Prevalence of SHV β-lactamases in Escherichia coli

Transcription

1 African Journal of Microbiology Research Vol. 6(26), pp , 12 July, 2012 Available online at DOI: /AJMR ISSN Academic Journals Full Length Research Paper Prevalence of SHV β-lactamases in Escherichia coli Mohammad Mehdi Soltan Dallal 1,2 *, Ailar Sabaghi 1, Hedrosha Molla Agha Mirzaiee 1, Jalil Fallah Mehrabadi 3, Abdol Aziz Rastegar Lari 2, Mohammad Reza Eshraghian 4, Mohammad Kazem Sharifi Yazdi 5, Enayat Kalantar 6,7 and Sevan Avadisians 1 * 1 Department of Pathobiology, Division of Microbiology, School of Public Health, Tehran University of Medical Sciences, 2 Antimicrobial Resistant Research Center, Tehran University of Medical Sciences, 3 Bioinformatics Institute, Tehran. Iran. 4 Department of Epidemiology and Biostatistics, School of Public Health, Tehran University of Medical Sciences, 5 Department of Medical Laboratory Sciences, School of Paramedicine, Tehran University of Medical Sciences, 6 Department of Medical Microbiology, Kurdistan University of Medical Sciences, Sanandaj, Iran. 7 Department of Pathobiology, School of Medicine, Alborz University of Medical Sciences, Karaj, Iran. Accepted 4 April, 2012 Resistance to β-lactam antibiotics by Gram-negative bacteria, especially Escherichia coli, is a major public health issue worldwide, and is often caused by the production of β-lactamase enzymes. Specifically, extended-spectrum β-lactamases (ESBLs), which cannot be diagnosed by phenotypic tests recommended by the Clinical and Laboratory Standards Institute (CLSI), are often produced. In this study, the use of designed primers with high ability to detect the sub family SHV gene was preferred. We focused on evaluating the prevalence of extended-spectrum β-lactamases using the disk diffusion method and confirmatory test (combined disk), as well as polymerase chain reaction (PCR) for the following gene (SHV). Our findings indicate that the prevalence of ESBLs in Iran is rising, which may lead to the ineffective treatment of these infections using β-lactam antibiotics. The development of nonphenotypic diagnostic methods capable of detecting β-lactamase enzymes is essential for the control of resistant strains as well as successful treatment through the administration of an appropriate β- lactam drug. Key words: Escherichia coli, beta lactamase enzymes, SHV-type extended spectrum beta-lactamases. INTRODUCTION Gram-negative pathogens have evolved several mechanisms to resist β-lactam antibiotics. However, the most predominant mechanism results from the production of β-lactamase enzymes, which inactivate the antibiotic by hydrolysis of the β-lactam ring (Stapleton et al., 1999; Rayamajhi et al., 2008). The widespread and unregulated *Corresponding author. sovenavedissian@yahoo.com. Tel: Fax: Abbreviation: ESBLs, Extended-spectrum β-lactamases. use of β-lactam antibiotics in medicine has led to the evolution of novel β-lactamase enzymes in gram-negative pathogens, including the extended spectrum β- lactamases (ESBLs) (Bradford, 2001; Denton, 2007). The SHV type-esbls are encoded in the chromosome of Klebsiella isolates, which can be transported to mobile elements such as plasmids and thereby promote the transfer to other microbial societies, in particular Enterobacteriaceae (Paterson and Bonomo, 2005). Detection of ESBLs is essential at the time of diagnosis, and a failure to detect these genes is the major cause of treatment failure using β-lactam antibiotics (Netzel et al.,

2 Dallal et al Table 1. Primers used for amplification. Target Primer Sequence (5`to 3 ` as synthesized) Expected amplicon size (bp) SHV SHVF GCCTGTGTATTATCTCCCTGTTAGC ). One of the current methods for ESBL detection is an initial screen for a series of cephalosporin indicators, especially ceftazidime and cefotaxime, and subsequent confirmatory tests with clavulanic acid (an inhibitor of ESBLs). In this test, if the zone of inhibition (ZOI) in the presence of clavulanic acid is greater than the ZOI in the absence of clavulanic acid, those organisms are classified as ESBL producers (Stürenburg and Mack, 2003; Pitout and Laupland, 2008). The prevalence of ESBL resistant strains amongst certain pathogens, particularly Escherichia coli, is increasing and therefore a broader spectrum of resistant strains is emerging (Goossens and Grabein, 2005; Deshpande et al., 2006). Over the past decade, the appearance of novel β- lactamase enzymes among pathogens has led to inadequacies in the diagnosis of ESBL resistant strains using the disk diffusion method (Goossens and Grabein, 2005). As a consequence, the use of molecular techniques in conjunction with phenotypic tests is essential (Jacoby and Medeiros, 1991; Pitout and Laupland, 2008). In this study, we addressed the prevalence of ESBLs and also sought to detect SHV-type β-lactamase genes by PCR using designed primers. MATERIALS AND METHODS Bacterial strains Over 500 clinical samples were collected from hospitals in Tehran and 200 E. coli isolates were detected using standard biochemical tests including the indole, methyl red, Voges-Proskauer, and citrate (IMViC) tests. All strains of E. coli isolated from samples were stored in skim milk at -70 C until required for further tests. Screening and phenotypic identification of ESBLs E. coli isolates were screened for susceptibility to antimicrobial agents using a standard Disk diffusion method on Muller-Hinton agar to test for ESBL producing strains. E. coli was streaked out on Muller-Hinton agar plates at the desired density and filter disks containing antibiotic were placed on the agar. The antibiotics used were as follows: cefotaxime (30 µg), ceftazidime (30 µg), gentamicin (10 µg), amoxicillin (30 µg), imipenem (10 µg), nalidixic acid (30 µg), streptomycin (10 µg), cotrimoxazole (1.25 µg), ciprofloxacin (5 µg) and chloramphenicol (30 µg) (Mast Diagnostics Ltd., UK). After incubation for 24 h at 37 C, the results were interpreted according to Clinical and Laboratory Standards Institute (CLSI). E. coli isolates resistant to cephalosporins were selected for confirmatory tests (combined disk method), which used ceftazidime (30 µg), ceftazidime/clavulanate (30/10 µg), cefotaxime (30 µg), and cefotaxime/clavulanate (30/10 µg) (Mast Diagnostics Ltd., UK). After incubation for 24 h at 37 C, production of ESBLs was confirmed by a 5 mm increase in the ZOI in the presence of clavulanic acid compared to samples without clavulanic acid (Clinical and Laboratory Standards Institute, 2005; Song et al., 2007). Isolates expressing ESBLs were tested for the bla SHV gene by PCR. Design of primers 50 sequences related to the bla SHV gene of E. coli were identified in GenBank. These sequences were aligned using a MEGA 4 multiple-alignment program to identify analogous loci. These loci were used to design primers using Gene runner. The designed primers were then tested in silico for homology with submitted sequences using BLAST. Finally, a set of designed primers were evaluated using PCR. PCR and sequencing of the β-lactamase genes Genomic DNA was isolated from E. coli strains expressing ESBLs using the extraction kit (Bioneer, Seoul, Korea) according to the manufacturer s instructions. Subsequently, the bla SHV gene was amplified by PCR using designed primers (Table 1) in the following conditions: each reaction contained 2.5 µl PCR buffer (10 X), 2 µl MgCl 2 (50 mm), 1 µl dntp (10 mm), 1.5 µl of each primer (50 pmol/µl), 1 µl Taq polymerase (5 U/µl), 2 µl template DNA (50 pmol/µl), and sterile H 2O (14.5 µl) in a final volume of 25 µl. Evidently, two negative control reactions were exercised. One of them contained the same material without DNA template and the other contained genomic DNA of a SHV negative clone which was confirmed by phenotypic assay. Moreover, Klebsiella pneumoniae ATCC 7881 was used as a positive control for bla SHV expression. PCR amplification was achieved using the following conditions: initial denaturation at 94 C for 3 min, followed by 40 cycles of denaturation at 94 C for 1 min, annealing at 62 C for 1 min, and elongation at 72 C for 1 min. The final elongation step (72 C) occurred for 10 min. Subsequently, the amplicons were detected by electrophoresis using a 0.8% agarose gel. PCR products were purified using a kit (Fermentas, Germany) according to the manufacturer s instructions. PCR products that corresponded to the expected size of the SHV cluster were sent to Macrogen Research, Seol, Korea for sequencing analysis. The resulting sequences were aligned with known SHV sequences in the NCBI database. RESULTS In our study, 200 clinical isolates of E. coli were collected over six months. The samples were isolated from urine and urinary catheter (62.5%), stool (24%), blood (9%), wound tissue (2.5%), and other clinical samples (2%). The patterns of resistance of the 200 E. coli isolates to 10 antimicrobial agents are shown in Table 2. The majority of isolates showed a high degree of resistance to oxyimino cephalosporins but appeared to be susceptible

3 5520 Afr. J. Microbiol. Res. Table 2. Pattern of resistance among 200 E. coli isolates to 10 antimicrobial agents. Antibiotic Resistance Intermediate Sensitive Imipenem 1 (0/5%) (99.5%) Ciprofloxacin 109 (54.5%) 16 (8%) 75 (37.5%) Gentamicin 78 (39%) 4 (2%) 118 (59%) Chloramphenicol 61 (30.5%) 36 (18%) 103 (51.5%) Streptomycin 143 (71.5%) 29 (14.5%) 28 (14%) Cefotaxime 128 (64%) 7 (3.5%) 65 (32.5%) Cepatozidin 111 (55.5%) 11 (5.5%) 78 (39%) Cotrimoxazole 161 (80.5%) 3 (1.5%) 36 (18%) Nalidixic acid 148 (74%) 13 (6.5%) 39 (19.5%) Amoxicillin 189 (94.5%) 3 (1.5%) 8 (4%) to imipenem as well. Up to 70% of the isolates exhibited a multidrug-resistance (MDR) phenotype. 128 (65%) of the ceftazidime and cefotaxime resistant strains of E. coli in the Disk diffusion method were classified as putatively positive for ESBLs and were selected for subsequent testing by the combined disk assay. In the combined disk assay, 115 (89.8%) isolates were found to express ESBLs among the 128 isolates screened. ESBL-expressing strains of E. coli were more common in urinary samples (80%). PCR was performed on genomic DNA isolated from all 128 resistance strains using designed primers. These data shows that among these isolates, 7(5.5%) were positive for the bla SHV. (Figure 1). DISCUSSION The prevalence of β-lactamase expressing E. coli strains varies significantly over time as well as geographic location (Al-Jasser, 2006). For example, among 7,054 strains of E. coli isolated between 1994 and 1996 in Barcelona, the prevalence of ESBL-producing strains was 0.14% (Sabaté, 2002). In 2001, however, the prevalence increased to 2.1% (Kenny et al., 2003). Similarly, other studies have shown that the prevalence of ESBLexpressing bacteria in Iran is rising according to the resistant rate of E. coli to cephalosporin indicators in this study (89.8%) compared with another study like Nakhaei et al. (32.11%) which is reported from Iran (Nakhaei et al., 2009) and could possibly be due to the irregular use of β-lactam antibiotics, especially expanded cephalosporins in Iran (Al-Jasser, 2006). Our study shows that among the 128 E. coli isolates screened using the Disk diffusion method, only 115 isolates were found to express ESBLs using the CLSI-recommended confirmatory assay (Combined Disk assay). Today, a significant challenge for diagnostic laboratories is the detection of extended spectrum β-lactamases, especially with the discovery of novel β-lactamase enzymes such as AmpC. These novel β-lactamases often register as false negatives when they are screened for using conventional ESBL phenotypic assays (Hanson, 2003). The misdiagnosis of β-lactam resistant bacteria by diagnostic laboratories can lead to the prescription of unsuitable drugs and can result in the failure to cure the infection or even death of the patient (Paterson et al., 2001). In order to verify the strains that were negative in the confirmatory test, we performed further evaluation using molecular methods as recommended by the CLSI (Walther-Rasmussen and Høiby, 2002; Song et al., 2007). PCR was performed on all 128 resistant isolates, and seven (5.5%) of the strains tested were shown to express bla SHV (Figure 1). Our study identified one sample with a negative ESBL phenotype that expressed the bla SHV gene, showing that possession of an ESBL gene may not always be detected by ESBL expression assays. The bla SHV gene was only detected in 5.5% of the isolates tested. Other ESBL genes such as TEM, OXA, and CTX-M may be responsible for the ESBL phenotype (Zhang et al, 2009). The prevalence of the bla SHV gene in this study was very similar to that reported in a Swedish hospital (6%, 2001 to 2006) (Fang et al., 2008) as well as the incidence reported at the Seoul National University Hospital in Korea (8.7%, 1995 to 1999) (Kim and Lee, 2000). In addition, our data was slightly higher than that reported in Thailand (3.8%, 2005) (Kiratisin et al., 2008) and was lower than that reported at a University Hospital in Salamanca, Spain (15.6%, 2001 to 2004) (Romero et al., 2007) as well as at several Turkish hospitals (28.6, 2007) (Hosoglu et al., 2007). ESBLs were first described in 1983 in Germany. Since then, a variety of these enzymes have been found worldwide in a broad spectrum of pathogens, in particular Klebsiella sp. and E. coli, and their expression has been associated with failures in treatment and increased mortality (Thomson, 2001; Denton, 2007). Previous investigations have not taken into account the expression of novel β-lactamases and the inability to detect them in phenotypic tests. Additionally, several clinical institutes do not screen for ESBL expression in bacteria. Our data supports the need for clinical diagnostic laboratories to

4 Dallal et al Figure 1. Lane 1, 100 bp DNA marker; lane 2, bla SHV from the positive control; lanes 3, 4, 5, and 7, clinical isolates that were negative for expression of the bla. 2. Lane 1: 100 bp DNA marker; Lane 2: bla SHV from SHV gene; lanes 6 and 8, clinical isolates expressing the bla SHV gene; lane 9, negative control. the positive control; Lane 3 Clinical isolates that were negative for expression of the bla SHV gene; Lane 6 and lates expressing improve diagnostic the methods bla SHV that gene; can unequivocally and Lane 9: 53(4): negative control detect ESBL-expressing organisms. ACKNOWLEDGMENT This research has been supported by Tehran University of Medical Sciences and Health Services grant and Antibiotic resistant research center, Tehran University of Medical Sciences, Number: REFERENCES Al-Jasser AM (2006). Extended-spectrum beta-lactamases (ESBLs): a global problem. Kuwait. Med. J., 38(3): Bradford PA (2001). Extended-spectrum β-lactamases in the 21 st century: characterization, epidemiology and detection of this important resistance threat. Clin. Microbiol. Rev., 14(4): Clinical and Laboratory Standards Institute (CLSI) (2005). Performance standards for antimicrobial susceptibility testing; 15th informational supplement.m100-s15. 14th Edition. Clinical and Laboratory Standards Institute, Wayne, PA, USA. Denton M (2007). Enterobacteriaceae. Int. J. Antimicrob. Agents, 29(3): S9-S22. Deshpande LM, Jones RN, Fritsche TR, Sader HS (2006). Occurrence of plasmidic AmpC type β-lactamase-mediated resistance in Escherichia coli: report from the SENTRY antimicrobial surveillance program (North America, 2004). Int. J. Antimicrob. Agents, 28(6): Fang H, Ataker F, Hedin G, Dornbusch K (2008). Molecular epidemiology of extended-spectrum β-lactamases among Escherichia coli isolates collected in a Swedish hospital and its associated health care facilities from 2001 to J. Clin. Microbiol., 46(2): Goossens H, Grabein B (2005). Prevalence and antimicrobial susceptibility data for extended-spectrum β-lactamase and AmpCproducing Enterobacteriaceae from the MYSTIC program in Europe and the United States ( ). Diagn. Microbiol. Infect. Dis., Hanson ND (2003). AmpC β-lactamases: what do we need to know for the future? J. Antimicrob. Chemother., 52(1): 2-4. Hosoglu S, Gundes S, Kolayli F, Karadenizli A, Demirdag K, Gunaydin M, Altindis M, Caylan R, Ucmak H (2007). Extended-spectrum betalactamases in ceftazidime resistant Escherichia coli and Klebsiella pneumoniae isolates in Turkish hospitals. Indian J. Med. Microbiol., 25(4): Jacoby GA, Medeiros AA (1991). More extended-spectrum β- lactamase. Antimicrob. Agents Chemother., 35(9): Kenny MJ, Birtles RJ, Day MJ, Shaw SE (2003). Community transmission of extended-spectrum β-lactamase. Emerg. Infect. Dis., 9(8): Kim J, Lee H-G (2000). Rapid discriminatory detection of genes coding for SHV β-lactamases by ligase chain reaction. Antimicrob. Agents Chemother., 44(7): Kiratisin P, Apisarnthanarak A, Laesripa C, Saifon P (2008). Molecular characterization and epidemiology of extended-spectrum-βlactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrob. Agents Chemother., 52(8): Nakhaei MM, Moshrefi SH (2009). Determined the pattern of antibiotic resistant urine Escherichia coli isolates and survey the prevalence of broad spectrum betalactamases. J. Med. Centers Sabzevar., 4: Netzel TC, Jindani I, Hanson N, Turner BM, Smith L, Rand KH (2007). The AmpC inhibitor, Syn2190, can be used to reveal extendedspectrum β-lactamases in Escherichia coli. Diagn. Microbiol. Infect. Dis., 58(3): Paterson DL, Bonomo RA (2005). Extended-spectrum β lactamases: a clinical update. Clin. Microbiol. Rev. 18(4): Paterson DL, Ko WC, Von GA, Casellas JM, Mulazimoglu L, Klugman KP, Bonomo RA, Rice LB, Mccormack JG, Yu VL (2001). Outcome of cephalosporin treatment for serious infections due to apparently susceptible organisms producing extended-spectrum β-lactamases: implications for the clinical microbiology laboratory. J. Clin. Microbiol., 39(6): Pitout JD, Laupland KB (2008). Extended-spectrum β-lactamaseproducing Enterobacteriaceae: an emerging public-health concern. Lancet. Infect. Dis. 8(3): Rayamajhi N, Kang SG, Lee DY, Kang ML, Lee SI, Park KY, Lee HS,

5 5522 Afr. J. Microbiol. Res. Yoo Hs (2008). Characterization of TEM-, SHV- and AmpC-type β- lactamases from cephalosporin resistant Enterobacteriaceae isolated from swine. Int. J. Food. Microbiol., 124(2): Romero ED, Padilla TP, Hernández AH, Grande RP, Vázquez MF, García IG, García-Rodríguez JA, Munnoz Bellido JL (2007). Prevalence of clinical isolates of Escherichia coli and Klebsiella spp. producing multiple extended-spectrum β-lactamases. Diagn. Microbiol. Infect. Dis., 59(4): Sabaté M, Miró E, Navarro F, Vergés C, Aliaga R, Mirelis B, Prats G (2002). β-lactamases involved in resistance to broad-spectrum cephalosporins in Escherichia coli and Klebsiella spp. clinical isolates collected between 1994 and 1996, in Barcelona (Spain). J. Antimicrob. Chemother., 49(6): Song W, Bae K, Lee Y-N, Lee C-H, Lee SH, Jeong SH (2007). Detection of extended-spectrum β-lactamases by using Boronic acid as an AmpC β- lactamase inhibitor in clinical isolates of Klebsiella spp. and Escherichia coli. J. Clin. Microbiol., 45(4): Stapleton PD, Shannon KP, French GL (1999). Construction and characterization of mutants of the TEM-1 β-lactamase containing amino acid substitutions associated with both extended-spectrum resistance and resistance to β-lactamase inhibitors. Antimicrob. Agents. Chemother., 43(8): Stürenburg E, Mack D (2003). Extended-spectrum beta-lactamases: implications for the clinical microbiology laboratory, therapy, and infection control. J. Infect., 47(4): Thomson KS (2001). Controversies about extended-spectrum and AmpC beta-lactamases. Emerg. Infect. Dis., 7(2): Walther-Rasmussen J, Høiby N (2002). Plasmid-borne AmpClactamases. Can. J. Microbiol., 48(6): Zhang Z, Guo X, Zhang Q (2009). Prevalence characterization of extended-spectrum β-lactamases among Escherichia coli isolates collected in Zhengzhou. J. Clin. Lab. Anal., 23(6):