Name Genotype Reference

Transcription

1 Supplemental Data Supplemental Table 1 S. cerevisiae strains. Name Genotype Reference RMY200 UKY403 W303-1a MATa ade2-101 (och) his3 200 lys2-801 (amp) trp1 901 ura3-52 hht1,hhf1::leu2 hht2,hhf2::his3 plus prm200 (CEN4 ARS1 TRP1 HHT2 HHF2) MATa ade2-101 his3-201 leu2-3,113 lys2-801 trp1-901 ura3-52 GAL+ thr- tyr- arg4-1 hhf1::his3 hhf2::leu2 plus puk421 (AMP CEN TRP1 GAL1- HHF2) MATa leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15 (1) (2) (3) AMR51 W303-1a top1-8::leu2 (3) RS191 W303-1a top2-1(ts) (3) RS192 W303-1a top1-8::leu2 top2-1(ts) (3) BY4741 MATa his3δ1 leu2δ0 met15δ0 ura3δ0 ATCC# YBR289W BY4741 BY4741 snf5δ ATCC# Z460 MATa, ura3-52, leu2-3,112, his3d200, his4-912, lys2-128, rpb1d187::his3 plus prp1-1u (AMP, CEN, LEU2, rpb1-1) (4) Supplemental Table 2 Primers. Experiment Pol II ChIP at PHO84 Sequence GGGTATTGGTATCGGTGGTG

2 Pol II ChIP at PHO84 Top2 and H3 ChIP at PHO84 Top2 and H3 ChIP at PHO84 Pol II ChIP at PHO5 Pol II ChIP at PHO5 Top2 and H3 ChIP at PHO5 Top2 and H3 ChIP at PHO5 AACATGCCAACCCTAGAACG AGGGCCCTTTCAACTCATCT GCATAACTGCACCGATCTCA CTTGGGACTACGATGCCAAT TGAACAAGTTGGAACCGACA TGGAAGTCATCTTATGTGCGCTGC ACGTGTGAGTGCCAAGGTTGTATC Supplemental Figure Legends: Figure S1. A high resolution map of Top2 and nucleosome occupancy at chromosome VI. Representative ChIP-chip data of Top2 (black) and H3 (red) are shown around the centromere of chromosome VI (top panel) and an poor region adjacent to telomere VI-R (bottom panel). Images were generated using the Affymetrix Integrated Genome Browser. Figure S2. Verification of the microarray nucleosome depletion data. H3 ChIP-chip data were rank sorted and four genes were randomly selected from the top 100 and four genes from the bottom 100. ChIP followed by semi-quantitative PCR was then carried out at these genes to verify the microarray data. There is no significant increase in H3 binding at any of the loci from the top 100, whereas the loci from the

3 bottom 100 show significant histone H3 loss during H4 depletion. H3 ChIP data at each gene are normalized to the ACT1 gene and to input. The average of three independent experiments is shown. Error bars represent the standard deviation. Figure S3. Nucleosomes are depleted and Top2 is recruited during gene activation at PHO5. ChIP of histone H3, Top2, and Pol II at the promoter and of the PHO5 gene at various timepoints following shift to low phosphate media in wild type yeast (strain BY4741). ChIP analysis was performed using semi-quantitative PCR and normalized to input and the SPS2 gene. The average of three independent experiments is shown. Error bars represent the standard deviation. Figure S4. Top2 is depleted from the genome following shift to the non-permissive temperature. Top2 ChIP-chip data in wild type, top1δ, and top1δtop2-ts strains. Average binding across the promoter and is shown, separated into clusters as in Figure 4. Figure S5. Top2 is positively correlated with transcriptional activity. Data for Top2 (A) and H3 (B) binding from ChIP-chip analysis were classified into five groups according to previously reported transcriptional rates (5). The average profiles are analyzed as described in Figure 1.

4 Figure S6. Top1 binding at promoters is positively correlated with transcription. Previously published data for Top1 ChIP-chip analysis (6) were classified into five groups according to previously reported transcriptional rates (5). Average binding in each group over the upstream activating sequence (UAS), transcription start site (TSS) and is shown. Figure S7. Gene length is not correlated with Top2 effect on transcription. Pol II ChIP-chip in wild type (blue) and top1δtop2-ts (red) strains. Experiments were performed as in Figure 4. Z-scored average log ratio binding across the promoter and (-1000 bp to bp) is shown. The data have been separated into five groups based upon gene length. Figure S8. Loss of Top1 and Top2 topoisomerase activity does not lead to increased nucleosome occupancy across the promoter or. H3 ChIP-chip binding following loss of Top1 and Top2 (RS192) activity normalized to wild type (W303-1a). Cells were grown to log phase at 25 C and then shifted to 37 C for 30 minutes prior to harvesting chromatin. s were separated into 10 equal sized bins and their associated promoters were divided into five 100 bp bins. Data for 6215 s was averaged. Error bars represent the 95% confidence interval. Note the very small increase in H3 occupancy, likely secondary to decreased transcription in the top1δtop2-ts

5 strain. Figure S9. Loss of Top1 and Top2 topoisomerase activity does not alter nucleosome density at promoters. Top2 and H3 binding at the promoter (-500bp to 0bp from translation start site) upon Top1 and Top2 inhibition was compared as in Figure 2. R represents the Pearson correlation between the percentile-ranked samples. Supplemental References 1. Mann RK & Grunstein M (1992) Histone H3 N terminal mutations allow hyperactivation of the yeast GAL1 gene in vivo. Embo J 11(9): Han M & Grunstein M (1988) Nucleosome loss activates yeast downstream promoters in vivo. Cell 55(6): Brill SJ & Sternglanz R (1988) Transcription dependent DNA supercoiling in yeast DNA topoisomerase mutants. Cell 54(3): Apone LM, et al. (1998) Broad, but not universal, transcriptional requirement for ytafii17, a histone H3 like TAFII present in TFIID and SAGA. Mol Cell 2(5): Holstege FC, et al. (1998) Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95(5): Venters BJ, et al. (2011) A comprehensive genomic binding map of gene and chromatin regulatory proteins in Saccharomyces. Mol Cell 41(4):

6 Figure S1, related to Figure 1 Top2 vs. Input H3 vs. Input ARS604 CEN6 ARS603.5 ARS605 ARS606 ARS Log2Ratio , , , , , ,000 Position (bp;; chromosome VI) YFR053C 1.5 YFR054C YFR055W YFR056C YFR057W Log2Ratio , , , , , , , , ,000 Position (bp;; chromosome VI-R)

7 Figure S2 Figure S3, related to Figure BSC1 MVD1 YPG YOR161W TDH2 YPD Selected from top 100 Selected from bottom 100 TOM7 SPC25 YBR012C YDR095C

8 Figure S3 1.6 H3 binding at the PHO5 promoter 8 Top2 binding at the PHO5 promoter Binding relative to SPS Time after induction (min) Binding relative to SPS Time after induction (min) 50 Pol II binding at the PHO5 Binding relative to SPS Time after induction (min)

9 Figure S4 Cluster 1 Wild Type top1δ top1δ,top2- ts Cluster 2 Top2 enrichment Cluster 3 Cluster 4-500bp - 500bp

10 Supplemental Figure 5 Figure 4 A 0.5 > 4 mrna log2ratio 3~4 mrna log2ratio 2~3 mrna log2ratio 1~2 mrna log2ratio 0.4 < 1 mrna log2ratio end 3 end 0.2 B > 4 mrna log2ratio 3~4 mrna log2ratio 2~3 mrna log2ratio 1~2 mrna log2ratio < 1 mrna log2ratio -1 5 end 3 end

11 Figure S6 Trx Freq Average Top1 Enrichment

12 Figure S7 Length > 3000 bp Pol II enrichment (Z- scored Logra9o) Wild Type top1δtop2- ts bp Pol II enrichment (Z- scored Logra9o) bp Pol II enrichment (Z- scored Logra9o) bp Pol II enrichment (Z- scored Logra9o) < 500 bp Pol II enrichment (Z- scored Logra9o)

13 Figure S8 Rela*ve change in H3 (top1δtop2- ts/wt) bp Top2 inhibi*on

14 Figure S9 Top2 inhibi*on R = 0.07