Anna A. Sablina, Wen Chen, Jason D. Arroyo, Laura Corral, Melissa Hector, Sara E. Bulmer, James A. DeCaprio, and William C. Hahn

Transcription

1 Cell, Volume 129 Supplemental Data The Tumor Suppressor PP2A Aβ Regulates the RalA GTPase Anna A. Sablina, Wen Chen, Jason D. Arroyo, Laura Corral, Melissa Hector, Sara E. Bulmer, James A. DeCaprio, and William C. Hahn Supplemental Experimental Procedures. Plasmids, cell lines, infections To create a FLAG epitope-tagged version of PP2A Aβ, we performed RT-PCR, using the sense primer GGCGGCGGATCCATGGACTACAAAGACGATGACGACAAGGCGGGCGCATCA GAGCTCGGGACC and the antisense primer GGCGGCGGCCTCGAGTTATGCCAATGCA AGAACACTTATAGC. This fragment was subcloned into the retroviral vector pmig. The Aβ mutants were generated using the QuickChange Multi Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA). HA-tagged wt-rala-v23g and A194S-Ral-V23G were the gift of Dr. Chi-Ying F. Huang (Division of Molecular and Genomic Medicine, National Health Research Institutes, Taipei). HA-tagged wild-type RalA and S11A, S183A and S194A mutants were generated by site-directed mutagenesis and then subcloned into the retroviral vectors ppsneo and pbabe-puro. The vectors pmko.1-shaα, pmko.1-shaβ, or pmko.1-shaβ2 were generated by introducing oligonucleotides corresponding to nucleotides of Aα subunit (gene accession number J02902), nucleotides or , respectively, of Aβ subunit (gene accession number AF087438) followed by a 6-bp loop and the corresponding antisense sequence, followed by five thymidines into pmko.1-puro (Masutomi et al., 2003). The plko.1- Puro, plko.1-shrala-1, or plko.1-shrala-2 vectors were provided by the RNAi Consortium (Broad Institute) (Moffat et al., 2006). Cells were cultured in minimal Eagle medium alpha (MEMα) supplemented with 10% heat-inactivated fetal calf serum (IFS). Wild-type and mutant versions of PP2A Aβ or RalA were introduced into cells using amphotropic retroviruses to generate the stable cell lines, as described (Hahn et al., 2002). HEK TER shaβ and shaβ-2 cells were generated by infecting HEK TER

2 cells with shaβ- or shaβ1-containing retroviruses and selecting with puromycin (0.5 μg/ml). HEK TER-shRalA cells were generated by infecting cells with shrala-1 or shrala-2-containing lentivirus. Immunoblotting and immunoprecipitation Cells were suspended in a lysis buffer [50mM Tris-HCl, ph 7.5, 150 mm NaCl, 1mM EDTA, protease inhibitor cocktail (Roche, Mannheim, Germany) and 0.5% NP-40] and cleared of insoluble material by centrifugation. Soluble proteins (100 μg) were subjected to SDS-PAGE followed by immunoblotting. To purify membrane-rich fraction of proteins, ProteoExtract Membrane Protein Extraction kit (Calbiochem) was used according the manufacturer s instructions. The antibodies used included: PP2A Aα (clone 6F9) and A (clone 6G3) (Covance, Richmond, CA), Cα (BD Biosciences, San Diego, CA), B56α (Upstate Biotechnology, Lake Placid, NY), and B56β (Santa Cruz Biotech, Santa Cruz, CA), FLAG M2, FLAG M5, rabbit polyclonal FLAG and β-actin (Sigma-Aldrich Co., St. Louis, MO), HA (clone 12C5) (Boehringer Mannheim). Affinity-purified polyclonal antibodies were raised against B55α, B56γ, B56δ subunit, and SV40 ST peptides as described (Chen et al., 2004). The PP2A B56ε polyclonal antibody was obtained by immunizing rabbits with a peptide ELKRGLRRDGIIPT corresponding to amino acids For immunoprecipitation, cells were lysed in a buffer containing 50 mm Tris-HCl, ph 7.5, 150 mm NaCl, 1mM EDTA, protease inhibitor cocktail and 0.3% CHAPS. Cell lysates (2 mg) were incubated with the FLAG M5 or Aα (clone 6F9) antibody overnight at 4 C, followed by the addition of protein G Sepharose beads (Amersham, Piscataway, NJ) for 2 h at 4 C, or overnight at 4 C with FLAG-agarose (M2) or HA-agarose (HA7) (Sigma Aldrich). The beads were washed 3 times with lysis buffer and eluted with 3X FLAG peptide (150ng/μl), 0.1M glycine (ph 3.5) or 2 SDS sample buffer, followed by SDS-PAGE and immunoblotting. For quantitative reciprocal co-immunoprecipitation experiments overexpressed FLAGtagged Aβ and HA-tagged in 293T cells were subjected to immunoprecipitation with anti-ha agarose, or anti-flag-agarose. The supernatants from the first immunoprecipitation were sequentially incubated with anti-flag-agarose (M2), or anti-ha-agarose (HA7) in reciprocal manner. The proteins eluted from the beads were separated by SDS-PAGE and revealed by

3 immunoblotting using HA and FLAG antibodies. Densitometry analysis was performed by using Scion Image Software. Quantitative RT-PCR Total RNA was prepared using TRIzol Reagent (Invitrogen, Carlsbad, CA). cdna synthesis was performed using the RT-for-PCR kit (BD Biosciences, San Diego, CA). Real-time PCR reactions were conducted in an ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA) using SYBR Green PCR Master Mix (Applied Biosystems). The primers S117 (GACGAGCTCCGCAATGAAG) and R399 (GGGACTCCACAGCCTTGT) were used for amplifying the Aβ cdna. Cell cycle and apoptosis analysis Cells were incubated with BrdU and then with fixed in 70% ethanol overnight. Fixed cells were double stained with PI and anti-brdu antibodies (BD Biosciences) and cell cycle distribution was determined using flow cytometry. To detect apoptotic cells, attached and floating cells were harvested, washed with PBS and stained by binding buffer containing FITC-conjugated Annexin V (Calbiochem, La Jolla, CA) and PI. Apoptotic cells were quantitated by fluorescence-activated cell sorting and analyzed by CellQuest software. References: Chen, W., Possemato, R., Campbell, K. T., Plattner, C. A., Pallas, D. C., and Hahn, W. C. (2004). Identification of specific PP2A complexes involved in human cell transformation. Cancer Cell 5, Hahn, W. C., Dessain, S. K., Brooks, M. W., King, J. E., Elenbaas, B., Sabatini, D. M., DeCaprio, J. A., and Weinberg, R. A. (2002). Enumeration of the simian virus 40 early region elements necessary for human cell transformation. Mol Cell Biol 22, Masutomi, K., Yu, E. Y., Khurts, S., Ben-Porath, I., Currier, J. L., Metz, G. B., Brooks, M. W., Kaneko, S., Murakami, S., DeCaprio, J. A., et al. (2003). Telomerase maintains telomere structure in normal human cells. Cell 114, Moffat, J., Grueneberg, D. A., Yang, X., Kim, S. Y., Kloepfer, A. M., Hinkle, G., Piqani, B., Eisenhaure, T. M., Luo, B., Grenier, J. K., et al. (2006). A Lentiviral RNAi Library for Human and Mouse Genes Applied to an Arrayed Viral High-Content Screen. Cell 124,

4

5

6

7

8

9

10

11