Flowcytometry-based purity analysis of peritoneal macrophage culture.

Transcription

1 Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate elicited peritoneal cells were incubated in culture dish for hours in DMEM supplemented with % FS and antibiotic. After washing of non-adherent cells, adherent macrophages were scraped from dish with rubber policeman and subjected to FITC-labeled CD5 antibody staining. A total of 5, or more cells were analyzed on a D FACSCalibur flow cytometer and CD5 positive cells were recorded as macrophages. Histogram shown is representative of 3 different samples. Figure S Time course of KLF4 gene expression. Changes in KLF4 mrna expression levels after treatment with LPS (5ng/ml), IFNγ (5ng/ml), IL4 (ng/ml), IL3 (ng/ml) and IL (ng/ml) in (A) peritoneal macrophages (PM) and () bone marrow derived macrophages (MDM). (C) Treatment of peritoneal macrophages with low dose of LPS (ng/ml). n=3 for each time point. Data presented as mean ± SEM. p<.5, Student s t test with onferroni correction. Figure S3 Characterization of myeloid-specific KLF4-deficient mice. Page 47 of 5

2 Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript RG- (A) Genotyping analysis of LysM cre/cre () and LysM cre/cre :KLF4 flox/flox () mice. (-D) Deletion of KLF4 in macrophages as assessed by qpcr ( and C) and Western blot (D). n=3 in each group for qpcr. (E) Leukocytes cell populations are comparable in and mice as assayed by CC (n=5 per genotype). (F) Monocyte population distribution (Ly6C hi vs. Ly6C lo ) is similar in and mice as analyzed by flow cytometry. Leukocytes were stained with fluorescent anti- CD5-RE (MCA898PET, AbDserotec), anti-cdb-percp-cy5.5 (55993, D), and anti-ly6c-fitc (5534, D) antibodies, and cells gated from CD5+ were further analyzed for CDb and Ly6C expression. n=3 in each genotype. p<.5, Student s t test with onferroni correction. : not significant. Figure S4 KLF4 is involved in the regulation of Arg and and PPARγ expression. (A) KLF4 enhanced IL4-induced Arg- expression. () KLF4 and Stat6 synergistically activate PPARγ promoter in RAW64.7 cells. n=3 in each group. (C) Requirement of KLF binding sites for optimal Arg- promoter activity. Schematic diagram of the IL4- responsive enhancer region of the mouse Arg- gene showing pertinent transcription factor binding sites. WT: ~4kb wild type mouse arg- promoter; ΔKLF#: arg- promoter with 5 KLF-binding site (KLF#) mutated; ΔKLF#: arg- promoter with 3 KLF-binding site (KLF#) mutated; ΔKLF#&: arg- promoter with both KLF-binding sites (KLF# and KLF#) mutated. n=3 in each group. (D) ChIP analysis demonstrates that binding of Stat6 to the Arg- promoter is not affected by KLF4 deficiency or overexpression. (E) IL4-induced Stat6 phosphorylation is similar in WT and KLF4-deficient MDM. Western blots of total cell protein were assessed by antibodies against total or phosphorylated Stat6. p<.5, Student s t test with onferroni correction. Page 48 of 5

3 Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript RG- Figure S5 Deficiency of KLF4 in macrophages enhanced LPS-induced M gene expression. LPS induced enhanced secretion of MCP- (A) and TNFα () in macrophages medium. Cytokine levels were determined by ELISA. n=3 in each group. p<.5, Student s t test. Figure S6 LPS-induced pro-inflammation genes expression and NO production in WT and Stat6- null macrophages. (A-E) qpcr analysis of pro-inflammation genes in control and LPS-treated peritoneal macrophages from WT and Stat6-null mice. n=3 in each group. (F) LPS-induced NO production in WT and Stat6-null macrophages as assayed by nitrate concentration in conditioned medium. n=3 for each data point. p<.5, Student s t test. : not significant. Figure S7 Non-specific PCR for Cox- promoter using non-targeting primers. PCR was performed with sense-primers: ATTCAAGCAGCAGAAGAGGGCAG and antisense-primer: CTGGGATGCCAGAGCACACTG. Figure S8 Page 49 of 5

4 Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript RG- IL4-pretreatment inhibits subsequent LPS-mediated induction of M genes in macrophages but not in macrophages. n=3 for each data point. p<.5, Student s t test with onferroni correction. : not significant. Figure S9 KLF4 deficient macrophage exhibit enhanced bactericidal activity. (A and ) KLF4-deficient macrophages exhibit enhanced bactericidal activity against S. aureus ex vivo. n=3 in each genotype. (C) NOX expression is augmented in KLF4 deficient macrophages after incubation with S. aureus. n=3 for each data point. p<.5, Student s t test with onferroni correction. Figure S Myeloid KLF4 deficiency does not affect bacterial uptake ability of macrophages. WT and KLF4-deficient macrophages take up similar amounts of K- E. coli bioparticles as revealed by fluorescent microscopy (A) and flow cytometry assay (). Image shown are representative from 3 sets of samples. Figure S Infiltration of macrophages in skin wound and in vitro migration assay of macrophages. (A) No difference is observed in the numbers of infiltrated macrophages in skin wound between and mice as analyzed by immunohistochemistry. n=3 in each group. () No difference in MCP- (CCL) induced migration between WT and KLF4-deficient macrophages as assessed by oyden chamber assay. n=3 in each group. : not significant as determined by Student s t test. Page 5 of 5

5 Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript RG- Figure S KLF and KLF4 expression levels in different human adipose tissues and KLF4 expression in different cells of adipose tissues. (A) Compared with subcutaneous fat, visceral fat has lower expression of KLF4 but not of KLF. Data represented were from 4 O patient samples. () KLF4 is predominantly expressed by macrophages in adipose tissue. Cells were isolated from 4 O patients. p<.5, Kruskal Wallis test. Figure S3 Metabolic changes in and mice after HFD. (A) Representative MRI images of body composition. () mice demonstrate higher level of total triglycerides in plasma (n=6 per genotype). (C and D) HDL and LDL levels in plasma remain similar between and after HFD. p<.5, Student s t test. : not significant. Figure S4 Food intakes and energy expenditure in and mice. (A) Food intake during a 4h period. () Respiration and heat production analysis. n=5 in each group. p<.5, Student s t test with onferroni correction. : not significant. Figure S5 Impaired insulin signaling in HFD-fed mice. Page 5 of 5

6 Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript RG- (A) Serum insulin levels in and mice. n=6 in each group. () aseline glucose tolerance test in and mice. n=6 in each group. (C) Impaired insulin signaling in mice after -week HFD as determined by phosphorylation of Akt. One animal in Saline group and two animals in Insulin-stimulated group were shown for each genotype.p<.5, Student s t test. Figure S6 Myeloid deficiency of KLF4 results in alteration of expression of select metabolic and inflammatory genes in HFD-fed mice. (A) Quadriceps muscle. () Liver tissue. n=6 per genotype. p value by Student s t test. Page 5 of 5

7 9% Cell Count Unstained control cells CD5 stained cells CD5 Figure S

8 A PM LPS (h) IFNγ (h) IL4 (h) IL3 (h) IL (h) MDM LPS (h) IFNγ (h) IL4 (h) IL3 (h) IL (h) C.5.5 PM with ng/ml LPS 4 6 Time (h) Figure S

9 A Tail DNA MФ DNA.5 PM C.5 MDM D 5bp KLF4+/+ KLF4+/+ KLF4F/+ KLF4F/+ KLF4F/F KLF4F/F KLF4+/+ KLF4+/+ KLF4F/F KLF4F/F excised floxed.5.5 KLF4 β-actin WT bp All mice in LysM cre/cre background Mye WT KO FL Mye Mye Mye E F Cell population (%) Monocyte population (%) K4 +/+ K4 -/- Figure S3

10 A C Ad-EV Ad-KLF4 IL4: Arg- β-actin enhancer region D IL4: PPARγ lucif erase activity (f old) Vector KLF4 Stat6 KLF4+Stat6 Ad-EV Ad-KLF ~4kb KLF# KLF# Stat6 Control IL4 IgG Arg- promoter activity (f old) Vector KLF4 Stat6 Vector KLF4 Stat6 Vector KLF4 Stat6 Vector KLF4 WT KLF# KLF# KLF#& Stat6 E input IL4 (h): 4 4 py-stat6 Stat6 Figure S4

11 A MCP- (pg/ml) 5 TNFα (pg/ml) Mac-WT Mac-KO 5 Control LPS Control LPS Figure S5

12 A C Cox- mrna level 5 WT Stat6 null 5 5 MCP- mrna level 4 WT Stat6 null RANTES mrna level WT Stat6 null Control LPS Control LPS Control LPS D E F TNFα mrna level WT Stat6 null Control LPS inos mrna level WT Stat6 null Control LPS [NO-] concentration (umol/l) WT Stat6 null Control LPS Figure S6

13 non-targeting PCR LPS: P65 PCAF P3 Input Figure S7

14 A inos mrna level (fold) TNFα mrna level (fold) IL4 6h pre-treatment LPS 6h treatment IL4 6h pre-treatment LPS 6h treatment C MCP- mrna level (fold) D RANTES mrna level (fold) IL4 6h pre-treatment LPS 6h treatment IL4 6h pre-treatment LPS 6h treatment Figure S8

15 A C Gram+ (S. aureus) CFU (S. aureus) per X 6 macrophages 45, 4, 35, 3, 5,, 5,, 5, NOX mrna level (fold) Figure S9

16 A Cell count no bacteria Alexa Fluor 488 (log) Figure S

17 A 5 5 Macrophage infiltration (cells/field) 4 3 MDM migration (cells/field) 4 3 Control MCP- Figure S

18 A mrna level (fold).5..5 Adipose tissue subcutaneous visceral KLF KLF4 (fold) Adipose tissue fractions Figure S

19 A C D Total Triglyceride (mg/dl) d HDL (mg/dl) 6 4 LDL (mg/dl) Figure S3

20 A 6 Chow Consumed (g) Total Light cycle Dark cycle Total Light cycle Dark cycle O consumption) (VO) (ml/kg/min) CO production (VCO) (ml/kg/min) Respiratory Quotient (RQ).9.8 Heat generation (Cal/h/kg) Dark Light.7 Figure S4

21 A Serum insulin level (ng/ml) lood glucose level (mg/dl) Saline Insulin Insulin Saline Insulin Insulin Time (min) C p-akt total-akt p-akt total-akt Muscle Liver Figure S5

22 A mrna level p=.54 p=.9 Quadriceps p=.9 p=. p=.56 p=.44 p=.5.4. mrna level Liver p=.7 p=. p=.77 p=.8.5 Figure S6