Supplementary Information

Transcription

1 Supplementary Information DNA based identification of medicinal materials in Chinese patent medicines Rong Chen, Juan Dong, Xin Cui, Wei Wang, Afshan Yasmeen, Yun Deng, Xiaomao Zeng, Zhuo Tang

2 Materials Taq DNA polymerase, Taq buffer, dntp s and peasy-t1 Cloning Kit were purchased from Trans Gen Biotech (Beijing, China); Hemin was purchased from Alfa Aesar; ABTS was purchased from Wolsen (Xi an, China); H 2 O 2 was purchased from Bodi Chemical Holding Co., Ltd. (Tianjin, China); DNA purification kit was purchased from Beijing Zoman biotechnology Co., Ltd. (Beijing, China) and DNA sequences were systhesized by Sangon Biotech (Shanghai, China). PCR conditions for Huoxiangzhengqi water. As the DNA extracted from Huoxiangzhengqi water is very low, a nest PCR was developed to get detectable amplification. The primary reaction was carried out in a 50 μl mixture containing 10 μl of DNA, 10 Taq buffer (200 mm Tris-HCl, ph 8.4, 200 mm KCl, 100 mm (NH 4 ) 2 SO 4, 20 mm MgSO 4 ), 0.2 mm dntps, 0.25 μm of each external primers and 2.5 units of EasyTaq polymerase. PCR cycle was as follows: 95 for 3 min; 35 cycles of 94 for 30 s, 56 for 45 s & 72 for 45s with a final extension at 72 for 5 min. The nested reaction was performed in a 50 μl mixture containing 4 μl of PCR products from first round PCR as template, 10 Taq buffer (200 mm Tris-HCl, ph 8.4, 200 mm KCl, 100 mm (NH 4 ) 2 SO 4, 20 mm MgSO 4 ), 0.2 mm dntps, 0.25 μm of each internal primer and 2.5 units of EasyTaq polymerase. Initial template denaturation was done at 95 for 3 min followed by 35 cycles of 94 for 30 s, 62 for 30 s & 72 for 30 s with final extension of 72 for 5 min. Molecular Cloning and sequence PCR products were initially cloned into peasy-t1 vector with the peasy-t1 Cloning Kit TransGen. The bacterial liquid was sent to Sangon Biotech (Shanghai, China) and sequenced using M13F primer. The sequencing results were aligned manually with the known sequences in genbank (Panax ginseng EU , Codonopsis pilosula GQ , Pinellia ternata AF , Pinellia pedatisecta AF , Typhonium flagelliforme AM ) Colorimetric assay 50μl PCR product was incubated with 10 units of Lambda exonuclease enzyme at 37 for 1 h to digest one strand of double stranded DNA. The GQ-HCR was carried out in a 50 μl mixture containing 40μl digested product, 0.5 μm probes, 400 mm NaCl. Incubated at 37 for 1h. Finally, hemin (2.4 μm), H 2 O 2 (2.4 mm), and ABTS 2- (7.2 mm) were added, followed by absorbance detection of ABTS - at 414 nm. Table S1 Primers and probe sequences for ginseng and Codonopsis samples Identity sequences Panax gingseng PP 5 p-ggggcggataatggc Internal primer PRP 5 -ACGACATGAGAAGAGGGC Panax gingseng 18d 5 -CACACCGCCCGTCGCTCCTACCGA External primer 28cc 5 -ACTCGCCGTTACTAGGGGAA Panax ginseng probe PH1 5 -TTGGCGATGGACGTCACGACAAGTGGTGG TGGGTAGGGCGGGTTGGGAAATTACCCACGA CCACTTGTCGTGACGTCCAT Panax ginseng probe PH2 5 -CCACCACTTGTCGTGACGTCCATCGCCAAA

3 TGGACGTCACGACAAGTGGTCGTGGGTA Codonopsis pilosula DP 5 p-ggggagcggatactg Internal primer DRP 5 -GCCTTGTTATCAACCACC Codonopsis pilosula B1 5 -CGTAACAAGGTTTCCGTAGG External primer B3 5 -TCCTCCGCTTATTGATATGC Codonopsis pilosula probe DH1 5 -GCACGACAAGTGGTGGTTGATAACAAGGC TGGGTAGGGCGGGTTGGGAAATTACCCAGGG TTGTTATCAACCACCACTTG Codonopsis pilosula probe DH2 5 -GCCTTGTTATCAACCACCACTTGTCGTGCC AAGTGGTGGTTGATAACAACCCTGGGTA P: forward primer, RP: reverse primer The sequences of G-quadruplex are shown in red; the target sequences complementary to the probes are underlined. Table S2 Primers for Huoxiangzhengqi water samples Identity sequences Pinellia ternata BP 5 -GGGAGACTCCCGACGATCGCA Internal primer BRP 5 -GCCGCACGGACGGATGGAT Pinellia pedatisecta HP 5 -GGGAGACTCCTGACGATCGGC Internal primer HRP 5 -CCACGCAGGCCATCACTTGAT Typhonium flagelliforme SP 5 -GTGCGGCGGGCTGAAGAATC Internal primer SRP 5 -CCCTTGTGCACGGGCGTC Pinellia ternata GP 5 - CGCGAACGGTTGACCC External primer GRP 5 - CCAATCTCCGCATCCCTC Pinellia pedatisecta GP 5 - CGCGAACGGTTGACCC External primer GRP 5 - CCAATCTCCGCATCCCTC Typhonium flagelliforme BEL GATGCGGAGATTGGCCCCCCGTGC External primer BEL GACGCTTCTCCAGACTACAAT P: forward primer, RP: reverse primer Figure S1

4 Figure S1: Agarose gel electrophoresis of genomic DNA. 5 μl of DNA extracted from the different samples. Lane 1-3: root powder of ginseng, ginseng tablet, and root powder of Codonopsis. Figure S2 Figure S2: Effects of different DNA extraction methods. 1-4: ginseng pill extracted by CTAB, ginseng pill extracted by CTAB+column purification, ginseng oral liquid extracted by ethanol precipitation, ginseng oral liquid extracted by column. The DNA extracted directly by CTAB or ethanol precipitation without purification is dark brown and viscous (1 and 3). Figure S3 Primarily, a simple PCR was performed with ginseng injection, but no amplification was seen on agarose gel. Then nested PCR was developed. Figure 3 shows the optimization of nested PCR for ginseng injection samples isolated by a magnetic beads kit. After first round PCR, gradient volumes of PCR products were added to the second round PCR.

5 Figure S3: Nested PCR optimization of ginseng injection DNA isolated by magnetic beads kit. Lane 1-3: second round negative control (water as template), 4μl PCR product of the negative control was used in 2 nd round nested PCR, 4μl PCR product of the isolation negative control (water is used as sample when extracted DNA) from the first round PCR was used in 2 nd round nested PCR, Lane 4-7: 1, 2, 4 & 8μl PCR product of ginseng injection from the first round PCR was used for nested PCR. Lane 8: 0.1μl PCR product of positive control from first round PCR was used in 2 nd round PCR. From the results we can conclude that 1μl PCR product of ginseng injection from the first round PCR is enough to get good PCR results for nested PCR. Because of repeated cycles in nested PCR, there are high chances to have non specific amplifications, as in lane 5 to 8 there are extra bands except the 100bp specific product. Figure S4 With the optimized condition, DNA in ginseng injection isolated by ethanol precipitation and column kit both show a good PCR amplification. Figure S4: PCR results of ginseng injection isolated by different methods. a. Agarose gel electrophoresis of PCR products from ginseng injection extracted by column. Lane 1-3: isolation negative control (water is used as sample when extracted DNA), sample, positive control (DNA extracted from reference drug is used as template). b. Agarose gel electrophoresis of PCR products from ginseng injection extracted by ethanol precipitation. Lane 1-3: isolation negative control (water is used as sample when extracted DNA), sample, positive control (DNA extracted from reference drug is used as template). In conclusion, these three DNA extraction methods can all extract DNA in a similar yield.

6 Considering that magnetic beads kit is expensive and ethanol precipitation requires large volume high-speed centrifugation, we prefer the column kit to concentrate DNA in oral liquid and injection samples. Figure S5 Figure S5: Agarose gel electrophoresis of PCR results from Codonopsis samples. Lane 1-6: negative control (no target), tablet, pill 1, pill 2, oral liquid, positive control (DNA extracted from reference drug is used as template). Figure S6 Figure S6: Time dependent absorption changes at 414nm of the GQ-HCR color reactions. Figure S6a and 6b are the figure 3b and 3c in the main text. Figure S6c and 6d show the

7 time dependent absorption changes of Figure S6a and 6b respectively. The error bars in the figure were determined by the standard deviation (SD) of the triplicate data. In figure S6d, both the ginseng and codonopsis samples are oral liquid. The explanatory legend with -g means the primers and GQ-HCR probes of ginseng were used. While the -c means the primers and GQ-HCR probes of codonopsis were used. It shows that the signal-to-noise ratio of each sample and the negative control is more than 3 times. So the visual results can be detected by both the naked eyes and the spectrophotometer or other similar instruments. Figure S7: Photos of Chinese medicinal raw materials in this research

8 Figure S8: Photos of CPM which were studied in this research (The manufacturers name was covered to protect their identities).