Functional Genomic Study of Exogenous n-butanol Stress in Escherichia coli. Supplementary Data

Transcription

1 Functional Genomic Study of Exogenous n-butanol Stress in Escherichia coli Supplementary Data Complete Microarray Data: or Complete Proteomics Data (Table S1): See separate file entitled: Rutherford et al 2009_supplementary data Table S1.xls INDEX: Figure S1: Histogram of COG Figure S2: Heat maps of select COG categories. Figure S3: Scatter plot comparing proteomics data across time points Figure S4: Reactive Oxygen Species detection assay. Figure S5: CE-MS metaolite assay Figure S6: Amino acid supplementation assay Figure S7: Comparison of the DH1 and BW strain Figure S8: PLFA analysis Table S2: Primers for RT-PCR

2 Figure S1. n-butanol stress microarray data. Total and differentially expressed genes in all major COG categories are shown. Significant change includes differential expression with a log 2 > 2. Red is up-regulated; blue is down-regulated; gray represents no change. Data represents samples collected at 80 min after n-butanol addition.

3 Figure S2. n-butanol stress microarray data changes in select COG categories across the three sampling times. This figure serves as a supplement to Figure 2 and serves to show the overall changes in these categories. For high resolution images, see separate files entitled, Rutherford et al 2009 COG T.jpg Rutherford et al 2009 COG E.jpg Rutherford et al 2009 COG C.jpg

4 Figure S3: Scatter plot of log 2 ratios of protein level changes at 60 mins vs. 120 mins. Good correlation was observed in changes for candidates indentified in these two data sets.

5 Figure S4: Measurement of intracellular reactive oxygen species using carboxy- H 2 DCFDA. Cells grown were with 0 2.0% n-butanol. Control cells treated with tertbutyl hydroperoxide (TBHP), known to produce intracellular H 2 O 2 and serve as a positive control. Data shown is fluorescence measured from 0 to 40 mins after treatment of cells with carboxy-h 2 DCFDA. Measurements were conducted in triplicate. Specific fluorescence is [Abs 535 /Abs 600 ].

6 Figure S5. CE-MS data for key metabolites in response to n-butanol stress (120 min). For metabolite extraction, E. coli was grown in M9 medium with or without 0.8% n- butanol. Samples were collected in triplicate at the mid-log phase and then pooled (a total volume of 400 ml was drawn from each pool of biomass). The cells were then harvested by centrifugation at 11,000 x g for 10 min at 4 C. Metabolites were extracted via a methanol/water extraction procedure, after which solid phase extraction (Oasis HLB, Waters, MA, USA) was used for the removal of salts from the sample (8). All metabolites assayed were quantified based on concentration curves using commercially available standards. Methods for Capillary electrophoresis (CE) and mass spectrometry (MS) are as follows. CE separation conditions were used as described previously (8). MS analysis was conducted on an Agilent 6210 TOF LC/MS (Agilent Technologies, Santa Clara, CA, USA) and an Agilent 1100 series isocratic HPLC pump for sheath liquid delivery. CE and electrospray ionization (ESI) MS coupling was achieved using an orthogonal coaxial sheath-flow interface, and the Agilent CE system was interfaced to the Agilent 6210 TOF LC/MS via a G1603A Agilent CE-MS adapter kit and a G1607A Agilent CE-ESI-MS sprayer kit (Agilent Technologies, Santa Clara, CA, USA). Both the Agilent CE system and Agilent 6210 TOF LC/MS were controlled by the Chemstation software package (Agilent Technologies, Santa Clara, CA, USA). A contact closure between the instruments was established in order to trigger the MS into operation upon the initiation of a run cycle from Chemstation. The Agilent 6210 TOF LC/MS was initially calibrated using the ES tune mix (Agilent Technologies, Santa Clara, CA, USA) and internally calibrated during runs via reference masses from tetrabutylammonium acetate (Sigma-Aldrich, St. Louis, MO, USA) and tetraethylammonium acetate (Fluka,

7 Seelze, Germany) as previously described in (8). Data acquisition and processing were carried out by the Agilent MassHunter Work Station Console software package. Metabolite changes during n-butanol stress. To examine the general down- regulation of metabolites suggested at both the transcript and protein levels, CE-MS based methods were used for a targeted measurement of the levels of several metabolites known to be involved in both osmotic and acid stress. These included several amino acids, osmoprotectants, and amino acid-derived compounds. Since absolute concentrations of metabolites were measured, this enabled a comparison of specific metabolites in control versus stress samples and also allowed comparison of different metabolites in a given sample. Consistent with the down-regulation in both biosynthetic and utilization pathways, most metabolites measured were found at lower levels or remained unchanged in n-butanol exposed cells (Figure 6). Glutamate, alanine, and glycine were the most abundant amino acids in both control and stressed samples, but were significantly reduced in the stressed samples. Figure S6: Response to metabolites. E. coli DH1 growth with or without addition of 0.8% n-butanol was supplemented with the most highly accumulated amino acids detected in the metabolite assay profile. OD 600 data is shown on a log scale. Data was measured in triplicate.

8 Figure S7: Comparison of growth of the E. coli DH1 wild type strain and the Keio collection E. coli BW25113 wild type strain, in M9 medium and M9 medium supplemented with 0.8% n-butanol. OD 600 data is shown on a log scale. Data was measured in triplicate.

9 Figure S8: Phospho-lipid Fatty Acid profile of E coli DH1 after two hours of n- butanol stress. Control and stressed cell cultures were grown in triplicate as described above and sent to Microbial ID (Newark, DE, USA) for analysis of PLFA content of each sample. Stressed samples were exposed to 0.8% (v/v) n-butanol for two hours before being harvested. Cell cultures (50 ml each) were harvested, centrifuged, washed in phosphate buffered saline, and flash frozen in liquid nitrogen before being shipped.

10 Table S2 Primers used for qpcr ompf GACATGACCTATGCCCGTCT GCCGTAATCGAAAGAACCAA evgs CTCAGGCGTTTAAGCAGGTC TCCTGCGATAATCCACTTCC cpxp TAACCGAACATCAGCGTCAG CATCTCAACCTGACGAGCAA mara AATACATCCGCAGCCGTAAG GTATTTATGCGGCGGAACAT rpoh GGCTGAAAAGCTGCATTACC CATCAGGCCGATGTTACCTT cyoa GTTGGTTTCGCCTGGAAGTA TCGATGGTAATGGGCTTCTC arca GCTGAACTGCTGAAGAAAATGAC CGGATCGTCACGTCTACAGT