The library plasmids each contain different mouse DNA sequences behind a bacterial promoter. Describe how you could use this library to clone the mouse homolog of SPF by complementation. b) If, for this cloning by complementation experiment, you had to choose to make a mouse library from either genomic DNA or cdna which would you choose and why? c) In your experiment, you find two clones of the mouse SPF homolog. Upon closer examination, clone 1 expresses a protein that runs at a slightly different size on protein gel electrophoresis than the protein expressed by clone 2. This difference is so that your professor thinks the difference is simply due to the low resolution of that technique, but you're certain that something funny is going on. You obtain a plasmid that contains the genomic DNA of the SPF gene and purify plasmid DNA from all three clones. Each clone is cut with SalI, and the SPF insert isolated as a single fragment (see row 1 below). You then perform restriction analysis of all three inserts independently and obtain the following data enzymes SPF genomic DNA clone cdna clone 1 cdna clone2 SalI EcoRI 10.6, , , 1.4 XhoI 9.8, XbaI 9.1, , HinDIII 8.1, ,

12 SpeI 10.3, , , 1.7 EcoRI+XbaI 9.1, 1.4, , 1.4, , 1.4 EcoRI+SpeI 8.9, 1.7, , 1.7, , 1.7, 1.4 EcoRI+HinDIII 6.7, 3.9, , , 1.4, 1.1 EcoRI+XhoI 9.8, 1.4, , , 1.4 i) Why is there a difference in the restriction maps of the cdna clones and the genomic clones? ii) Why is there a difference between cdna clone 1 and cdna clone 2? d) Using the data given in part (c), draw the most complete diagram possible of the genomic locus for the SPF gene and the SPF mrnas represented in clones 1 and 2. Indicate the restriction sites, the distances on the DNA, and when possible label the introns and exons. 12

13 8) Earth has been invaded by aliens from Mars who wish to enslave all of humanity. As a molecular biologist in a top-secret agency, the task has fallen upon you to engineer a virus that will infect the aliens and stop the invasion. Your strategy is to produce a virus which will increase expression of an alien neuro-signaling molecule, "signalin". Excess signalin will decrease aggression of the aliens and make them very friendly to us, thus preventing conflict. You first need to clone the SIG gene that encodes signalin. Fortunately, you've heard of a technique called the Polymerase Chain Reaction (PCR) that can be used under certain circumstances to clone your gene of interest. This technique requires some sequence information, and luckily your government wisely invested money years ago in basic Martian research. You know that Martian DNA is structurally the same as ours and you have a rough map of the SIG region on alien chromosomal 5' 3' 5' 3' region A SIG gene region B 3' 5' where 5' 3' where 3' 5' DNA (shown below). To the lab! is the primer used to sequence region A and is the primer used to sequence region B Eric Lander has not yet sequenced the alien genome, so you do a little sequencing for yourself on either side of the SIG gene. You perform Sanger dideoxy sequencing of alien genomic DNA using radiolabeled primers that you stole on a raid of an alien lab. Shown below are autoradiograms of sequencing gels representing both regions A and B. - region A dda ddt ddc ddg - region B dda ddt ddc ddg

14 a) Given the autoradiograms on page 4, What is the single-stranded DNA sequence of region A? Indicate the 5' and 3' ends? What is the single-stranded DNA sequence of region B? Indicate the 5' and 3' ends? b) Using the information in (a) write the double-stranded DNA sequence of both regions on either side of the SIG gene. Mark the 5' and 3' ends and pay careful attention to orientation. Region A: Region B: c) Give the sequence of two DNA primers that you could use to amplify the SIG gene in a PCR. Indicate 5' and 3' ends. Make each primer 10 bases long and on the diagram below indicate to which strand each would bind. primer 1: primer 2: 5' 3' primer 1 region A SIG gene region B primer 2 Assume that the PCR product that is generated can not be cut with EcoRV, XhoI or SalI, yet it can be cloned into the following paln that contains an alien promoter sequence. EcoRV: XhoI: SalI: 5'...GAT ATC...3' 3'...CTA TAC...5' 5'...C TCGA G...3' 3'...G AGCT C...5' 5'...G TCGA C...3' 3'...C AGCT G...5' 14

15 Alien promoter SalI EcoRV XhoI p ALN d) Explain why this is the case. e) The type of ligation you used in (d) above is extremely inefficient. Researchers can include sites for restriction enzymes in the PCR primer by exploiting the fact that the extreme 5' end of a primer can be non-complementary to the target sequence as long as there is a long enough region of complementarity on the 3' end. Use this information and the restriction enzyme data above to re-design primer 1 from part (c) above. Make this primer 16 bases long. primer 1: primer 2: 15