Biochemical characteristics and gene expression profiles of two. paralogous luciferases from the Japanese firefly Pyrocoelia

Transcription

1 Electronic Supplementary Material (ESI) for Photochemical & Photobiological Sciences. This journal is The Royal Society of Chemistry and Owner Societies 0 Electronic Supplementary Material (ESI) for Photochemical & Photobiological Science Biochemical characteristics and gene expression profiles of two paralogous luciferases from the Japanese firefly Pyrocoelia atripennis (Coleoptera, Lampyridae, Lampyrinae): Insight into the evolution of firefly luciferase genes 8 Manabu Bessho-Uehara, a Kaori Konishi, a and Yuichi Oba *a,b 9 0 a Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya -80, Japan. yoba@isc.chubu.ac.jp b Department of Environmental Biology, Chubu University, Kasugai 8-80, Japan

2 genome cdna PatLuc PatLuc Patrp9 a 0.8 kbp 0. kbp.9 kbp. kbp 00 bp 0 bp Patrp9 b 00 bp 80 bp Fig. S. RT-PCR and genomic PCR of PatLuc (A), PatLuc (B) and Patrp9 (C, D). The RT-PCR products (cdna) are distinguishable from the genomic PCR (genome) products by the length of the amplicon.

3 Fig. S. Non-lantern bioluminescence of female adults. The luminescence is observed throughout the body including the prothorax (arrowhead). The luminescence is stronger between segments.

4 A B PatLuc 9 08 ATG 8 PatLuc AAAAAA 8 ATG TAA TAG AAAAAA Fig. S. (A) Pairwise alignments of PatLuc and PatLuc. Underline indicates the AMP-biding domain, open circles indicate putative firefly luciferin-binding sites (Nakatsu et al., 00), and closed circles indicate the PST sequence. Identical amino acid residues and similarities according to the Blosum matrix are boxed in black and grey, respectively. (B) Gene structures of PatLuc and PatLuc. Both CDSs are divided by six introns. Numbers in each box indicate nucleotide length. Numbers under arrowheads indicate intron size.

5 Relative intensity (%) ph8.0 ph. ph Wavelength (nm) Fig. S. In vitro luminescence spectra of native luciferase extracted from larval lanterns at ph. (black line), ph. (gray line), and ph 8.0 (dots).

6 Luc Lampyrinae Pyrocoelia atripennis (This study) Luc Luciolinae Fig. S. Schematic diagram of the evolutionary process of firefly luciferases. The ancestral firefly luciferase gene split into Luc (red line) and Luc (blue line) by gene duplication (black circle). In each developing stage (silhouettes), the areas filled in red and blue indicate where Luc and Luc are expressed, respectively. Luciola lateralis (Oba et al., 0) Luciola parvula (Bessho-Uehara & Oba, 0)

7 Table S. Primer list and PCR conditions. Name of primer Sequence ' - ' Description Molecular cloning of PatLuc a,b,c PyrocoeliaLuc-f GGTTCCAGGGACAATTGC Forward primer PyrocoeliaLuc-r TGCAGGAAGTTCACCGGC Reverse primer PyrocoeliaLuc-r TTCTAATTCGGCAGGCGG Reverse primer PatLuc-RACE GTAAACCAAGTCCGTACCTC Reverse primer for RACE-PCR PatLuc-RACE ATAGTGCACCGCATACAGGC Reverse primer for RACE-PCR PatLuc-RACE CCCAGAAGCAACAAATGC Forward primer for RACE-PCR PatLuc-RACE GATGGATGGTTACACTCTGG Forward primer for RACE-PCR PatLuc-f CTGGTTCCTGAGACACTAACGC Forward primer for cloning complete CDSs PatLuc-r GTGCACATCCCATTGTTAGC Reverse primer for cloning complete CDSs Molecular cloning of PatLuc b,c,d,e LH GGWWCHACYGGNYTNCCNAA Degenerated forward primer for luciferase homologs LH ACYGGNYTNCCNAARGGNGT Degenerated forward primer for luciferase homologs LH ACYTGRTANCCYTTRTAYTT Degenerated reverse primer for luciferase homologs LH TGRTANCCYTTRTAYTTDAT Degenerated reverse primer for luciferase homologs LucUdig-r TCWGTHARWCCRTANCCYTG Degenerated reverse primer for firefly luciferase PatLuc-RACE GACACCTTTAGGCAGACC Reverse primer for RACE-PCR PatLuc-RACE GGTGTGGTGGGATTGATTTG Reverse primer for RACE-PCR PatLuc-RACE GCTAGTTCCGACCCTAATG Forward primer for RACE-PCR PatLuc-RACE GAGATAGCATCAGGTGGAGC Forward primer for RACE-PCR PatLuc-f CGTGTGCAATTTCGAGTGAAC Forward primer for cloning complete CDS and genomic sequence PatLuc-r CTGAAATATTCAAATGTCACTAAT Reverse primer for cloning complete A CDSs and genomic sequence Construction of heterologous expression plasmid c,e pczp-patluc-f CAGGGGCCCGAATTCCGAATGGA Forward primer for constructing AGATGATAGTAA pcold-zz-p-patluc and cloning

8 genomic sequence pczp-patluc-r ACCTATCTAGACTGCAATTACAAT Reverse primer for constructing TTGGATTTTTG pcold-zz-p-patluc and cloning genomic sequence PatLuc-XhoI GGACTCGAGATGGAACACGAA Forward primer for constructing pcold-zz-p-patluc PatLuc-XbaI GGGTCTAGAGTACACATTAAAAG Reverse primer for constructing pcold-zz-p-patluc Molecular cloning of Lprp9 f fireflyrp9-f RGGWCAATACYTRATGCC Degenerated forward primer for ribosomal protein 9 fireflyrp9-r CGAATSGAAAGTTGSGCAGC Degenerated reverse primer for ribosomal protein 9 fireflyrp9-r RCGMAGACGTGCATGTCC Degenerated reverse primer for ribosomal protein 9 Semi-quantitative RT-PCR g,h,i PatLuc-RACE CCCAGAAGCAACAAATGC Forward primer PatLuc-r GTGCACATCCCATTGTTAGC Reverse primer PatLuc-f CGTGTGCAATTTCGAGTGAAC Forward primer PatLuc-r CTGAAATATTCAAATGTCACTAAT Reverse primer A Patrp9-f ATGCCCAACATTGGTTACGG Forward primer Patrp9-r CGAATGGAAAGTTGGGCAGC Reverse primer Patrp9-f ACGGTTCCAATGCAAGAACAC Forward primer Patrp9-r GAAAGTTGGGCAGCACGTTC Reverse primer W = A + T, R = A + G, M = A + C, K = T + G, Y = T + C, S = G + C, H = A + C + T, B = G + C + T, V = A + G + C, D = A + G + T, N = A + G + C + T. PCR conditions were as follows. a PCR conditions for isolating a partial gene of PatLuc using degenerated primer sets:.0 min at 9 ; -0 cycles of 0 s at 9,.0 min at, and.-. min at ; followed by a final extension of.0 min at. b RACE-PCR conditions with the primer sets were:.0 min at 9 ; cycles of 0 s at 9,.0 min at -, and.0 min at ; followed by a final extension of.0 min at. c PCR conditions for cloning complete CDSs and construction of expression plasmids with primer sets were:.0 min at 9 ; 0 cycles of 0 s at 98, s at -8, and 0 s at ; followed by a final extension of.0 min at. d Degenerated PCR conditions for isolating luciferase homologs with degenerated primer sets were:.0 min at 9 ; - cycles of -0 s at 9,.0 min at, and.-. min at ; followed by a final extension of.0 min at. e PCR conditions for cloning genomicsequences with 8

9 8 9 0 primer sets were:.0 min at 9 ; 0 cycles of 0 s at 98, - s at, and min at ; followed by a final extension of.0 min at. f Degenerated PCR conditions for Patrp9 with degenerated primer sets were:.0 min at 9 ; cycles of 0 s at 9, 0 s at, and.0 min at ; 0 cycles of 0 s at 9, 0 s at 0, and.0 min at ; 0 cycles of 0 s at 9, 0 s at, and.0 min at ; followed by a final extension of.0 min at. g Semi-quantitative RT-PCR conditions for PatLuc with primer sets were:.0 min at 9 ; -0 cycles of 0 s at 9, 0 s at, and 0 s at ; followed by a final extension of.0 min at. h Semi-quantitative RT-PCR conditions for PatLuc with primer sets were:.0 min at 9 ; cycles of 0 s at 9, 0 s at, and.0 min at ; followed by a final extension of.0 min at or.0 min at 9 ; cycles of 0 s at 9, 0 s at, and.0 min at ; - cycles of 0 s at 9, 0 s at, and.0 min at ; followed by a final extension of.0 min at. i Semi-quantitative RT-PCR conditions for Patrp9; with primer sets were:.0 min at 9 ; cycles of 0 s at 9, 0 s at, and 0 s at ; followed by a final extension of.0 min at. 9