Identification of Differential Genes by Suppression Subtractive Hybridization: IV. Mirror Orientation Selection (MOS)

Transcription

1 1 of 14 4/29/2009 1:10 PM Cite as: Cold Spring Harb. Protoc.; 2008; doi: /pdb.prot4858 Protocol Identification of Differential Genes by Suppression Subtractive Hybridization: IV. Mirror Orientation Selection (MOS) Denis V. Rebrikov This protocol was adapted from "Identification of Differential Genes by Suppression Subtractive Hybridization," Chapter 22, in PCR Primer, 2nd edition, (eds. Dieffenbach and Dveksler). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, INTRODUCTION Suppression subtractive hybridization (SSH) is one of the most powerful and popular methods for generating subtracted cdna or genomic DNA libraries. This technique can be used to compare two mrna populations and obtain cdnas representing genes that are either overexpressed or exclusively expressed in one population as compared to another. It can also be used for comparison of genomic DNA populations. The major drawback of SSH is the presence of background clones that represent nondifferentially expressed DNA species in the subtracted libraries. In some cases, the number of background clones may considerably exceed the number of target clones. This protocol describes mirror orientation selection (MOS)--a simple procedure that substantially decreases the number of background clones in libraries generated by SSH. The MOS technique is based on the rationale that after PCR amplification, during SSH, background molecules will be present in one orientation only, relative to the adapter sequences. Genuine SSH clones will be present in both sequence orientations. RELATED INFORMATION MOS was originally described by Rebrikov et al. (2000). An overview of the SSH method is given in Identification of Differential Genes by Suppression Subtractive Hybridization: An Overview (Rebrikov 2008a). Protocols that describe subsequent steps in the SSH method are also available; see the following: Identification of Differential Genes by Suppression Subtractive Hybridization: I. Preparation of Subtracted cdna or Genomic DNA Library (Rebrikov 2008b) Identification of Differential Genes by Suppression Subtractive Hybridization: II. Subtractive Hybridization (Rebrikov 2008c) Identification of Differential Genes by Suppression Subtractive Hybridization: III. PCR Amplification of Differentially Presented DNAs (Rebrikov 2008d) Identification of Differential Genes by Suppression Subtractive Hybridization: V. PCR-Based DNA Dot Blot (Rebrikov 2008e) Identification of Differential Genes by Suppression Subtractive Hybridization: VI. Differential Hybridization with Tester and Driver DNA Probes (Rebrikov 2008f) MATERIALS Reagents Agarose gel (2%), prepared as described in Agarose Gel Electrophoresis (Sambrook and Russell 2006)

2 2 of 14 4/29/2009 1:10 PM DNA samples, subtracted, from Step 12 in Identification of Differential Genes by Suppression Subtractive Hybridization: II. Subtractive Hybridization (Rebrikov 2008c) dntp solution (containing all four dntps, each at 10 mm) EDTA (0.2 M) Ethanol (for DNA purification; see Step 24) Mineral oil PCR primers (each at 10 µm): MOS PCR primer (NP2Rs) (GGTCGCGGCCGAGGT) Nested PCR primer 1 (NP1) (TCGAGCGGCCGCCCGGGCAGGT) Nested PCR primer 2R (NP2R) (AGCGTGGTCGCGGCCGAGGT) PCR primer 1 (P1) (CTAATACGACTCACTATAGGGC) Phenol:chloroform (for DNA purification; see Step 24) Polymerase mixture (50X) (Clontech, Advantage 2) Use this enzyme with one of the reaction buffers supplied by the manufacturer, or prepare the following buffer from scratch: PCR buffer (10X). SSH dilution buffer SSH hybridization buffer (4X) TN buffer XmaI (10 U/µL) and 10X restriction buffer (supplied with XmaI) Equipment Microcentrifuge Microcentrifuge tubes (0.5 ml) PCR tubes (0.5 ml) Thermal cycler Water baths, preset to 37 C and 74 C METHOD Primary PCR Amplification for MOS This involves two PCR stages: PCR-1 (Steps 1-7) and PCR-2 (Steps 8-14). 1. Transfer 10 µl of each diluted second hybridization (from Step 12 of Identification of Differential Genes by Suppression Subtractive Hybridization: II. Subtractive Hybridization [(Rebrikov 2008c]) into appropriately labeled tubes. 2. For each sample, combine a master mix (115 µl/reaction) for PCR-1 as follows:

3 3 of 14 4/29/2009 1:10 PM Component Amount per reaction H 2 O 92.5 µl PCR buffer (10X) 12.5 µl dntp solution (10 mm each) 2.5 µl PCR primer P1 (10 mm) 5.0 µl Polymerase mixture (50X) 2.5 µl 3. Mix the components well, and briefly centrifuge the tube. 4. Aliquot 115 µl of master mix from Step 3 into each reaction tube from Step For each reaction (now at a total volume of 125 µl), aliquot 25 µl into each of five 0.5-mL PCR tubes. 6. Overlay each sample with one drop of mineral oil. 7. Incubate the reaction mixture in a thermal cycler at 74 C for 5 min to extend the adapters, then immediately begin thermal cycling using the following profile. The number of PCR-1 cycles is the number of SSH primary PCR cycles minus 2. SSH primary PCR was performed in Steps 1-7 of Identification of Differential Genes by Suppression Subtractive Hybridization: III. PCR Amplification of Differentially Presented DNAs (Rebrikov 2008d). So, for example, if those PCR products were visible on agarose gel after 31 cycles, you will need 29 PCR-1 cycles for MOS. Denaturation Annealing Polymerization/Extension 10 sec at 95 C 10 sec at 66 C 1.5 min at 72 C 8. Combine 2 µl of each of the five PCR-1 products into one tube. Add 390 µl of H 2 O. 9. Transfer 1 µl of diluted primary PCR-1 product mixture from Step 8 into an appropriately labeled PCR tube. 10. Prepare a master mix (24 µl/reaction) for PCR-2 as follows: Component Amount per reaction H 2 O 19.5 µl PCR buffer (10X) 2.5 µl dntp solution (10 mm each) 0.5 µl Primer P1 (10 µm) 1.0 µl Polymerase mixture (50X) 0.5 µl 11. Mix the components well, and briefly centrifuge the tube. 12. Aliquot 24 µl of master mix from Step 11 into each reaction tube from Step 9.

4 4 of 14 4/29/2009 1:10 PM 13. Overlay each sample with one drop of mineral oil. 14. Immediately commence thermal cycling as follows: No. of cycles Denaturation Annealing Polymerization/Extension sec at 95 C 30 sec at 66 C 1.5 min at 72 C 15. Analyze 4 µl from each reaction on a 2.0% agarose gel as described in Agarose Gel Electrophoresis. Secondary PCR Amplification for MOS 16. Dilute 2 µl of each primary PCR-2 mixture (generated in Step 14) in 38 µl of H 2 O. 17. Transfer 2 µl of each diluted primary PCR-2 product mixture (from Step 16) into an appropriately labeled tube. 18. Prepare a master mix (48.0 µl/reaction) for secondary PCR as follows: Component Amount per reaction H 2 O 37.0 µl PCR buffer (10X) 5.0 µl dntp solution (10 mm each) 1.0 µl Primer NP1 (10 µm) 2.0 µl Primer NP2R (10 µm) 2.0 µl Polymerase mixture (50X) 1.0 µl 19. Mix the components well, and briefly centrifuge the tube. 20. Aliquot 48 µl of master mix from Step 19 into each reaction tube from Step Overlay each sample with one drop of mineral oil. 22. Immediately commence thermal cycling as follows: No. of cycles Denaturation Annealing Polymerization/Extension sec at 95 C 10 sec at 68 C 1.5 min at 72 C 23. Analyze 4 µl from each tube on a 2% agarose gel as described in Agarose Gel Electrophoresis (Sambrook and Russell 2006). 24. Purify the secondary PCR product by phenol:chloroform extraction and ethanol precipitation. For guidance, see Purification of Nucleic Acids by Extraction with Phenol:Chloroform (Sambrook and Russell 2006) and Standard Ethanol Precipitation of DNA in Microcentrifuge Tubes (Rebrikov 2008c). 25. Dissolve each purified DNA pellet in µl of TN buffer (to a concentration of 20 ng/µl DNA). The DNA can be stored at 20 C.

5 5 of 14 4/29/2009 1:10 PM 26. Analyze 2 µl of DNA from Step 25 on a 2% agarose gel as described in Agarose Gel Electrophoresis (Sambrook and Russell 2006). XmaI Digestion 27. Dilute 1 µl of purified PCR product from Step 25 in 1.6 ml of H 2 O. This sample will be the undigested control for the XmaI digestion. 28. Place the following reagents in a tube: Component Amount per reaction H 2 O 12 µl XmaI restriction buffer (10X) 2 µl DNA sample from Step 25 5 µl XmaI (10 U/µL) 1 µl 29. Mix the sample thoroughly by pipetting. 30. Incubate the sample at 37 C for 2 h. 31. Add 2 µl of 0.2 M EDTA to terminate the reaction. 32. Incubate the sample at 74 C for 5 min to inactivate the enzyme. At this stage, the samples can be stored at 20 C. MOS Hybridization 33. Combine the following reagents in a 1.5-mL microcentrifuge tube: Component Amount per reaction H 2 O 2 µl XmaI-digested DNA from Step 32 1 µl SSH hybridization buffer (4X) 1 µl 34. Place 2 µl of this mixture in a 0.5-mL microcentrifuge tube. 35. Overlay the sample with one drop of mineral oil. 36. Incubate the sample in a thermal cycler at 98 C for 1.5 min. 37. Incubate the sample in a thermal cycler at 68 C for 3 h. 38. Add 200 µl of dilution buffer to the tube. Mix the sample well by pipetting. 39. Heat it in a thermal cycler at 70 C for 7 min. At this stage, the samples can be stored at 20 C. MOS PCR Amplification 40. Prepare a master mix (24.0 µl/reaction) for all MOS PCRs as follows:

6 6 of 14 4/29/2009 1:10 PM Component Amount per reaction H 2 O 19.5 µl 10X PCR buffer (10X) 2.5 µl dntp solution (10 mm each) 0.5 µl Primer NP2Rs (10 µm) 1.0 µl Polymerase mixture (50X) 0.5 µl 41. Add 1 µl of each DNA sample (i.e., the hybridized sample from Step 39 and the corresponding undigested control from Step 27) to appropriately labeled tubes. 42. To each tube in Step 41, add 24 µl of master mix from Step Overlay each sample with one drop of mineral oil. 44. Incubate the reaction mix in a thermal cycler at 74 C for 5 min to extend the adapters. Do not remove the samples from the thermal cycler. 45. Immediately commence thermal cycling as follows: No. of cycles Denaturation Annealing Polymerization/Extension sec at 95 C 10 sec at 62 C 1.5 min at 72 C After this step, the reaction products can be stored at 20 C. 46. Analyze 4 µl from each tube as described in Agarose Gel Electrophoresis (Sambrook and Russell 2006). Once a subtracted sample has been confirmed to be enriched in DNAs derived from differentially presented genes, the MOS PCR products can be subcloned using several conventional cloning techniques. For site-specific cloning using the adapter sequences described here, cleave at the EagI (NotI) and XmaI (SmaI, SrfI) sites and then ligate the products into an appropriate plasmid vector. It is recommended that cloning reactions begin with 3 µl of the MOS PCR product. After 500 colonies are arrayed, the clones can be screened using a PCR-based DNA dot blot analysis (see Identification of Differential Genes by Suppression Subtractive Hybridization: V. PCR-Based DNA Dot Blot [(Rebrikov 2008e]). REFERENCES Rebrikov, D.V. 2008a. Identification of differential genes by suppression subtractive hybridization: An overview. CSH Protocols (this issue) doi: /pdb.top21.[Abstract/Free Full Text] Rebrikov, D.V. 2008b. Identification of differential genes by suppression subtractive hybridization: I. Preparation of subtracted cdna or genomic DNA library. CSH Protocols (this issue) doi: /pdb.prot4855. [Abstract/Free Full Text] Rebrikov, D.V. 2008c. Identification of differential genes by suppression subtractive hybridization: II. Subtractive hybridization. CSH Protocols (this issue) doi: /pdb.prot4856.[Abstract/Free Full Text] Rebrikov, D.V. 2008d. Identification of differential genes by suppression subtractive hybridization: III. PCR amplification of differentially presented DNAs. CSH Protocols (this issue) doi: /pdb.prot4857. [Abstract/Free Full Text]

7 7 of 14 4/29/2009 1:10 PM Rebrikov, D.V. 2008e. Identification of differential genes by suppression subtractive hybridization: V. PCR-based DNA dot blot. CSH Protocols (this issue) doi: /pdb.prot4859.[Abstract/Free Full Text] Rebrikov, D.V. 2008f. Identification of differential genes by suppression subtractive hybridization: VI. Differential hybridization with tester and driver DNA probes. CSH Protocols (this issue) doi: /pdb.prot4860. [Abstract/Free Full Text] Rebrikov, D.V., Britanova, O.V., Gurskaya, N.G., Lukyanov, K.A., Tarabykin, V.S., and Lukyanov, S.A Mirror orientation selection (MOS): A method for eliminating false positive clones from libraries generated by suppression subtractive hybridization. Nucleic Acids Res. 28: e90. doi: /nar/28.20.e90.[Abstract/Free Full Text] Sambrook, J. and Russell, D Agarose gel electrophoresis. CSH Protocols doi: /pdb.prot4020.[Free Full Text] Sambrook, J. and Russell, D Purification of nucleic acids by extraction with phenol:chloroform. CSH Protocols doi: /pdb.prot4455.[Free Full Text] Caution Phenol:chloroform Phenol is extremely toxic, highly corrosive, and can cause severe burns. It may be harmful by inhalation, ingestion, or skin absorption. Wear appropriate gloves, goggles, and protective clothing. Always use in a chemical fume hood. Rinse any areas of skin that come in contact with phenol with a large volume of water and wash with soap and water; do not use ethanol! Chloroform (CHCl 3 ) is irritating to the skin, eyes, mucous membranes, and respiratory tract. It is a carcinogen and may damage the liver and kidneys. It is also volatile. Avoid breathing the vapors. Wear appropriate gloves and safety glasses. Always use in a chemical fume hood. Recipe PCR buffer (10X) 40 mm tricine-koh (ph 9.2 at 22 C) 3.5 mm magnesium acetate 10 mm potassium acetate 75 mg/ml bovine serum albumin (BSA) Recipe SSH dilution buffer 20 mm HEPES-HCl (ph 8.3) 50 mm NaCl 0.2 mm EDTA Recipe

8 8 of 14 4/29/2009 1:10 PM SSH hybridization buffer (4X) 4 M NaCl 200 mm HEPES (ph 8.3) 4 mm CTAB Recipe TN buffer 10 mm Tris-Cl (ph 7.6) 10 mm NaCl Topic Introduction Identification of Differential Genes by Suppression Subtractive Hybridization: An Overview Denis V. Rebrikov Adapted from "Identification of Differential Genes by Suppression Subtractive Hybridization," Chapter 22, in PCR Primer, 2nd edition (eds. Dieffenbach and Dveksler). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, INTRODUCTION Suppression subtractive hybridization (SSH) is one of the most powerful and popular methods for generating subtracted cdna or genomic DNA libraries. This technique can be used to compare two mrna populations and obtain cdnas representing genes that are either overexpressed or exclusively expressed in one population as compared to another. It can also be used for comparison of genomic DNA populations. We have used SSH in studies of regeneration and development on various types of model organisms (including freshwater planaria regeneration, Xenopus laevis development, and mammalian brain cortex development). We also use SSH for the analysis of strainspecific genes in bacteria with different characteristics. During these studies, a large number of differentially regulated and differentially presented genes have been identified, including transcriptional regulation factors and restriction modification enzymes. This article describes the SSH method and considerations for its use. RELATED INFORMATION A series of detailed protocols for SSH is available; see the following: Identification of Differential Genes by Suppression Subtractive Hybridization: I. Preparation of Subtracted cdna or Genomic DNA Library (Rebrikov 2008a) Identification of Differential Genes by Suppression Subtractive Hybridization: II. Subtractive Hybridization (Rebrikov 2008b) Identification of Differential Genes by Suppression Subtractive Hybridization: III. PCR Amplification of Differentially Presented DNAs (Rebrikov 2008c) Identification of Differential Genes by Suppression Subtractive Hybridization: IV. Mirror Orientation Selection (MOS) (Rebrikov 2008d)

9 9 of 14 4/29/2009 1:10 PM Identification of Differential Genes by Suppression Subtractive Hybridization: V. PCR-Based DNA Dot Blot (Rebrikov 2008e) Identification of Differential Genes by Suppression Subtractive Hybridization: VI. Differential Hybridization with Tester and Driver DNA Probes (Rebrikov 2008f) AN OVERVIEW OF THE SSH PROCEDURE The SSH method (Fig. 1 ) is based on a suppression PCR effect, introduced by Sergey Lukyanov (Lukyanov et al. 1994). A key feature of the method is simultaneous normalization and subtraction steps. The normalization step equalizes the abundance of DNA fragments within the target population, and the subtraction step excludes sequences that are common to the two populations being compared (Gurskaya et al. 1996). SSH eliminates any intermediate steps demanding the physical separation of single-stranded (ss) and double-stranded (ds) DNAs, it requires only one round of subtractive hybridization, and it can achieve a >1000-fold enrichment for differentially presented DNA fragments. Figure 1. Overview of the SSH and MOS procedures. The DNA in which specific sequences are to be found is called "tester" and the reference DNA is called "driver." View larger version (21K): [in this window] [in a new window] Preparation of a Subtracted DNA Library The DNA population in which specific fragments are to be found is called the tester. The reference DNA population is called the driver. The generation of tester and driver DNAs begins with either poly(a)+ mrna, followed by conversion to cdna, or genomic DNA. After isolation and synthesis, the tester and driver DNAs are digested with a four-basecutting restriction enzyme that yields blunt ends (e.g., RsaI). The enzyme should be selected according to the GC-content of the target organism, and should yield blunt-ended fragments averaging around 0.5 to 1 kb. The tester DNA is then subdivided into two portions, and each portion is ligated to a different pseudo-double-stranded (ds) adapter (adapter 1 [Ad1] and adapter 2R [Ad2R]). These adapters will serve as primer-binding sites for PCR amplification in later steps. Tester and driver DNA are then incubated and treated so that only appropriate adapterlabeled molecules will be amplified during the PCR steps (Fig. 2 ). These methods are described step by step in the following protocol: Identification of Differential Genes by Suppression Subtractive Hybridization: I. Preparation of Subtracted cdna or Genomic DNA Library (Rebrikov 2008a).

10 10 of 14 4/29/2009 1:10 PM Figure 2. Schematic diagram of SSH procedure. View larger version (13K): [in this window] [in a new window] Subtractive Hybridization It is strongly recommended that subtractions be performed in both directions for each tester/driver DNA pair. Forward subtraction is designed to enrich for differentially presented molecules present in the tester but not in the driver; reverse subtraction is designed to enrich for differentially presented sequences present in the driver but not in the tester. The availability of such forward- and reverse-subtracted DNAs is useful for differential screening of the resulting subtracted tester DNA library. For a protocol describing subtractive hybridization, see Identification of Differential Genes by Suppression Subtractive Hybridization: II. Subtractive Hybridization (Rebrikov 2008b). We also recommend performing self-subtractions, with both tester and driver prepared from the same DNA sample, as a control to determine subtraction efficiency. These controls should yield little, if any, PCR product after amplification. For a protocol describing PCR amplification of subtracted DNA samples, see Identification of Differential Genes by Suppression Subtractive Hybridization: III. PCR Amplification of Differentially Presented DNAs (Rebrikov 2008c). Cloning of Subtracted DNAs Once a subtracted sample has been confirmed to be enriched in DNAs derived from differentially presented genes, the PCR products can be subcloned using several conventional cloning techniques. For site-specific cloning using the adapter sequences used in this series of protocols, cleave at the EagI (NotI) and XmaI (SmaI, SrfI) sites and then ligate the products into an appropriate plasmid vector. Keep in mind that some or all of these sites might also be present in the DNA fragments. The number of independent colonies obtained for each library depends on the number of differentially expressed genes, as well as the subtraction and subcloning efficiencies. Additional colonies can be easily obtained by performing further subclonings of the secondary PCR products. Typically, it is necessary to analyze clones from a subtracted library to ensure that genes representing low-abundance transcripts are not lost. Sequence data from various studies show that the majority of the clones will be picked repeatedly, two to six times, indicating a degree of redundancy. This finding confirms the high level of normalization of SSH libraries, suggesting that the libraries contain both high- and low-abundance differentially presented DNAs. Differential Screening of the Subtracted DNA Library Two approaches can be utilized for differential screening of the arrayed subtracted DNA clones: colony dot blots and PCR-based DNA dot blots. For colony dot blots, bacterial colonies are spotted on nylon filters, grown on antibiotic plates, and processed for colony hybridization. This method is cheaper and more convenient, but it is less sensitive and gives a higher background than PCR-based DNA dot blots. The DNA dot blot approach is highly recommended and

11 11 of 14 4/29/2009 1:10 PM is described in Identification of Differential Genes by Suppression Subtractive Hybridization: V. PCR-Based DNA Dot Blot (Rebrikov 2008e) and Identification of Differential Genes by Suppression Subtractive Hybridization: VI. Differential Hybridization with Tester and Driver DNA Probes (Rebrikov 2008f). MIRROR ORIENTATION SELECTION (MOS) High background in the SSH-generated subtracted library can be reduced using MOS. The MOS technique is based on the rationale that after PCR amplification, during SSH, background molecules will be present in one orientation only, relative to the adapter sequences. Genuine SSH clones will be present in both sequence orientations (Rebrikov et al. 2000), as detailed in Figure 3. Figure 3. Schematic diagram of MOS procedure. View larger version (20K): [in this window] [in a new window] The MOS procedure is described in Identification of Differential Genes by Suppression Subtractive Hybridization: IV. Mirror Orientation Selection (MOS) (Rebrikov 2008d). We recommend the use of MOS in the following cases: Use MOS if the percentage of differentially expressed clones found during differential screening is very low (e.g., 1%-5%). MOS can increase the number of differential clones up to 10-fold. Use MOS if most of the differentially expressed clones found are false positives. The MOS procedure can decrease the portion of false-positive clones several-fold. Use MOS if the primary PCR in SSH requires more than 30 cycles (but no more than 36 cycles) to generate visible PCR product. If this is the case, the problems described in the previous two items will usually appear. If the complexity of tester and driver samples is very great, or if the difference in gene expression between tester and driver is very small, use MOS. Plan to perform MOS from the beginning of the experiment. If the SSH subtracted library has already been made and found, upon differential screening, to contain high background, the option to perform MOS on the SSH-generated library should be considered. The hybridization mix generated in Step 12 of Identification of Differential Genes by Suppression Subtractive Hybridization: II. Subtractive Hybridization (Rebrikov 2008b) can be used for PCR amplification using MOS.

12 12 of 14 4/29/2009 1:10 PM FINAL CONSIDERATIONS The most critical step in SSH is the choice of cells or tissue for comparison. The two samples should be related, with stable expression of the phenotypic difference of interest. If the two samples are too distantly related, a large number of irrelevant, differentially expressed genes will be identified. For systems where there is experimentally induced overexpression of a known set of genes, such as viral infections, it is extremely important to add these known sequences to the driver DNA sample. For example, when searching for p53-up-regulated genes in a p53-overexpressing cell line, add RsaI-digested p53 cdna to the RsaI-digested driver sample to a level of 10% of the total driver DNA concentration. This must be done after the preparation of the adapter-ligated tester sample. Addition of this exogenous DNA before RsaI digestion will cause disproportional representation of this material in the samples. The level of enrichment of a particular DNA depends greatly on its original abundance, the ratio of its concentration in the samples being subtracted, and the number of other differentially presented genes (Jin et al. 1997; Akopyants et al. 1998). Other factors, such as the complexity of a starting material, hybridization time, and ratio of two samples being subtracted, play a very important role in the success of SSH for any given application. For instance, the high complexity of eukaryotic genomic DNA makes SSH very difficult. Some cdna subtractions can also be very challenging due to the nature of the starting samples. Subtracted libraries generated from complex samples may contain very high background. An especially challenging problem is the generation of so-called "false-positive" clones that show a differential signal in a primary screening procedure but are not confirmed by subsequent detailed analysis. To overcome this problem, MOS can be used to decrease substantially the number of background clones (Rebrikov et al. 2000). To obtain the maximum data from a cdna or genomic DNA subtraction experiment, it is important to achieve the highest efficiency of subtraction. The power of SSH subtraction makes it possible to achieve a level of 90%-95% differentially expressed clones in the cdna-subtracted library (Diatchenko et al. 1996; Zuber et al. 2000). In cases where differentially expressed clones represent the majority of the clones in the subtracted library, the time-consuming process of differential screening can be omitted. Whenever possible, the researcher should consider designing the experiment to yield the highest level of difference between the tester and driver RNA populations, possibly by choosing the time point with the highest fold induction of control gene, for example. In the case of a sample comprising a mixed cell population, homogeneity can often be achieved by fine dissection of fixed or frozen tissues and/or by cell sorting. However, when this is not possible, the MOS procedure should be applied. REFERENCES Akopyants, N.S., Fradkov, A., Diatchenko, L., Hill, J.E., Siebert, P.D., Lukyanov, S.A., Sverdlov, E.D., and Berg, D.E PCR-based subtractive hybridization and differences in gene content among strains of Helicobacter pylori. Proc. Natl. Acad. Sci. 95: [Abstract/Free Full Text] Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., et al Suppression subtractive hybridization: A method for generating differentially regulated or tissue-specific cdna probes and libraries. Proc. Natl. Acad. Sci. 93: [Abstract/Free Full Text] Gurskaya, N.G., Diatchenko, L., Chenchik, A., Siebert, P.D., Khaspekov, G.L., Lukyanov, K.A., Vagner, L.L., Ermolaeva, O.D., Lukyanov, S.A., and Sverdlov, E.D Equalizing cdna subtraction based on selective suppression of polymerase chain reaction: Cloning of Jurkat cell transcripts induced by phytohemaglutinin and phorbol 12-myristate 13-acetate. Anal. Biochem. 240: [Medline] Jin, H., Cheng, X., Diatchenko, L., Siebert, P.D., and Huang, C.C Differential screening of a subtracted cdna library: A method to search for genes preferentially expressed in multiple tissues. BioTechniques 23: [Medline] Lukyanov, S.A., Gurskaya, N.G., Lukyanov, K.A., Tarabykin, V.S., and Sverdlov, E.D Highly efficient subtractive hybridization of cdna. J. Bioorg. Chem. 20: Rebrikov, D.V. 2008a. Identification of differential genes by suppression subtractive hybridization: I. Preparation of subtracted cdna or genomic DNA library. CSH Protocols (this issue) doi: /pdb.prot4855.

13 dentification of Differential Genes by Suppression Subtractive Hybridizat of 14 4/29/2009 1:10 PM [Abstract/Free Full Text] Rebrikov, D.V. 2008b. Identification of differential genes by suppression subtractive hybridization: II. Subtractive hybridization. CSH Protocols (this issue) doi: /pdb.prot4856.[Abstract/Free Full Text] Rebrikov, D.V. 2008c. Identification of differential genes by suppression subtractive hybridization: III. PCR amplification of differentially presented DNAs. CSH Protocols (this issue) doi: /pdb.prot4857. [Abstract/Free Full Text] Rebrikov, D.V. 2008d. Identification of differential genes by suppression subtractive hybridization: IV. Mirror orientation selection (MOS). CSH Protocols (this issue) doi: /pdb.prot4858.[Abstract/Free Full Text] Rebrikov, D.V. 2008e. Identification of differential genes by suppression subtractive hybridization: V. PCR-based DNA dot blot. CSH Protocols (this issue) doi: /pdb.prot4859.[Abstract/Free Full Text] Rebrikov, D.V. 2008f. Identification of differential genes by suppression subtractive hybridization: VI. Differential hybridization with tester and driver DNA probes. CSH Protocols (this issue) doi: /pdb.prot4860. [Abstract/Free Full Text] Rebrikov, D.V., Britanova, O.V., Gurskaya, N.G., Lukyanov, K.A., Tarabykin, V.S., and Lukyanov, S.A Mirror orientation selection (MOS): A method for eliminating false positive clones from libraries generated by suppression subtractive hybridization. Nucleic Acids Res. 28: e90. doi: /nar/28.20.e90.[Abstract/Free Full Text] Zuber, J., Tchernitsa, O.I., Hinzmann, B., Schmitz, A.C., Grips, M., Hellriegel, M., Sers, C., Rosenthal, A., and Schafer, R A genome-wide survey of RAS transformation targets. Nat. Genet. 24: [Medline] Copyright 2008 by Cold Spring Harbor Laboratory Press. Online ISSN: Terms of Service All rights reserved. Anyone using the procedures outlined in these protocols does so at their own risk. Cold Spring Harbor Laboratory makes no representations or warranties with respect to the material set forth in these protocols and has no liability in connection with their use. All materials used in these protocols, but not limited to those highlighted with the Warning icon, may be considered hazardous and should be used with caution. For a full listing of cautions, click here. All rights reserved. No part of these pages, either text or images, may be used for any reason other than personal use. Reproduction, modification, storage in a retrieval system or retransmission, in any form or by any means-electronic, mechanical, or otherwise-for reasons other than personal use is strictly prohibited without prior written permission. CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this? This article has been cited by other articles: D. V. Rebrikov Identification of Differential Genes by Suppression Subtractive Hybridization: An Overview CSH Protocols, July 1, 2008; 2008(8): pdb.top21 - pdb.top21. [Abstract] [Full Text] D. V. Rebrikov Identification of Differential Genes by Suppression Subtractive Hybridization: I. Preparation of Subtracted cdna or Genomic DNA Library CSH Protocols, July 1, 2008; 2008(8): pdb.prot pdb.prot4855. [Abstract] [Full Text]

14 dentification of Differential Genes by Suppression Subtractive Hybridizat of 14 4/29/2009 1:10 PM D. V. Rebrikov Identification of Differential Genes by Suppression Subtractive Hybridization: II. Subtractive Hybridization CSH Protocols, July 1, 2008; 2008(8): pdb.prot pdb.prot4856. [Abstract] [Full Text] D. V. Rebrikov Identification of Differential Genes by Suppression Subtractive Hybridization: III. PCR Amplification of Differentially Presented DNAs CSH Protocols, July 1, 2008; 2008(8): pdb.prot pdb.prot4857. [Abstract] [Full Text] D. V. Rebrikov Identification of Differential Genes by Suppression Subtractive Hybridization: V. PCR-Based DNA Dot Blot CSH Protocols, July 1, 2008; 2008(8): pdb.prot pdb.prot4859. [Abstract] [Full Text] D. V. Rebrikov Identification of Differential Genes by Suppression Subtractive Hybridization: VI. Differential Hybridization with Tester and Driver DNA Probes CSH Protocols, July 1, 2008; 2008(8): pdb.prot pdb.prot4860. [Abstract] [Full Text]