An antibiotic selection marker for nematode transgenesis

Transcription

1 nature methods An antibiotic selection marker for nematode transgenesis Rosina Giordano-Santini, Stuart Milstein, Nenad Svrzikapa, Domena Tu, Robert Johnsen, David Baillie, Marc Vidal & Denis Dupuy Supplementary figures and text: Supplementary Figure 1 Duplex PCR analysis of MosSCI-biotic insertion events. Supplementary Figure 2 Primer location for qpcr analysis of MosSCI-biotic insertions. Supplementary Figure 3 Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Supplementary Table 4 Supplementary Table 5 Supplementary Table 6 Supplementary Table 7 qpcr analysis of MosSCI-biotic insertions. Selection of G-418 resistant C. elegans in liquid media. Comparison of MosSCI process with and without antibiotics selection. Strains. Plasmids. Primers for cloning experiments and PCR. Primers for qpcr. Fold change relative to unc-119 for all genes analyzed by qpcr.

2 Supplementary Figure 1. Duplex PCR analysis of MosSCI-biotic insertion events. (a) Schematic view of primers annealing for an insertion event in Chromosome I. For an insertion event and in the absence of an extrachromosomal array, the predicted PCR product is 1.4 kb (blue). In the presence of an extrachromosomal array, there is a second predicted PCR product of 1.5 kb (green). (b) Schematic view of primers annealing for an insertion event in Chromosome X. For an insertion event and in the absence of an extrachromosomal array, the predicted PCR product is 1.7 kb (blue). In the presence of an extrachromosomal array, there is a second predicted PCR product of 1.5 kb (green). (c) PCR analysis of insertion lines DUD0029 and DUD0030. The expected band of 1.4 kb shows that the transgenes did insert in the right locus. This band is specific from insertion events in Chromosome I since it is not amplified from extrachromosomal array lines such as DUD0021. (d) PCR analysis of insertion lines DUD0024 to DUD0028. An expected band of 1.7 kb shows that the transgenes did insert in the right locus in Chromosome X. DUD0017, an extrachromosmal array line, does not lead to its amplification.

3 Supplementary Figure 2. Primer location for qpcr analysis of MosSCI-biotic insertions. As internal control, we use three pairs of primers corresponding to endogenous loci: unc-119, 71L and 73R, the Left and Right recombination template corresponding respectively to the two Mos1 strains used EN5271 and EN5273. To monitor the transgene copy numbers we used two sets of primers corresponding to gfp and NeoR markers (for primers sequences see Supplementary Table 5). (a) Schematic view of primers locations for an integration event in Chromosome I, (b) an integration event in Chromosome X and (c) an intermediate extrachromosomal array.

4 Supplementary Figure 3. qpcr analysis of MosSCI-biotic insertions. Fold-change in C(t) for analyzed genes relative to the endogenous control unc-119. As expected, gfp and neo primers did not lead to amplification from EN5271 and EN5273 genomic DNA. gfp and neo amplicons were obtained from integration events in chromosome I (DUD0029 and DUD0030) and in chromosome X (DUD0024 to DUD0028) indeed. Their expression relative to unc-119 was in the range of that of endogenous genomic regions like 71L and 73R, showing that transgenes were inserted at an endogenous level. Extrachromosomal array lines (DUD0017 and DUD0019), however, showed a high fold change compared to the endogenous control. For detailed values of C(t) fold changes see Supplementary Table 6. Error bars: s.d..

5 Supplementary Table 1. Selection of G-418 resistant C. elegans in liquid media. Day 0 Day 4 Fold enrichment transgenic wild-type transgenic wild-type culture , , culture , culture , , culture , , culture , culture , We carried selection of synchronized populations of G-418 resistant C. elegans L1s in M9 buffer at a final G-418 concentration of 0.4 mg/ml. On day one, we mixed 10 G-418 resistant L1s (DUD0029) with a population of wild-type animals. Populations were analyzed after four days of incubation. More than 96 % of wild-type animals were eliminated, while resistant worms survived. This treatment led to a fold enrichment of at least 25.

6 Supplementary Table 2. Comparison of MosSCI process with and without antibiotics selection. Transgenesis step MosSCI/unc-119 MosCSI-biotic Comment 1. Recipient strain genotype requirement characterized Mos-1 insertion site characterized Mos-1 insertion site + unc-119 -/- Phenotype: Unc-119 Neo sensitive 2. Extrachromosomal array manual picking of wild-type worms hands-off maintenance based on antibiotic selection Phenotype: (WT+RFP) /Unc-119 NeoR+RFP 3. Integrant isolation isolation of non-red wildtype worms among a population of wild-type and non-transgenic animals isolation of non-red grown-up worms among a population of grown-up NeoR transgenic animals Phenotype: WT / (WT+RFP) /Unc-119 NeoR / NeoR+RFP 4. Integrated strain carries the unc-119 mutation can be maintained without selection Phenotype: WT NeoR 5. Crosses selection can only be used if crossed with unc-119 mutant strains convenient to cross with most strains including insertion strains made using PuroR (Semple et al., 2010) Phenotype: N/A NeoR+PuroR using NeoR, any Mos-1 strain can be used without crossing into an unc-119 mutant background using NeoR, secondary selection plates are not crowded by non transgenic animals: smaller population to screen

7 Supplementary Table 3. Strains. Strain N2 AF16 PS312 DF5006 DF5012 CB907 EN5271* EN5273* Genotype Caenorhabditis elegans Caenorhabditis briggsae Pristionchus pacificus Rhabditella axei Rhabditoides regina dpy-5(e907)/dpy-5(e907) kr5271/kr5271 I kr5273/kr5273 X DUD0001 N2 ; dudex1[pdd04neo ; p myo-2::gfp] DUD0002 N2 ; dudex2[pdd04neo ; p myo-2::gfp] DUD0003 N2 ; dudex3[pdd04neo ; p myo-2::gfp] DUD0004 N2 ; dudex4[pdd04neo ; p myo-2::gfp] DUD0005 N2; dudex5[pdd04neo ; p myo-2::gfp] BC8950 dpy-5(e907)/dpy-5(e907) ; sex2910[pdd04neo ; p myo-2::gfp ; C.e. gdna ; pceh361] BC8951 dpy-5(e907)/dpy-5(e907) ; sex2911[pdd04neo ; p myo-2::gfp; C.e. gdna ; pceh361] DUD0006 AF16 ; dudex6[pdd04neo p myo-2::gfp; C.b. gdna] DUD0007 AF16 ; dudex7[pdd04neo p myo-2::gfp; C.b. gdna] DUD0015 kr5273/ kr5273 X ; dudex15[pcb101 ; prg5273neo p myo-2::gfp; pjl44] DUD0016 kr5273/ kr5273 X ; dudex16[pcb101 ; prg5273neo p myo-2::gfp; pjl44] DUD0017 kr5273/ kr5273 X ; dudex17[pcb101 ; prg5273neo p myo-2::gfp; pjl44] DUD0018 kr5273/ kr5273 X ; dudex18[pcb101 ; prg5273neo p myo-2::gfp; pjl44] DUD0019 kr5273/ kr5273 X ; dudex19[pcb101 ; prg5273neo p myo-2::gfp; pjl44] DUD0020 kr5273/ kr5273 X ; dudex20[pcb101 ; prg5273neo p myo-2::gfp; pjl44] DUD0021 kr5271/ kr5271 I ; dudex21[pcb101 ; prg5273neo p myo-2::gfp; pjl44] DUD0022 kr5271/ kr5271 I ; dudex22[pcb101 ; prg5271neo p myo-2::gfp; pjl44] DUD0023 kr5271/ kr5271 I ; dudex23[pcb101 ; prg5271neo p myo-2::gfp; pjl44] DUD0024 dudsi01[ p myo-2::gfp; p rps-27::neo::3'utr unc-54] X DUD0025 dudsi02[ p myo-2::gfp; p rps-27::neo::3'utr unc-54] X DUD0026 dudsi03[ p myo-2::gfp; p rps-27::neo::3'utr unc-54] X DUD0027 dudsi04[ p myo-2::gfp; p rps-27::neo::3'utr unc-54] X DUD0028 dudsi05[ p myo-2::gfp; p rps-27::neo::3'utr unc-54] X DUD0029 dudsi06[ p myo-2::gfp; p rps-27::neo::3'utr unc-54] I DUD0030 dudsi07[ p myo-2::gfp; p rps-27::neo::3'utr unc-54] I *These lines were not outcrossed before MosSCI-biotic experiments. Although they look wild-type it remains possible that their genome has been modified by Mos1 mobilization.

8 Supplementary Table 4. Plasmids. pdestdd04neo destination vector carrying p rps-27::neor::3 UTR unc-54 and a Gateway cassette flanked by attr4 and attl1 upstream of gfp. It can be used as such as a co-transformation marker or as a destination vector for introducing promoters from the Promoterome resource upstream of gfp (Dupuy et al., 2004). pdd04neo p myo-2::gfp myo-2 promoter from the Promoterome resource (Dupuy et al., 2004) was introduced into pdestdd04neo using Gateway technology. pcb101 carries p rgef-1::dsred2 ; leads expression of DsRed2 in the nervous system. pceh361 rescues dpy-5 phenotype (Thacker et al., 2006). pjl44 phsp-16.48::transposase. This construct expresses Mos1 transposase after heatshock activation (Robert et al., 2009). prg5271neo repair template for strain EN5271 for MosSCI-biotic insertion; contains a mini cloning site (SalI, EcoRI, XmaI, SmaI) between the NeoR cassette and the right recombination site. prg5273neo repair template for strain EN5273 for MosSCI-biotic insertion; contains a mini cloning site (XhoI, EcoRV, XmaI, SmaI) between the NeoR cassette and the right recombination site. pdestrg5271neo repair template for strain EN5271 in Promoterome destination format to generate transcription fusion by Gateway recombination (Dupuy et al., 2004). pdestrg5273neo repair template for strain EN5273 in Promoterome destination format to generate transcription fusion by Gateway recombination (Dupuy et al., 2004). prg5271neo p myo-2::gfp repair template for strain EN5271 carrying p myo-2::gfp and prps-27::neor::3 UTR unc-54 prg5273neo p myo-2::gfp repair template for strain EN5273 carrying p myo-2::gfp and prps-27::neor::3 UTR unc-54

9 Supplementary Table 5. Primers for cloning experiments and PCR. Primer Sequence 5 to 3 (restriction site in bold) Restriction enzyme M13F CGACGTTGTAAAACGACGGCCAGT ojl115 GCTCAATTCGCGCCAAACTATG org98 CGGGGTACCAATTTTCATACCTTAAACTCC KpnI org99 CGGCGCGGGCCCTATATATATATATATATTTCC ApaI org102 CGGGGTACCGTATTATAATTCCAAAAACACAG KpnI org103 CTAGGGCCCGTCGAATTGAGTGACGAGGC ApaI org111 CGCCCCGGGTAGATTACATCAAGCTCAAG SmaI org112 TCTTATATGCGGCCGCGGATGATGGGCATCGTCACTC NotI org113 TCTTATATGCGGCCGCCGGGACAAGAAGACATGATCG SmaI org114 CGCCCCGGGTATATATATATTGGGATGCAC NotI org115 AGGTCGACGGTATCGATAAGC org119 GACTCACTATAGGGCGAATTGG org120 TTAAACTAAAATTTAGAAATGG org145 GTCGGAGGGAACAGGGAATG org146 GGGACGCATGATGACGTTCCC ovr261 GAAATAGAGGGCAGTTCAACG ovr266 GACAAAGACGTGTAGTTGCG

10 Supplementary Table 6. Primers for qpcr. Gene Primers unc-119 fwd 5 ACAAAAAATGCGGGAGAAGAGA 3 rev 5 CCGAACACCCCTGGTTCATA 3 kr5271 left fwd 5 TTCGGAACAATTTGAAGCATTG 3 recombination region (71L) rev 5 AAATGCCATGCAAGATAAGTGAAG 3 kr5273 right fwd 5 CCAATGCACCCACAGCTAAA 3 recombination region (73R) rev 5 GGGTCCACGTCATGAATCCTT 3 neor gfp fwd 5 GGATCTCGTCGTGACCCATG 3 rev 5 ATCCAGAAAAGCGGCCATT 3 fwd 5 TCCTTTTACCAGACAACCATTACCT 3 rev 5 GTCTCTCTTTTCGTTGGGATCTTT 3

11 Supplementary Table 7. Fold change relative to unc-119 for all genes analyzed by qpcr. Fold change relative to unc L 73R gfp neo EN5271 0,78 ± 0,05 0,78 ± 0,09 NA NA DUD0029 0,95 ± 0,17 0,96 ± 0,02 0,99 ± 0,13 0,78 ± 0,01 DUD0030 0,72 ± 0,04 0,72 ± 0,04 0,69 ± 0,00 0,83 ± 0,02 EN5273 0,67 ± 0,04 0,73 ± 0,03 NA NA DUD0024 1,48 ± 0,02 1,30 ± 0,09 1,62 ± 0,19 1,20 ± 0,10 DUD0025 1,49 ± 0,00 1,17 ± 0,06 1,33 ± 0,09 0,93 ± 0,03 DUD0026 1,21 ± 0,18 1,32 ± 0,13 1,19 ± 0,10 0,91 ± 0,08 DUD0027 1,42 ± 0,23 1,16 ± 0,09 1,00 ± 0,07 0,89 ± 0,06 DUD0028 1,56 ± 0,16 1,27 ± 0,18 1,26 ± 0,06 1,17 ± 0,19 DUD0017 1,20 ± 0,20 32,91 ± 2,96 27,37 ± 5,52 30,49 ± 3,02 DUD0019 1,40 ± 0,23 45,35 ± 6,04 37,98 ± 4,03 32,39 ± 3,64 Insertion events on Chromosome I Insertion events on Chromosome X Extrachromosomal array lines NA: not applicable.