AMPLIFICATION AND SEQUENCING OF THE MITOCHONDRIAL GENOME OF THE BASAL ANIMAL CTENOPHORE MNEMIOPSIS LEIDYI

Transcription

1 AMPLIFICATION AND SEQUENCING OF THE MITOCHONDRIAL GENOME OF THE BASAL ANIMAL CTENOPHORE MNEMIOPSIS LEIDYI Nelson B. Lazaga Department of Geology and Geophysics University of Hawai i at Mānoa Honolulu, HI ABSTRACT The mitochondrial genome (mtdna) represents a model system for studying evolutionary genomics in metazoans because of unique features associated with mtdna including uniparental inheritance, orthologous genes, and lack of substantial intermolecular recombination. mtdna was successfully extracted from DNAzol preserved Ctenophore Mnemiopsis leidyi via similar preparatory steps used in a phenol chloroform ethanol precipitation extraction. However, the amplification of the complete genome of Ctenophore Mnemiopsis leidyi was unsuccessful. Once Ctenophore Mnemiopsis leidyi mtdna is successfully amplified, the information obtained by sequencing the mitochondrial genome of Ctenophore mnemiopsis would help in deciphering the phylogenetic order within the kingdom Metazoa. INTRODUCTION The origin of animals is a key evolutionary event in the history of life and ultimately resulted in intelligence. Early steps in the process of evolution can be inferred by phylogenetic trees which allow the reconstruction of ancestors and ancestral traits. Phylogenetic analysis based on gene data consistently shows five major groups within the kingdom Metazoa, also known as the kingdom Animalia. These five major groups include Bilateria, Cnidaria, Porifera, Ctenophora, and Placozoa. Due to conflicting genetic data that has been obtained thus far, the specific branching order of the groups has yet to be resolved. To try to resolve this issue, the method of comparative mitochondrial genomics was applied. Comparative mitochondrial genomics is becoming an effective tool to resolve phylogenetic placements because of several unique properties of mitochondrial genomes, including uniparental inheritance, orthologous genes, and lack of substantial intermolecular recombination. i In addition, mitochondrial genes / gene functions are highly conserved and are not confounded by recombination, which leads to homoplasies. Although mitochondrial genomes vary extensively in size, structure, and gene content across diverse eukaryotic groups; those of multicellular animals (Metazoa), however, are remarkably uniform. ii A surprising result of mitochondrial data place Placozoans at the base of the animal tree but also give anomalous results for other parts of the tree (Dellaporta et al. 2006). Furthermore, there is no data available for Ctenophores; the last major group without a sequenced mitochondrial genome. Therefore, the importance of this study was to amplify the mitochondrial genome of a species of Ctenophores, which would then be utilized for sequencing and ultimately comparative mitochondrial genomics. 39

2 METHODS Primer construction: Firstly, a fragment of the ATPase6 gene of Mnemiopsis leidyi mitochondrial DNA (mtdna) (M. Martindale, personal communication) was utilized to find primers that would be used for the amplification. The ATPase 6 gene sequence used to create the primers is as follows: TTTGAGCGTGATGTTGAGTTGCTCCAGAATTTTCCTTCGCCAGGGCCTAAGTACCGGAGCCCG CTCTCTGGCTGCCCCAATCCAGCTTACCAGCTACATCCACACCACTCACGTCAACAAGGACGAAACTG TTGCCTCCGGCGCTCTGATCGAGGCGGCTAAAGGAATGAGGGTGATTCCTACTAGGGGACAGGCTGCC AAGGAGAAACTCTACGGTTTTGTTCAAGACCTCTGTAAACAGAACCTAGGAGAGGAGGGCTACCGTTA TTTCCCCTTTGCTCTGGGTCTTTTTACTACAATCGGTTTCTGCAACGTCACCAACCTTCTACCTTACATT GAGATGCCCACACAGATTATCGGGTGTACGGTTGCCATGAGCACGACCCTTATCGCCGGACTTACTAT CAAGTGTATCGCCAAGCACAAGCTTGACTTCGCTTCTTTCTTCTTCCCTCCTGGGGCCCCTATTGGTCTG GCTCCTCTCCTTGTACCTGTCGAAACGATTTCCTTCTTCTCCCGAGCCGTCTCTCTCGGAGTTCGTCTGG GTGCCAACTTGACCGCCGGACACATGATCCTCCACATCATTTCCGATTTCGGCGCCCAAATGTTGGCAA GCGGAACTGTCGGCGGTGGAATCGGCGGTGTTCTCTGTACTGCCGCCCTCGTACCCGTCTGCATCCTCG AGATGGCTGTTGCTGTGGTCCAGGCTTATGTTTTCTGTATGTTGACCACGATGTACCTTAACGATGCCC ATGAGCTTCATTGAACAGACTAACTGATTAGCGGACCATTCTTAAATTATTCGTTTGAGATTGTTGTAT GATGATGTACTAATACTTCGACTTCGCTTTTGGTTATGTCGGCTCATTATTTTTTTAACGCATGAAAGG GATCATTTAGTTTCACAAAAAAAAAAAAAAAAA Two sets of primers were created via Primer 3. The first set of primers was used to amplify the ATPase6 gene to check if the extracted Mnemiopsis leidyi DNA samples contained mtdna (Figure 1.). The second set of primers was used in a long range PCR in hopes of amplifying the rest of the unknown regions of the Mnemiopsis leidyi mitochondrial genome. For the long range PCR instead of having the primers amplify a region within the known gene, the primers were oriented to face away from the gene as to amplify the rest of the unknown regions of Mnemiopsis leidyi mitochondrial DNA (Figure 2.). The primers were oriented to face outward as to assume that the genome is circular, as in the case for most, but not all, animals. This process is seen below: AMPLIFIED REGION Figure 1. Amplification of the region within ATPase6 gene of Mnemiopsis leidyi mitochondrial DNA. 40

3 Figure 2. Amplification of the region outside of the ATPase6 gene of Mnemiopsis leidyi mitochondrial DNA. As seen within both figures, the known ATPase6 gene of Mnemiopsis leidyi mitochondrial DNA is seen in bold while arrow heads indicate the direction of DNA, in black, and primers, in red. DNA extraction: Juvenile Ctenophore Mnemiopsis leidyi were kindly collected and provided by Dr. Mark Martindale s PhD student Kevin Pang. The juvenile Mnemiopsis leidyi were stored in DNAzol by Kevin Pang prior to receiving the specimens. Because Ctenophore mitochondrial DNA has not been amplified as the date of the project s submission, a specific protocol for extracting Ctenophore Mnemiopsis leidyi mitochondrial DNA was also unknown. In the attempt to extracting Mnemiopsis leidyi mitochondrial DNA two different genomic DNA extraction protocols were tested. The protocol provided by Dr. Eric Gaidos lab followed similar preparatory steps used in a phenol chloroform ethanol precipitation extraction. The protocol provided by Kevin Pang from Dr. Mark Martindale s lab was a DNAzol extraction protocol, where a biological sample is homogenized (or lysed) in DNAzol, and the DNA is precipitated with ethanol, washed and dissolved iii. Thus, DNAzol was used in hopes that the mitochondrial DNA enclosed within the membrane enclosed mitochondria would be released. The first protocol that was used was a protocol utilized by Dr. Eric Gaidos lab to extract Placozoan DNA (J. Ward, personal communication). Total genomic DNA was extracted from the DNAzol preserved Ctenophore Mnemiopsis leidyi. In step one, 450 μl of DNAzol preserved Ctenophore Mnemiopsis leidyi was added to an Eppendorf tube along with 12.5 μl of proteinase K (1 mg/ml). The added mixture was incubated at 50 o C overnight on a shaker. The next day, 500 μl of phenol:chloroform:isoamylalcohol (25:24:1) was added to the tubes containing the DNAzol preserved Ctenophore Mnemiopsis leidyi and proteinase K. The mixture was then vortexed for about 10 seconds, followed by centrifugation at max speed for 20 minutes. The top layer was added to a newly labeled Eppendorf tube and another 500 μl of phenol:chloroform:isoamyl alcohol (25:24:1) was added. The mixture was then votexed for about 10 seconds, followed by centrifugation at max speed for 10 minutes. The top layer was added to a newly labeled Eppendorf tube. Then 480 μl chloroform and 20 μl of isoamyl alcohol were added. The mixture was then votexed for about 10 seconds, followed by centrifugation at max speed for 2 minutes. After centrifugation, the top layer was added to a newly labeled Eppendorf tube where 1000 μl of 100% ethanol was added. The mixture was inverted a couple times and incubated at -80 o C for 1.5 hours. After 1.5 hours, the mixture was spun down at max 41

4 speed for 20 minutes. The supernatant was removed and the pellet was dried at room temperature until there was no remaining moisture. The pellet was then resuspended in the appropriate volume of Qiagen EB (elution buffer) or nanopure H 2 O. The samples were left overnight at 4 o C before using. The second protocol was provided by Kevin Pang from Dr. Mark Martindale s lab. The protocol was unsuccessful executed in extracting genomic DNA. First, 1 ml of DNAzol preserved Ctenophore Mnemiopsis leidyi was added to an Eppendorf tube with 5 μl Proteinase K at (1 mg/ml) and incubated at room temperature overnight. The next day, the sample was mixed via centrifugation at 10,000xg for 10 minutes. The supernatant was removed and transferred to a new Eppendorf tube, without getting any insoluble material. 500 μl of 100% ethanol was added and mixed by inverting. The mixture was then incubated at room temperature for 5 minutes. This was followed by centrifugation at 9,000xg for 5 minutes. A small white pellet should have been visible. In this case, a transparent gelatinous material was found at the bottom of the tube. The supernatant was removed and the transparent gelatinous material was washed with 1 ml of 70% ethanol. The sample was mixed via centrifugation at 5,000xg for 2 minutes. The supernatant was removed and washed again with 1 ml of 75% ethanol. The remaining ethanol was removed and the pellet was dried at room temperature until there was no remaining moisture. The pellet was then resuspended in the appropriate volume of EB (elution buffer) or nanopure H 2 O. The samples were left overnight at 4 o C before using. After preparation of Mnemiopsis leidyi DNA via the previously mentioned protocols, the samples were analyzed by the Hitachi Genespec Spectrophotometer for concentration and purity. The DNA extracted was then used as template in PCR amplifications. PCR reactions: The samples were then used in a Polymerase Chain Reaction (PCR) utilizing the primers that would amplify the known ATPase6 gene to identify if mitochondrial DNA (mtdna) was present in the samples. The expected amplified product band size, when visualized via gel electrophoresis, being 749 bp. The forward primer that was used was 5 - TTTGAGCGTGATGTTGAGTTGCDNA-3 and the reverse primer being 5 - CATCGTTAAGGTACATCGTGGTCA-3. DNA (1 ng) was amplified in a total volume of 25 μl containing 12.5 μl of Bio-rad iq SYBR Green supermix, and 2.5 μl of 5 μmol primers. Amplifications were performed in a Bio-rad MyiQ real-time PCR machine for 35 cycles. The 35 cycles consisted of, 30 s at 95 o C, 30 s at a gradient for the annealing temperature ranging from o C, and 30 s at 72 o C. The 35 cycles were preceded by 2 minutes at 95 o C and followed by 5 min at 72 o C. All products were visualized on a 1.2% agarose gel stained with ethidium bromide. Negative controls lacking Ctenophore Mnemiopsis leidyi DNA were included in PCR assays to monitor any possible contamination. The samples that contained mtdna were then subjected to a long range PCR using the Roche Expand 20 kb PLUS PCR System to try to amplify the unknown regions of mtdna. The forward primer that was used was 5 - CCCTCATTCCTTTAGCCGC-3 and the reverse primer being 5 - GGTTTCTGCAACGTCACCAACC-3. The manufacturer s recommended conditions for amplification were used. 42

5 RESULTS The DNA extracted using the protocol provided by Dr. Eric Gaido s lab are seen in Table 1. The DNAzol extraction protocol provided by Kevin Pang from Dr. Mark Martindale s lab was unsuccessful in collecting genomic DNA, and therefore was not tested for the presence of mtdna. The successfully extracted genomic Ctenophore Mnemiopsis leidyi DNA was then tested, via PCR, to see if mtdna was present by amplifying the ATPase6 gene. Samples at annealing temperatures 52 o C (Figure 3), 52.8 o C (Figure 4) are shown; annealing temperatures above 52.8 o C weren t successful in amplifying the ATPase6 gene. The samples that were successfully identified as having mitochondrial DNA were then tested using the Roche Expand 20 kb PLUS PCR System to try to amplify the unknown regions of mtdna (Figure 6). Table 1. Mnemiopsis Genomic DNA Concentrations and Ratios. Sample Concentration (ng/ul) Ratio The concentrations and ratios are indicative of genomic double stranded DNA, where a pure sample of double stranded DNA is about

6 Lane 1: 500 bp ladder Lane 2: sample 1 Lane 3: sample 2 Lane 4: sample 3 Lane 5: sample 4 Lane 6: sample 5 Lane 7: sample 6 Lane 8: sample 7 Lane 9: sample 8 Lane 10: sample 9 Lane 11: sample 10 Lane 12: sample 11 Lane 13: negative control Figure 3. Gel electrophoresis of amplified PCR products at an annealing temperature of 52 o C Lane 1: 500 bp ladder Lane 2: sample 1 Lane 3: sample 2 Lane 4: sample 3 Lane 5: sample 4 Lane 6: sample 5 Lane 7: sample 6 Lane 8: sample 7 Lane 9: sample 8 Lane 10: sample 9 Lane 11: sample 10 Lane 12: sample 11 Lane 13: negative control Figure 4. Gel electrophoresis of amplified products at an annealing temperature at 52.8 o C. 44

7 kb 23 kb Lane 1: hind3 lambda DNA ladder Lane 2: sample 1 Lane 3: sample 2 Lane 4: sample 3 Lane 5: sample 7 Lane 6: sample 9 Lane 7: sample 11 Lane 8: positive control Lane 9: 1:10 positive control dilution Lane 10: negative control Figure 5. Long range PCR gel electrophoresis. ANALYSIS AND DISCUSSION Samples 1 through 19 (Table 1) contained genomic DNA and therefore were tested for the presence of mitochondrial DNA. The samples were amplified via PCR utilizing primers that would amplify the ATPase6 gene of Ctenophore Mnemiopsis leidyi mitochondrial DNA. To visualize the amplification process, the samples were tested via gel electrophoresis, seen in Figures 3 and 4. Figure 3 shows a gel electrophoresis of a PCR at an annealing temperature of 52 o C. Here, amplified products are seen in lane 3 (sample 2), lane 8 (sample 7) and lane 10 (sample 9). The bands produced were slightly above the 500 bp band in lane 1, with the products having an expected band size of 749 bp. Figure 4 shows a gel electrophoresis of a PCR at an annealing temperature of 52.8 o C. An annealing temperature at 52.8 o C yielded similar results to an annealing temperature at 52 o C. Amplified products are seen in lane 3 (sample 2), lane 8 (sample 7) and lane 10 (sample 9). Samples that were positive and negative for Ctenophore Mnemiopsis leidyi mitochondrial DNA were then tested by long range PCR using the Roche Expand 20 kb PLUS PCR System to try to amplify the unknown regions of mtdna. The samples that tested negative for Ctenophore Mnemiopsis leidyi mitochondrial DNA were used as a negative control. After running the long range PCR, it was evident that the samples tested, lanes 2 through 7, were not amplified in the process. The positive control in lane 8 confirms that the contents of the Roche Expand 20 kb PLUS PCR System and the amplification process itself are working. The problem therefore lies in the suitability of the template mtdna being amplified. 45

8 CONCLUSION Mitochondrial DNA was successfully extracted from DNAzol preserved Ctenophore Mnemiopsis leidyi via similar preparatory steps used in a phenol chloroform ethanol precipitation extraction. The DNAzol protocol was unsuccessful in collecting genomic DNA and therefore was not tested for the presence of mitochondrial DNA. The DNA samples that contained the mitochondrial ATPase6 gene were then tested via the Roche Expand 20 kb PLUS PCR System to try to amplify the unknown regions of the Ctenophore Mnemiopsis leidyi mtdna. However, the amplification step of the unknown regions of Ctenophore Mnemiopsis leidyi mtdna was unsuccessful. A possible explanation for the unsuccessful amplification could be because the genome might be linear or have been linearized during extraction process. Another explanation could be that the genome is too large to be amplified. Thus, because the amplification of the unknown regions of the Ctenophore Mnemiopsis leidyi mtdna was unsuccessful, the project will be carried on by another member of Dr. Eric Gaidos lab at this stage. ACKNOWLEDGMENTS The author would like to thank NASA and the Hawai i Space Grant Consortium. A special thank you to Dr. Eric Gaidos for providing guidance and mentoring throughout this semester s experience. The author would also like to thank Dr. Mark Martindale and Kevin Pang for providing the Ctenophore Mnemiopsis leidyi used in the study. Last but not least, post doc Gayle Philip and graduate student Jillian Ward for their added knowledge and support. i Dellaporta, S.L., Xu, A., Sagasser, S., Jakob, W., Moreno, M.A., Buss, L.W., Schierwater, B Mitocondrial genome of Trichoplax adhaerens supports Placozoa as the basal lower metazoan phylum. Proc. Natl. Acad. Sci. USA 103, ii Lang, B.F., Gray, M.W., Burger, G Mitochondrial genome evolution and the origin of eukaryotes. Annu. Rev. Genet. 33, iii Chomczynski, P., Mackey, K., Drews, R., Wilfinger, W DNAzol: a reagent for the rapid isolation of genomic DNA. Biotechniques. Mar;22(3):