ARTICLE IN PRESS. Abstract. Introduction

Transcription

1 ARTICLE IN PRESS International Journal of Medical Microbiology 298 (2008) Epidemiological aspects and molecular characterization of Borrelia burgdorferi s.l. from southern Germany with special respect to the new species Borrelia spielmanii sp. nov. Volker Fingerle a,,1, Ulrike C. Schulte-Spechtel a,1, Eva Ruzic-Sabljic b, Sarah Leonhard c, Heidelore Hofmann d, Klaus Weber e, Kurt Pfister c, Franc Strle f, Bettina Wilske a a National Reference Center for Borreliae, Max von Pettenkofer-Institut für Medizinische Mikrobiologie und Hygiene der Ludwig-Maximilians-Universität München, Pettenkoferstraße 9a, D Munich, Germany b University of Ljubljana, Faculty of Medicine, Institute of Microbiology and Immunology, Ljubljana, Slovenia c Institut für Vergleichende Tropenmedizin und Parasitologie, Leopoldstr. 5, Munich, Germany d Klinik und Poliklinik für Dermatologie und Allergologie am Biederstein, TU München, Munich, Germany e Dermatologist, Greinwaldstr. 2, Tutzing, Germany f Department of Infectious Diseases, University of Ljubljana, Ljubljana, Slovenia Received 11 December 2006; received in revised form 29 May 2007; accepted 29 May 2007 Abstract In 475 Borrelia-infected Ixodes ricinus (2155 ticks investigated) from southern Germany the most common Borrelia burgdorferi sensu lato species was B. garinii (34.3%) followed by B. afzelii (25.1%), B. burgdorferi sensu stricto (22.0%), and B. valaisiana (12.7%). B. spielmanii sp. nov. was detected in 5.9% of the 475 infected ticks. Hints for a focal distribution were found for B. spielmanii sp. nov. and B. garinii OspA type 4. In 242 patient isolates, dominance (66.9%) of B. afzelii for skin could be confirmed, while frequency of B. garinii in cerebrospinal fluid (CSF) isolates (51.1%) was comparable to the frequency in nymphal ticks (51.6%). Four patient isolates from southern Germany and two from Slovenia, all isolated from erythema migrans, could be assigned to B. spielmanii sp. nov. Within this new species high sequence identities were found for rrs, fla, and ospa while rrf-rrl, ospc, and dbpa were less conserved: three new ospc and two new dbpa sequence types were found. This genetic heterogeneity reveals that B. spielmanii sp. nov. did not evolve just recently. r 2007 Elsevier GmbH. All rights reserved. Keywords: Borrelia burgdorferi; Borrelia spielmanii; Ixodes ricinus; ospa; ospc; dbpa; 16S rdna; 5S-23S intergenic spacer Introduction Lyme borreliosis (LB), the most frequent vector-borne disease in Europe and the USA, is a multisystemic Corresponding author. Tel.: ; fax: address: Fingerle@mvp.uni-muenchen.de (V. Fingerle). 1 These authors contributed equally to this work. infectious disorder caused by spirochaetal bacteria belonging to the Borrelia burgdorferi sensu lato (s.l.) complex. This disease can affect different organs and organ systems, most often the skin, but also nervous system, joints, or the heart may be involved (Stanek and Strle, 2003). In Europe, the principal vectors are the hard-bodied ticks Ixodes ricinus and, at the eastern range, I. persulcatus. The B. burgdorferi s.l. complex comprises at least 12 species wherefrom B. burgdorferi sensu stricto (s.s.), /$ - see front matter r 2007 Elsevier GmbH. All rights reserved. doi: /j.ijmm

2 280 ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) B. afzelii, and B. garinii are assured to be pathogenic for humans while the pathogenicity of B. valaisiana, B. lusitaniae, and B. bissettii is still unclear, although all three species have been detected occasionally in patient specimens (Baranton et al., 1992; Canica et al., 1993; Rijpkema et al., 1997; Strle et al., 1997; Wang et al., 1999b; Collares-Pereira et al., 2004). In Europe, the five species B. afzelii, B. garinii, B. burgdorferi s.s., B. valaisiana, and B. lusitaniae have been recorded in association with I. ricinus. Thereof, B. afzelii and B. garinii appear to be the most prevalent species followed by B. burgdorferi s.s. and B. valaisiana, while B. lusitaniae seems to be rare (Hubalek and Halouzka, 1997; Rauter and Hartung, 2005). B. burgdorferi s.s., the only species causing LB in the USA, is homogeneous with respect to outer surface protein (Osp) A, while in Europe at least eight different OspA types have been observed among the human pathogenic species (Wilske et al., 1993, 1996; Lencakova et al., 2006). In 1993, van Dam et al. described a B. burgdorferi s.l. strain (A14S) that could not be classified that time. Based on its reactivity with monoclonal antibodies (MAbs), ribotyping, and randomly amplified polymorphic DNA fingerprinting, the authors concluded that this isolate could well represent a novel pathogenic B. burgdorferi s.l. species (van Dam et al., 1993; Wang et al., 1998). In 1999, further characterization of this strain by protein profiling, reactivity with MAbs, sequences of 16S rrna (rrs), ospa, ospc, fla, and 5S-23S intergenic spacer (rrf-rrl) further supported that this strain represents a new B. burgdorferi s.l. species (Wang et al., 1999a). Subsequently, Richter et al. (2004) showed that this new genospecies seems to have a restricted geographic distribution and seems to be associated with dormice, especially garden dormice, but not mice or voles. In this study, the name B. spielmani sp. nov. for this apparently new B. burgdorferi s.l. species was proposed. In a following study, its position as a new species was validated by multilocus sequence analysis and its name was changed to the correct spelling B. spielmanii (Richter et al., 2006). Further A14S-like or B. spielmanii isolates from patients were reported in 2002 from south-western Germany (Rauter et al., 2002), in 2003 from southeastern Germany (Michel et al., 2003), in 2005 from Hungary (Foldvari et al., 2005), and in 2006 from Slovenia (Maraspin et al., 2006). Notably, all human B. spielmanii isolates described so far were cultured from erythema migrans. The aim of this study was to gain more information about the epidemiological situation of B. burgdorferi s.l. and, especially, about the new species B. spielmanii, including its molecular heterogeneity. The results of the present study show that all relevant B. burgdorferi s.l. species described so far for Europe are present in I. ricinus from southern Germany. Also, B. spielmanii is present in ticks possibly in a focal manner and seems to be a relevant cause for human LB, at least for erythema migrans. Molecular genetic analyses provide evidence that this newly described species did not evolve just recently. Material and methods Study sites and collection of questing Ixodes ricinus ticks A total of 2155 I. ricinus were collected by flagging at eight locations in southern Germany within a radius of 150 km around the city of Munich (Tables 1 and 2). In Erlangen, located about 150 km north of Munich, sampling was done in an area intensively used for agricultural purposes at waysides between a cornfield and a fir wood. The study area Passau, about 150 km east-east-north of Munich, was along a dirt road through a mixed forest with lots of underbrush. The collection region Traunstein is located about 120 km east-east-south of Munich and comprises a forest track through a coniferous forest with lots of underbrush, predominantly blackberries. The Isar meadow region is about 10 km north-west of Munich. Collection of ticks was done along a grassy dirt road in a humid deciduous forest dominated by birch trees. The English Garden area is part of a recreational park located in the city of Munich. The sampling region was the edge of a small deciduous wood (predominant beech and oak trees, lots of underbrush) to public grassland, which is intensively used for recreational activities. The study area Grafrath, situated about 35 km west of Munich, comprises a grassy forest track through a mixed forest. The sampling area Scho ffelding, which is situated about 50 km west of Munich, was the edge of a deciduous forest with lots of underbrush to a swampy grassland. Collection region Bad To lz, located about 45 km south of Munich, was a light coniferous forest with a lot of grass and bushes. The collection areas each had a size of about m 2 except the English Garden collection area, which had a size of about 400 m 2. After collection, ticks were assigned to tick species and stage, and individually stored in 1.5-ml reaction tubes at 20 1C until use. Before DNA extraction, each tick was crushed using a separate laboratory spatula. Borrelia burgdorferi s.l. strains and cultivation, DNA extraction All strains were derived from patient material collected in the years at the Max von

3 ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) Table 1. (a) Prevalence of B. burgdorferi s.l. species according to tick stage and study site Region Tick stage b n Pos c (%) Pos d Thereof a Bb (%) Ba (%) Bg (%) Bv (%) Bs (%) Bad A (18.1) 25 4 (16.0) 5 (20.0) 15 (60.0) 1 (4.0) 0 To lz e,a N (7.3) 16 2 (12.5) 4 (25.0) 9 (56.3) 0 0 Erlangen e A (26.5) (12.5) 13 (81.3) 1 (6.3) 0 N 40 2 (5.0) (100) 0 0 Scho ffelding A (21.8) 35 8 (22.9) 3 (8.6) 20 (57.1) 4 (11.4) 0 N 92 9 (9.8) 10 2 (20.0) 0 8 (80.0) 0 0 Grafrath A (36.7) (20.2) 30 (30.3) 32 (32.3) 12 (12.1) 5 (5.1) N (12.3) 15 2 (13.3) 8 (53.3) 5 (33.3) 0 0 Traunstein e A (18.9) (24.4) 14 (31.1) 15 (33.3) 3 (6.7) 2 (4.4) N (9.6) 15 6 (40.0) 2 (13.3) 7 (46.7) 0 0 EG f A (37.2) (15.4) 30 (38.5) 9 (11.5) 13 (16.7) 14 (17.9) MIR f A (35.7) (30.7) 15 (20.0) 23 (30.7) 11 (14.7) 3 (4.0) Passau A (33.2) (28.8) 14 (19.2) 15 (20.5) 19 (26.0) 4 (5.5) All regions e A (29.7) (22.2) 113 (25.3) 142 (31.8) 64 (14.3) 28 (6.3) N (9.0) (20.7) 14 (24.1) 31 (53.4) 0 0 (b) B. burgdorferi s.l. combinations present in multiple infected ticks Region Tick stage b Combinations of B. burgdorferi s.l. species and B. garinii OspA types g Bad To lz a,e A 0 N 0 Erlangen e A Ba/Bg3, Ba/Bg7, Bg6/Bv N 0 Scho ffelding A Bb/Bg4, Bb/Bg6, Bg5/Bg6, Bg5/Bg7, Bg6/Bg7, Bg6/Bv N Bg5/Bg7 Grafrath A Bb/Ba, Bb/Bg3, Bb/Bg4, Bb/Bg5, Bb/Bg6, Ba/Bg3, Ba/Bg4, Ba/Bv, Ba/Bs, Bb/Ba/Bg4 N Bb/Bg3, Bg4/Bg5 Traunstein e A Bb/Ba, Bb/Bg5, Bg5/Bg6 N 0 EG f A Ba/Bs MIR f A Bb/Ba Passau A Bb/Bs, Bv/Bs, Bv/Bs Bb, B. burgdorferi s.s.; Ba, B. afzelii; Bg, B. garinii; Bv, B. valaisiana; Bs, B. spielmanii. a B. lusitaniae was found in one nymphal tick from Bad To lz. b A, adults; N, nymphs. c Number of B. burgdorferi-infected ticks. d Number of B. burgdorferi s.l. species and OspA types found in the ticks including multiple infections (shown in (b)). e Larvae (n ¼ 136) were investigated in Bad To lz (n ¼ 16; none infected), Erlangen (n ¼ 110; one infected with B. garinii and one with B. burgdorferi s.s.), and Traunstein (n ¼ 10; none infected). f EG, English Garden; MIR, meadows of the Isar river. g Number behind Bg corresponds to the B. garinii OspA type. Pettenkofer Institut (Table 3) or from Slovenia. All strains were cultured at 33 1C in MKP medium as described previously (Preac-Mursic et al., 1986), harvested at a density of 10 7 cells/ml by centrifugation (20,000g, 20 min), washed three times in 200 ml phosphate-buffered saline (PBS, ph 7.4), and resuspended in 200 ml PBS. DNA from cultured strains and ticks was extracted with High Pure PCR Template Preparation Kit (Roche Molecular Biochemicals, Mannheim, Germany) according to the manufacturer s instructions. PCR and restriction fragment length polymorphism (RFLP) analysis Primers for PCR are given in Table 4. All ticks and Borrelia strains were investigated by a hemi-nested PCR

4 282 Table 2. ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) Prevalence of B. garinii OspA types according to tick stage and study site Region Tick stage n Pos a Thereof B. garinii OspA type 3 (%) 4 (%) 5 (%) 6 (%) 7 (%) 8 (%) Bad To lz b A (20.0) 10 (66.7) 0 2 (13.3) 0 0 N (11.1) 8 (88.9) Erlangen b A (30.8) 1 (7.7) 1 (7.7) 5 (38.5) 2 (15.4) 0 N (50.0) (50.0) 0 Scho ffelding A (5.0) 2 (10.0) 3 (15.0) 11 (55.0) 3 (15.0) 0 N (12.5) 3 (37.5) 1 (12.5) 1 (12.5) 2 (25.0) 0 Grafrath A (28.1) 9 (28.1) 10 (31.3) 4 (12.5) 0 0 N (40.0) 1 (20.0) 1 (20.0) 1 (20.0) 0 0 Traunstein b A (20.0) 3 (20.0) 1 (6.7) 6 (40.0) 2 (13.3) 0 N (57.1) 2 (28.6) 1 (14.3) 0 0 EG A (55.6) 0 1 (11.1) 3 (33.3) 0 0 MIR A (21.7) 1 (4.3) 4 (17.4) 12 (52.2) 0 1 (4.3) Passau A (53.3) 0 2 (13.3) 5 (33.3) 0 0 All regions A (26.8) 26 (18.3) 22 (15.5) 48 (33.8) 7 (4.9) 1 (0.7) N (16.1) 16 (51.6) 4 (12.9) 3 (9.7) 3 (9.7) 0 A, adults; N, nymphs. EG, English Garden; MIR, Meadows of the Isar River. a Number of B. garinii-infected ticks. b Larvae (n ¼ 136) were investigated in Bad To lz (n ¼ 16; none infected), Erlangen (n ¼ 110; one infected with B. garinii OspA type 6.), and Traunstein (n ¼ 10; none infected). Table 3. Prevalence of B. burgdorferi s.l. species and OspA types in 242 human isolates from Germany Material n Bb (%) Ba (%) Bg (%) Thereof Borrelia garinii OspA type Bbi (%) Type Type 4 Type 5 Type 6 Type Type 3 (%) (%) (%) (%) 7 (%) 8 (%) Bs (%) Skin (6.3) 107 (66.9) 39 (24.4) 4 (2.5) 19 (11.9) 7 (4.4) 7 (4.4) 1 (0.6) 1 (0.6) 4 (2.5) CSF (25.0) 15 (20.8) 38 (51.1) 4 (5.6) 16 (22.2) 3 (4.2) 11 (15.3) 2 (2.8) 2 (2.8) 1 (1.4) Synovia 6 2 (33.3) 2 (33.3) 2 (33.3) 1 (16.7) 1 (16.7) Total a a (13.2) 126 a (52.1) 79 (32.6) 8 (3.3) 36 (14.9) 10 (4.1) 19 (7.9) 3 (1.2) 3 (1.2) 1 (0.4) 4 (1.7) Bb, B. burgdorferi s.s.; Ba, B. afzelii; Bg, B. garinii; Bbi, B. bissettii; Bs, B. spielmanii. a Numbers include two B. burgdorferi s.s. cultured from vitreous body and myocard, and two B. afzelii cultured from blood and bone, respectively. targeting ospa, using Amplitaq Gold DNA polymerase (Applied Biosystems) as described previously (Lencakova et al., 2006; Michel et al., 2003). For RFLP, aliquots (7 ml) of each ospa amplicon were digested with 0.5 U Kpn21 (MBI Fermentas, Lithuania), BglII, SspI, HindIII, SfuI and, optionally, XbaI (Roche Molecular Biochemicals) overnight. Restriction fragments were electrophoresed, visualized, and documented as described for amplification products (see below). Molecular analysis of B. spielmanii DNA extractions positive for B. spielmanii DNA according to ospa-based RFLP were subjected to rrs, rrf-rrl, dbpa, ospc, and fla PCR. Amplification of rrs used the same protocol as for ospa except for the annealing temperature being 45 1C. OspC, dbpa, and rrf-rrl PCRs were carried out as described previously (Postic et al., 1994; Schulte-Spechtel et al., 2005). For tick DNA extractions, a re-pcr for dbpa amplification was necessary. The fla gene has been amplified according to the protocol of Fukunaga et al. (1996) using the primers listed in Table 4. Both strands of the resulting PCR products were sequenced (see below) using the amplification primer pair or, for fla, characterized by restriction enzyme analysis (HpaII, HhaI, CellI, HincII, and DdeI). Amplified products and restriction enzyme fragments were visualized on a 2% agarose gel (Sea Kem LE

5 ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) agarose, Biozym, Hessisch Oldendorf, Germany) stained with 1 mg/ml ethidium bromide (Bio-Rad, Munich, Germany) and documented with a gel documentation system (Herolab, Wiesloch, Germany). Sequencing and sequence analysis Sequencing was performed with a dye terminator cycle sequencing kit (Applied Biosystems, Inc., Foster City, CA). All sequencing reactions were run on an ABI PRISM TM 377 DNA Sequencer. Multiple sequence alignments and amino acid sequence alignments were accomplished with DNAMAN Version software (Lynnon Biosoft). Nucleotide sequence accession numbers GenBank accession numbers for the sequences determined for patient isolates in this study are listed Table 4. Amplified gene fragments and corresponding oligonucleotide primers Fragment length (bp) Primer sequences ( ) Target 390 ttaacaggaaaagctagattagaatcatca dbpa univ.3 for atcccttgagctgtagttgga dbpa univ.3 rev gggaataggtctaatattagc V1a a (ospa for ) ggggataggtctaatattagc V1b a (ospa for ) b gccttaatagcatgtaagc V3a a (ospa for nested ) gccttaatagcatgcaagc V3b a (ospa for nested ) cataaattctctttattttaaagc R2 a (ospa rev ) ccttattttaaagcggc R37 a (ospa rev ) 600 atgaaaaagaatacattaagtgcg ospc for ttaggtttttttggactttctgc ospc rev 580 gcagttcaatcaggtaacgg fla for aggttttcaatagcatactc fla rev 210 ctgcgagttcgcgggaga rrf-rrl for tcctaggcattcaccata rrf-rrl rev 1400 agagtttgatcctggcttag 16S RNA for t(g/t)aaggaggtgatccagc 16S RNA rev a Primer name according to Michel et al. (2003). b Fragment length after hemi-nested amplification. in Table 5. As only PCR amplicons but no isolates could be investigated from the ticks the respective sequences were not deposited at GenBank. Statistical analyses Statistical analyses were performed using the w 2 test. p Values of o0.05 were considered statistically significant. Results Prevalence of Borrelia burgdorferi s.l. species and OspA types in ticks and patient isolates All tick extractions were subjected to a hemi-nested ospa PCR and subsequently to RFLP for species and OspA type differentiation. It is important to mention that according to the previous RFLP protocol (Michel et al., 2003) it was not possible to distinguish OspA type 6 from OspA type 8 and B. valaisiana subgroup II (M53) from B. spielmanii (Wang et al., 2000). Additional digestion with XbaI now allows reliable differentiation of the above-mentioned species and OspA types (Fig. 1A) (Lencakova et al., 2006). Of the 2155 I. ricinus ticks, 475 were infected with B. burgdorferi s.l., corresponding to a total infection rate of 22% (Table 1). Infection rates were significantly higher in adults compared with nymphs in all regions where both stages were investigated. Total infection rates at the different locations ranged for adults from 18.1% (Bad To lz) to 37.2% (English Garden) (po0.001) and for nymphs from 5% (Erlangen) to 12.3% (Grafrath) (p40.05). From the 136 larvae only 2 (1.5%) were infected, therefore they are not further considered. The most common species found in ticks was B. garinii (34.3%), followed by B. afzelii (25.1%), B. burgdorferi s.s. (22.0%), B. valaisiana (12.7%), and B. spielmanii (5.9%). Even one B. lusitaniae was present in a nymphal tick from Bad To lz. Comparing the Table 5. Accession numbers of the ospa, dbpa, ospc, rrf-rrl, rrs, and fla sequences of B. spielmanii isolates determined in this study Strain Origin ospa ospc dbpa rrf-rrl Rrs Fla PSigII G AM AM (AJ767066) AM AM AM PHap G AM AM (AJ767065) AM AM AM PMew G AM AM AM AM AM AM PMai G AM AM AM AM AM AM PAnz Sl AM AM AM AM AM AM PJes Sl AM AM AM AM AM AM PC-Eq17 F na AM AM AM (AY147008) na A14S NL (AF102057) (AF102058) AM (U76616) (AF102056) (DQ111034) G, Germany; F, France; NL, Netherlands; Sl, Slovenia; na, not available. Numbers in parentheses: not determined in this study.

6 284 ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) SspI SfuI XbaI BglII Kpn21HindIII M SspI SfuI XbaI BglII Kpn21HindIII M HpaII HhaI CelII HincII DdeI Fragmentlength Fig. 1. Typical restriction fragment length polymorphism (RFLP) patterns of the amplified ospa and fla genes from B. spielmanii sp. nov. (A) RFLP pattern of the B. spielmanii sp. nov. ospa PCR fragment (left side) compared to the B. valaisiana ospa subgroup II fragment (strain M53, right side). Note: reliable differentiation is only achieved by XbaI digestion. (B) RFLP pattern of the flagellin PCR fragment of B. spielmanii sp. nov. M: DNA molecular weight marker (bp). different tick stages, B. valaisiana was significantly more prevalent in adults (p ¼ 0.002) and B. garinii in nymphs (p ¼ 0.001). Notably, B. valaisiana and B. spielmanii were exclusively detected in adult ticks. Regarding the different study sites, the proportion of species present in infected adult ticks was between 0% and 30.7% for B. burgdorferi s.s., between 8.6% and 38.5% for B. afzelii, between 11.5% and 81.3% for B. garinii, between 4.0% and 26.0% for B. valaisiana, and between 0% and 17.9% for B. spielmanii. Regarding nymphal ticks, these proportions were between 0% and 40.0% for B. burgdorferi s.s., between 0% and 53.3% for B. afzelii, and between 33.3% and for B. garinii. The most unusual prevalence pattern was found in the English Garden: here B. afzelii was the significantly most common species (pp0.004), followed by B. spielmanii, while B. garinii was, except for B. lusitaniae, the least prevalent species. Of note, here the prevalence of B. spielmanii is significantly higher when compared with any other study site (pp0.032). Regarding OspA types of B. garinii, the significantly most frequent ones were type 6 (33.8% of all B. garinii, p ¼ 0.008) in adult ticks and type 4 (51.5%, po0.001) in nymphs, while especially type 8 was rare and detectable in only one adult tick (Table 3). Significant stage-dependent differences in prevalence were present for OspA type 4 (po0.001) and type 6 (p ¼ 0.002). Comparison of the different regions and tick stages results in a quite heterogeneous picture, possibly caused in part by the low numbers of positive ticks. However, noteworthy is the high prevalence of B. garinii OspA type 4 in Bad To lz, where this type contributes 18 of the 24 B. garinii found in ticks. The RFLP used in the present study allows a reliable differentiation of mixed infections of single ticks with different B. burgdorferi s.l. species and even B. garinii OspA types according to characteristic RFLP patterns as shown in previous studies (Lencakova et al., 2006; Michel et al., 2003). Infection of single ticks with two different species or B. garinii OspA types was present in 26 adults and 3 nymphs (Table 1b). In one adult tick, even three different species were detectable: B. burgdorferi s.s., B. afzelii, and B. garinii OspA type 4. The rate of multiple infections in infected ticks was not different in adults compared with nymphs (p ¼ 0.98). The prevalence of B. burgdorferi species and B. garinii OspA types in multiple infected ticks was comparable to the distribution in ticks harbouring only a single infection and there was no obvious predominance of a specific species or OspA type combination as found in other studies (Kurtenbach et al., 2001; Lencakova et al., 2006). Furthermore, 242 patient strains (Table 3) collected in the period between 1984 and 2002 at the Max von Pettenkofer Institute were characterized to species and OspA type level by ospa RFLP and sequencing of ospa. Among 160 skin isolates B. afzelii (66.9%) was the significantly most frequent species (po0.001), followed by B. garinii (24.4%). Regarding B. garinii in skin isolates, OspA type 4 accounts for 19 of the 39 OspA types found. Notably, four skin isolates could be assigned to the new species B. spielmanii. In cerebrospinal fluid (CSF) isolates, B. garinii (51.1%) was the significantly most often found species (po0.001) followed by B. burgdorferi s.s. (25%) and B. afzelii (20.8%). Also, one B. bissettii was detected. Regarding B. garinii CSF isolates, OspA type 4 accounts

7 ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) Fig. 2. DNA sequence alignment of the rrf-rrl intergenic region of representative Borrelia species. Strains isolated from humans are A14S, PAnz, PHap, PJes, PMai, PMew, and PSig. MIR (Meadows of the Isar River) and EG (English Garden) indicate the collection site of the ticks. Sequences from B. spielmanii sp. nov. found in ticks are based on direct PCR from tick DNA extractions. for 16/38 (42%) OspA types found. Isolates from synovial fluid belonged to B. burgdorferi s.s., B. afzelii, and B. garinii, two strains each (B. garinii were OspA types 4 and 6, respectively). Furthermore, screening of more than 1000 erythema migrans isolates from Slovenia by pulsed field gel electrophoresis (PFGE) of MluI-digested total DNA resulted in two strains, which presented an atypical PFGE pattern (data not shown). Subsequently, both strains, PAnz and PJes, were identified as B. spielmanii strains according to their ospa RFLP and sequence. Molecular characterization of B. spielmanii To gain deeper insight into the genetic diversity of B. spielmanii, patient isolates (n ¼ 6) and tick materials (n ¼ 28) were subjected to further genetic analysis. PCR targeting the inner part of fla followed by RFLP could identify B. burgdorferi s.s., B. garinii, and B. afzelii as described previously (Fukunaga et al., 1996). In addition, B. spielmanii clearly could be differentiated by typical restriction patterns (Fig. 1B): digestion with HhaI and DdeI resulted in DNA fragments of 350 and 230 bp length for both enzymes. This pattern was found for all tick extractions, which were pre-defined as containing B. spielmanii DNA according to ospa-based RFLP. Sequences of rrs (for patient isolates only), rrf-rrl, and the inner part of fla were determined as these sequences provide hints to the evolutionary derivation of bacterial strains (Postic et al., 1994). Compared to sequences of the previously described B. spielmanii strains A14S and PC-Eq17 (Richter et al., 2004), our six patient strains showed 99 identity to rrs, to the inner part of fla, and 96 to rrf-rrl (data shown in Figs. 2 and 3 for rrf-rrl only). This clearly indicates that our patient strains can be assigned to B. spielmanii. Notably, compared to the rrf-rrl sequence of B. burgdorferi s.s. strain B31 several deletions within nucleotides from positions 39 to 88 (Fig. 2) are present.

8 286 ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) dbpa PAnz PJes EG 54 EG 14 PC-Eq17 A14S PMai PMew PSigII MIR 71 PHap 90% 80% 70% In contrast, ospc and dbpa sequences were more heterogeneous. B. spielmanii showed sequence identities between 66% and for dbpa and between 84% and for ospc (Figs. 3 and 4). As shown by sequence identity trees for ospa, ospc, and dbpa (Fig. 4), the B. spielmanii strains cluster in separate groups when compared with other human pathogenic B. burgdorferi s.l. Sequence comparison of the three gene loci shows an identical ospa gene, two different dbpa gene clusters, and a heterogeneous ospc within the species B. spielmanii. An interesting result is that the two dbpa gene groups of B. spielmanii are in close concordance with the two different non-coding rrf-rrl regions (Fig. 3), while such a correlation cannot be found within other B. burgdorferi s.l. species (data not shown). Discussion 69% rrf-rrl 95% PAnz EG 54 EG 14 The still expanding knowledge on the heterogeneity and prevalence of the causative agents of LB in Europe is a prerequisite for development of diagnostic tests, for development of vaccines, as well as for local risk assessment. The goal of the present study was to gain more information regarding the heterogeneity of B. burgdorferi s.l. in patient isolates and in ticks from southern Germany with special respect to B. spielmanii. Furthermore, we were interested in the genetic heterogeneity of the latter species. Prevalence of Borrelia burgdorferi s.l. in patient isolates and ticks The prevalence of B. burgdorferi s.l. in questing I. ricinus found in the present study is in line with PJes PC-Eq17 A14S PMai PSigII MIR 71 PMew PHap 96% Fig. 3. Comparision of the dbpa and rrf-rrl gene sequence identity trees from B. spielmanii sp. nov. previous reports from Europe, where prevalences were 0 11% for larvae, 2 43% for nymphs, and 3 58% for adult ticks (Hubalek and Halouzka, 1997). Most studies throughout Europe recognized B. garinii and/or B. afzelii as the predominant species, while B. burgdorferi s.s. and B. valaisiana are less frequent, and detection of B. lusitaniae is rare (Hubalek and Halouzka, 1997; Rauter and Hartung, 2005; Richter and Matuschka, 2006). Occurrence of the different B. burgdorferi s.l. species thereby may vary considerably between different European countries and even between closely located areas (van Dam et al., 1993; Eiffert et al., 1995; Rijpkema et al., 1996; Hubalek and Halouzka, 1997; Gern et al., 1999; Rauter et al., 2002; Michel et al., 2003; Casati et al., 2004; Jouda et al., 2004; Lencakova et al., 2006). Accordingly, in the present study, B. garinii was the predominant species in nymphal and adult ticks in most study sites, followed by B. afzelii and B. burgdorferi s.s. with similar frequencies. However, any one of the three human pathogenic species was found as the most common one in at least one of the investigated study sites, and the prevalence pattern of species and OspA type frequencies varied considerably between the regions. According to these data, all of the known human pathogenic species and B. garinii subtypes must therefore be considered for development of vaccines or diagnostic tests in Europe. A further interesting finding, as also observed previously, is the focal occurrence of certain species or subtypes, especially that of OspA type 4 in Bad To lz and B. spielmanii in the English Garden (Peter et al., 1995; Michel et al., 2003; Richter et al., 2004). This probably new species was detectable in a surprisingly high proportion of infected ticks from the English Garden, a highly frequented recreational area in the city of Munich. Coinstantaneously, three of the four isolates were from patients living in the Munich area, while the address of the fourth patient is unknown but the skin biopsy was sent by a dermatologist from Munich. Taken together, these data argue for a focal occurrence of B. spielmanii as also found in the study by Richter et al. (2004). The present study confirms that in Europe there is a strong prevalence of B. afzelii among human skin isolates, whereas isolates from CSF are most commonly B. garinii (Table 3), a finding that might argue for a species-specific organotropism (Canica et al., 1993; Wilske et al., 1993; Eiffert et al., 1995; Ruzic-Sabljic et al., 2001, 2002). The fact that B. garinii might be neurotropic is further supported by the finding that recombinant DbpA derived from B. garinii showed the highest sensitivity with sera from patients with early neuroborreliosis when compared with recombinant DbpA of B. afzelii and B. burgdorferi s.s. (Schulte- Spechtel et al., 2005). Under the assumption that all B. burgdorferi s.l. species are equally transmitted from ticks to humans and have no organotropism, the species

9 ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) ospa ospc dbpa 95% 90% 85% 95% 90% 85% 80% 90% 80% 70% 65% ZS7 N40 86% ZS7 B. burgdorferi s.s. N40 PGl B B31 ZS7 PGl 84% 86% 85% PGl N40 B % 94% 81% VS461 PKo PBr B. afzelii PBo PGau PKo 87% PGau PBo A91 89% PHez PHei B29 96% 74% A91 PTrob 86% T25 PLud PBi 96% PRef 97% PAnz PHez PLa PHap PJes PJes PJes PMai PAnz PLud 81% PC-Eq17 PAnz 79% PMew 88% TN 88% EG 54 A14S PWud II Grafrath 49 B. spielmanii PSig II MIR 71 EG 127 Grafrath 49 EG 11 PC-Eq17 EG 191 Grafrath 123 Grafrath 78 85% PHei PFim VS461 PBr PRef T25 B29 PLa PSig II 87% 85% 89% 89% 88% Grafrath 78 Grafrath 123 EG 191 EG 11 PGau 97% PLud A91 95% PBo 93% 98% PKo 66% EG 54 PHap 86% VS461 B. garinii PBr (3)* PRef (7)* T25 (7)* PTrob (4)* PBi (4)* PHei (5)* B29 (6)* 98% 92% 93% 87% PMew MIR 71 PMai EG 127 A14S PC-Eq17 EG 11 98% 87% 84% A14S PMai PMew PSig II MIR 71 EG 127 PHap 77% 72% PFim (6)* 94% EG 191 PTrob PHez (6)* TN (6)* PWudII (6)* 90% Grafrath 78 EG 54 Grafrath49 PBi PFim TN 82% PLa (8)* Grafrath 123 PWud II Fig. 4. Comparison of ospa, ospc, and dbpa gene sequence identity trees from selected strains of B. burgdorferi s.s., B. afzelii, B. garinii, and B. spielmanii sp. nov. Grafrath, MIR (Meadows of the Isar River), and EG (English Garden) indicate the collection sites of the ticks. numbers in brackets indicate the B. garinii OspA type.

10 288 ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) pattern present in the respective organs should match the pattern found in ticks. This is in the present study clearly not true for B. afzelii, since its prevalence in skin is significantly higher (po0.001) when compared with its prevalence in infected nymphs or adults. In our opinion, postulation of an organotropism for B. afzelii for skin is justified by several congruent studies and is, in addition, reflected by the fact that the skin manifestation acrodermatitis chronica athrophicans is non-existent in the USA, where B. afzelii does not occur. Prevalence of B. garinii in CSF isolates is significantly higher when compared with the prevalence in adult ticks (po0.001), but matches the prevalence in nymphs (p ¼ 0.6). Moreover, the overall prevalence pattern in nymphs revealed no significant differences to CSF isolates, not even for the different B. garinii OspA types. Since I. ricinus nymphs are the most important vectors for human disease, organotropism of B. garinii for the central nervous system could not be substantiated, which is in line with a previous study (Eiffert et al., 1995). Furthermore, our results confirm that the strains causing Lyme arthritis in Europe are heterogeneous (Eiffert et al., 1998; Vasiliu et al., 1998) and not limited to B. burgdorferi s.s. as primarily supposed (Jaulhac et al., 1996; Lunemann et al., 2001). Nevertheless, our results must be interpreted with caution. The patient isolates were collected from all over Germany, predominantly southern Germany, between 1984 and 2002, while the ticks represent only eight small areas from southern Germany and were collected in 2003/2004. Furthermore, different detection methods may influence the results, e.g. some species or strains grow better in culture and may even be selectively amplified by PCR. Interestingly, one CSF isolate could be assigned to the species B. bissettii. This species was found in Ixodes ticks from the USA and has rarely been isolated from European patients, but its human pathogenicity is still a matter of discussion (Strle et al., 1997; Postic et al., 1998). Unfortunately, until now we could not obtain information regarding the patients symptoms, laboratory test results, or anamnestic data, and therefore the relevance of this isolate remains unclear. Molecular characterization of B. spielmanii In this study, rrs, rrf-rrl, the inner part of fla, ospa, ospc, and dbpa genes from the patient isolates and tickderived B. spielmanii amplicons have been partially sequenced. Comparison of rrs, fla, rrf-rrl, and ospa sequences to the recently published sequences (Richter et al., 2006) clearly confirmed the assignment of these strains to B. spielmanii. Regarding the rrf-rrl region one has to mention that the sequences cluster into two groups showing 96% sequence identity only, similar to the low rrf-rrl sequence identity found within B. garinii. Another noticeable fact is that all rrf-rrl sequences of the B. spielmanii strains have deletions that cannot be found within the rrf-rrl region of other B. burgdorferi s.l. species (Fig. 2). These deletions lead to the outgrouping of this species, but their significance remains unclear. Further references for the heterogeneity of B. spielmanii aretheexistenceoffourseparateospc types and two dbpa clusters (Fig. 4). Compared to the few sequences that have been to our disposal, this heterogeneity is noteworthy. At the small study site English Garden in Munich measuring about 400 m 2, both dbpa types and two out of the four ospc types were present. We assume that the heterogeneity within this species is even higher than observed here. Notably, the alignment of the DbpA protein sequences confirms the functionality of the DbpA proteins of the B. spielmanii strainsasthelysine residue at position 82 (reference strain B. burgdorferi s.s. B31) required for the binding of decorin (Pikas et al., 2003) is conserved (data not shown). It is suggested that invasiveness of B. burgdorferi s.l. is linked to certain OspC groups (Lagal et al., 2003). So far, B. spielmanii was only detected in patients with localized skin disease and its potential for systemic infection is unknown. More data of patient- and tickderived isolates of B. spielmanii are required to find out whether there are certain OspC types that are invasive or on the other hand are perhaps even not pathogenic. In conclusion, we have found a broad heterogeneity of B. burgdorferi s.l. species and OspA types in ticks and patient isolates from Germany, including the new species B. spielmanii sp. nov. Delineation of the latter as a new species as well as its human pathogenic potential including new isolates from Germany and Slovenia could further be substantiated. Such data are a basic requirement for development of diagnostic tests, vaccines, as well as for risk assessment after a tick bite. Acknowledgements We thank Cecilia Hizo-Teufel for excellent technical work and Jürgen Heesemann for generous support. This work was supported in part by the Robert-Koch-Institut, grant no. ZV , and the Bayerisches Staatsministerium für Umwelt, Gesundheit und Verbraucherschutz. Part of the tick study was part of Sarah Leonhard s thesis, which will be published elsewhere. References Baranton, G., Postic, D., Saint, G., Boerlin, I.P., Piffaretti, J.C., Assous, M., Grimont, P.A., Delineation of Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., group VS461 associated with Lyme borreliosis. Int. J. Syst. Bacteriol. 42,

11 ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) Canica, M.M., Nato, F., du, M.L., Mazie, J.C., Baranton, G., Postic, D., Monoclonal antibodies for identification of Borrelia afzelii sp. nov. associated with late cutaneous manifestations of Lyme borreliosis. Scand. J. Infect. Dis. 25, Casati, S., Bernasconi, M.V., Gern, L., Piffaretti, J.C., Diversity within Borrelia burgdorferi sensu lato genospecies in Switzerland by reca gene sequence. FEMS Microbiol. Lett. 238, Collares-Pereira, M., Couceiro, S., Franca, I., Kurtenbach, K., Schafer, S.M., Vitorino, L., Goncalves, L., Baptista, S., Vieira, M.L., Cunha, C., First isolation of Borrelia lusitaniae from a human patient. J. Clin. Microbiol. 42, Eiffert, H., Ohlenbusch, A., Christen, H.J., Thomssen, R., Spielman, A., Matuschka, F.R., Nondifferentiation between Lyme disease spirochetes from vector ticks and human cerebrospinal fluid. J. Infect. Dis. 171, Eiffert, H., Karsten, A., Thomssen, R., Christen, H.J., Characterization of Borrelia burgdorferi strains in Lyme arthritis. Scand. J. Infect. Dis. 30, Foldvari, G., Farkas, R., Lakos, A., Borrelia spielmanii erythema migrans, Hungary. Emerg. Infect. Dis. 11, Fukunaga, M., Okada, K., Nakao, M., Konishi, T., Sato, Y., Phylogenetic analysis of Borrelia species based on flagellin gene sequences and its application for molecular typing of Lyme disease borreliae. Int. J. Syst. Bacteriol. 46, Gern, L., Hu, C.M., Kocianova, E., Vyrostekova, V., Rehacek, J., Genetic diversity of Borrelia burgdorferi sensu lato isolates obtained from Ixodes ricinus ticks collected in Slovakia. Eur. J. Epidemiol. 15, Hubalek, Z., Halouzka, J., Distribution of Borrelia burgdorferi sensu lato genomic groups in Europe, a review. Eur. J. Epidemiol. 13, Jaulhac, B., Chary-Valckenaere, I., Sibilia, J., Javier, R.M., Piemont, Y., Kuntz, J.L., Monteil, H., Pourel, J., Detection of Borrelia burgdorferi by DNA amplification in synovial tissue samples from patients with Lyme arthritis. Arthritis Rheum. 39, Jouda, F., Perret, J.L., Gern, L., Ixodes ricinus density, and distribution and prevalence of Borrelia burgdorferi sensu lato infection along an altitudinal gradient. J. Med. Entomol. 41, Kurtenbach, K., De Michelis, S., Sewell, H.S., Etti, S., Schäfer, S.M., Hails, R., Collares-Pereira, M., Santos-Reis, M., Hanincova, K., Labuda, M., Bormane, A., Donaghy, M., Distinct combinations of Borrelia burgdorferi sensu lato genospecies found in individual questing ticks from Europe. Appl. Environ. Microbiol. 67, Lagal, V., Postic, D., Ruzic-Sabljic, E., Baranton, G., Genetic diversity among Borrelia strains determined by single-strand conformation polymorphism analysis of the ospc gene and its association with invasiveness. J. Clin. Microbiol. 41, Lencakova, D., Hizo-Teufel, C., Pet ko, B., Schulte-Spechtel, U., Stanko, M., Wilske, B., Fingerle, V., Prevalence of Borrelia burgdorferi s.l. OspA types in Ixodes ticks from selected localities in Slovakia and Poland. Int. J. Med. Microbiol. 296S1, Lunemann, J.D., Zarmas, S., Priem, S., Franz, J., Zschenderlein, R., Aberer, E., Klein, R., Schouls, L., Burmester, G.R., Krause, A., Rapid typing of Borrelia burgdorferi sensu lato species in specimens from patients with different manifestations of Lyme borreliosis. J. Clin. Microbiol. 39, Maraspin, V., Ruzic-Sabljic, E., Strle, F., Lyme Borreliosis and Borrelia spielmanii. Emerg. Infect. Dis. 12, Michel, H., Wilske, B., Hettche, G., Goettner, G., Heimerl, C., Reischl, U., Schulte-Spechtel, U., Fingerle, V., An ospa-polymerase chain reaction/restriction fragment length polymorphism-based method for sensitive detection and reliable differentiation of all European Borrelia burgdorferi sensu lato species and OspA types. Med. Microbiol. Immunol. (Berl.) 193, Peter, O., Bretz, A.G., Bee, D., Occurrence of different genospecies of Borrelia burgdorferi sensu lato in ixodid ticks of Valais, Switzerland. Eur. J. Epidemiol. 11, Pikas, D.S., Brown, E.L., Gurusiddappa, S., Lee, L.Y., Xu, Y., Hook, M., Decorin-binding sites in the adhesin DbpA from Borrelia burgdorferi: a synthetic peptide approach. J. Biol. Chem. 278, Postic, D., Assous, M.V., Grimont, P.A., Baranton, G., Diversity of Borrelia burgdorferi sensu lato evidenced by restriction fragment length polymorphism of rrf (5S)-rrl (23S) intergenic spacer amplicons. Int. J. Syst. Bacteriol. 44, Postic, D., Ras, N.M., Lane, R.S., Hendson, M., Baranton, G., Expanded diversity among Californian Borrelia isolates and description of Borrelia bissettii sp. nov. (formerly Borrelia group DN127). J. Clin. Microbiol. 36, Preac-Mursic, V., Wilske, B., Schierz, G., European Borrelia burgdorferi isolated from humans and ticks. Culture conditions and antibiotic susceptibility. Zentralbl. Bakteriol. Mikrobiol. Hyg. [A] 263, Rauter, C., Hartung, T., Prevalence of Borrelia burgdorferi sensu lato genospecies in Ixodes ricinus ticks in Europe: a metaanalysis. Appl. Environ. Microbiol. 71, Rauter, C., Oehme, R., Diterich, I., Engele, M., Hartung, T., Distribution of clinically relevant Borrelia genospecies in ticks assessed by a novel, single-run, real-time PCR. J. Clin. Microbiol. 40, Richter, D., Matuschka, F.R., Perpetuation of the Lyme disease spirochete Borrelia lusitaniae by lizards. Appl. Environ. Microbiol. 72, Richter, D., Schlee, D.B., Allgower, R., Matuschka, F.R., Relationships of a novel Lyme disease spirochete, Borrelia spielmani sp. nov., with its hosts in Central Europe. Appl. Environ. Microbiol. 70, Richter, D., Postic, D., Sertour, N., Livey, I., Matuschka, F.R., Baranton, G., Delineation of Borrelia burgdorferi sensu lato species by multilocus sequence analysis and confirmation of the delineation of Borrelia spielmanii sp. nov. Int. J. Syst. Evol. Microbiol. 56,

12 290 ARTICLE IN PRESS V. Fingerle et al. / International Journal of Medical Microbiology 298 (2008) Rijpkema, S., Golubic, D., Molkenboer, M., Verbeek-de Kruif, N., Schellekens, J., Identification of four genomic groups of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in a Lyme borreliosis endemic region of northern Croatia. Exp. Appl. Acarol. 20, Rijpkema, S.G., Tazelaar, D.J., Molkenboer, M.J., Noordhoek, G.T., Plantinga, G., Schouls, L.M., Schellekens, J.F., Detection of Borrelia afzelii, Borrelia burgdorferi sensu stricto, Borrelia garinii and group VS116 by PCR in skin biopsies of patients with erythema migrans and acrodermatitis chronica atrophicans. Clin. Microbiol. Infect. 3, Ruzic-Sabljic, E., Lotric-Furlan, S., Maraspin, V., Cimperman, J., Pleterski-Rigler, D., Strle, F., Analysis of Borrelia burgdorferi sensu lato isolated from cerebrospinal fluid. APMIS 109, Ruzic-Sabljic, E., Maraspin, V., Lotric-Furlan, S., Jurca, T., Logar, M., Pikelj-Pecnik, A., Strle, F., Characterization of Borrelia burgdorferi sensu lato strains isolated from human material in Slovenia. Wien. Klin. Wochenschr. 114, Schulte-Spechtel, U., Fingerle, V., Goettner, G., Rogge, S., Wilske, B., Molecular analysis of decorin binding protein A (DbpA) reveals five major groups among European Borrelia burgdorferi sensu lato strains with impact for the development of serological assays and indicates lateral gene transfer of the dbpa gene. Int. J. Med. Microbiol. 296S1, Stanek, G., Strle, F., Lyme borreliosis. Lancet 362, Strle, F., Picken, R.N., Cheng, Y., Cimperman, J., Maraspin, V., Lotric-Furlan, S., Ruzic-Sabljic, E., Picken, M.M., Clinical findings for patients with Lyme borreliosis caused by Borrelia burgdorferi sensu lato with genotypic and phenotypic similarities to strain Clin. Infect. Dis. 25, van Dam, A.P., Kuiper, H., Vos, K., Widjojokusumo, A., de Jongh, B.M., Spanjaard, L., Ramselaar, A.C., Kramer, M.D., Dankert, J., Different genospecies of Borrelia burgdorferi are associated with distinct clinical manifestations of Lyme borreliosis. Clin Infect. Dis. 17, Vasiliu, V., Herzer, P., Ro ssler, D., Lehnert, G., Wilske, B., Heterogeneity of Borrelia burgdorferi sensu lato demonstrated by an ospa-type-specific PCR in synovial fluid from patients with Lyme arthritis. Med. Microbiol. Immunol. (Berl.) 187, Wang, G., van Dam, A.P., Spanjaard, L., Dankert, J., Molecular typing of Borrelia burgdorferi sensu lato by randomly amplified polymorphic DNA fingerprinting analysis. J. Clin. Microbiol. 36, Wang, G., van Dam, A.P., Dankert, J., 1999a. Phenotypic and genetic characterization of a novel Borrelia burgdorferi sensu lato isolate from a patient with Lyme borreliosis. J. Clin. Microbiol. 37, Wang, G., van Dam, A.P., Schwartz, I., Dankert, J., 1999b. Molecular typing of Borrelia burgdorferi sensu lato: taxonomic, epidemiological, and clinical implications. Clin. Microbiol. Rev. 12, Wang, G., van Dam, A.P., Dankert, J., Two distinct ospa genes among Borrelia valaisiana strains. Res. Microbiol. 151, Wilske, B., Preac-Mursic, V., Go bel, U.B., Graf, B., Jauris, S., Soutschek, E., Schwab, E., Zumstein, G., An OspA serotyping system for Borrelia burgdorferi based on reactivity with monoclonal antibodies and OspA sequence analysis. J. Clin. Microbiol. 31, Wilske, B., Busch, U., Eiffert, H., Fingerle, V., Pfister, H.W., Ro ssler, D., Preac-Mursic, V., Diversity of OspA and OspC among cerebrospinal fluid isolates of Borrelia burgdorferi sensu lato from patients with neuroborreliosis in Germany. Med. Microbiol. Immunol. (Berl.) 184,