Supporting Information

Transcription

1 Supporting Information Wiley-VCH Weinheim, Germany Pyrene-Excimer Probes Based on the Hybridization Chain Reaction for the Detection of Nucleic Acids in Complex Biological Fluids** Jin Huang, Yanrong Wu, Yan Chen, Zhi Zhu, Xiaohai Yang, Chaoyong James Yang,* Kemin Wang,* and Weihong Tan* anie_ _sm_miscellaneous_information.pdf

2 Reagents: The sequences of oligonucleotides and pyrene labeled probes are listed in Table S1. DNA synthesis reagents were purchased from Glen Research (Sterling, VA). The succinimidyl ester of 1- pyrenebutanoic acid was purchased from Molecular Probes (Oregon, USA). A solution of 0.1 M triethylamine acetate (ph 6.5) was used as HPLC buffer A, and HPLC-grade acetonitrile (Fisher) was used as HPLC buffer B. 1 SPSC buffer (1 M NaCl, 50 mm Na 2 HPO 4 ; ph 7.5) was used for all reactions. Except for the cell media, ultrapure water was used to prepare all of the solutions. The cell medium, DMEM (Mediatech, Herndon, VA) supplemented with 10% fetal bovine serum (Invitrogen), was used for the detection of DNA in the biological samples. Instruments: An ABI 3400 DNA/RNA synthesizer (Applied Bio-systems) was used for DNA synthesis. Probe purification was performed with a ProStar HPLC (Varian) equipped with a C18 column (Econosil, 5U, mm) from Alltech Associates. UV-Vis measurements were performed with a Cary Bio- 100 UV/vis spectrometer (Varian) for probe quantitation. Steady-state fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon, Edison, NJ) with temperaturecontroller set to 22 ºC, using a quartz fluorescence cell with an optical path length of 1.0 cm. The excitation was made at 340 nm with recording emission range of nm. All excitaion and emission slits were set at 5 nm. Time-resolved measurements were made on a Fluo Time 100-Compact Fluorescence lifetime spectrometer (PicoQuant, Germany), where a pulsed diode laser (PDL 800-B) was used as the excitation source (λ= 355 nm), photo counting instrumentation (PicoHarp 300) was used as a readout. Synthesis and Purification: Amine-modified DNA probe was synthesized using standard phosphoramidite chemistry and probes were purified using reversed phase HPLC. The purified DNAs were conjugated with the pyrene at the amino end by overnight incubation in 0.1 M sodium bicarbonate/sodium carbonate buffer (ph 8.5) mixed with a 15-fold excess of the succinimidyl ester of 1- pyrene butanoic acid dissolved in dimethyl sulfoxide (DMSO). The unconjugated pyrene was removed by ethanol precipitation of DNA, repeated three times. The resulting crude mixture was separated by HPLC using a linear elution gradient with buffer B changing from 25% to 75% in 25min at a flow rate of 1ml/min. The last peak in chromatography that absorbed at 260 and 350 nm was collected as the product. The collected product was then vacuum-dried, desalted with an NAPTM-5 column (GE, Healthcare), and stored at -20 ºC for future use. The following figure is the HPLC result. Native Gel Electrophoresis: H1* and H2* were heated to 95 ºC for 2min and then allowed to cool to room temperature for 1 h before use. Different concentration of target DNA were incubated overnight with 1 µm each H1* and H2*. A 10% native polyacrylamide gel was prepared using 1 TBE buffer (89

3 mm Tris Borate, 2.0 mm Na 2 EDTA, ph 8.3). The gel was run at 100 V for 60 min in 1 TBE buffer, stained for 30 min in a Stains All solution (500 ml formamide, 100ml 10 TBE, 400 ml H 2 O, 200 mg Stains All), then illuminated with white light until the stained band appeared, and finally photographed with a digital camera. Detection Procedure: After testing various conditions, the following procedure was used to study the concentration-dependent changes in fluorescence experiments: Each hairpin probe was heated to 95 ºC for 2min and then allowed to cool to room temperature for 1 h before use. Then different concentrations of target DNA were incubated with 500 nm H1* and H2* in 1 SPSC buffer (1 M NaCl, 50 mm Na 2 HPO 4 ; ph 7.5). The total volume of reaction solution is 100 µl. Subsequently, the time-dependent incubation process was monitored by spectrofluorometer at room temperature Table S1. Sequence used in the HCR detection system Name Sequence (from 5 to 3 ) H1 TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTG H2 AGTCTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACTACTTTG H1 TTAACCCACGCCGAATCCTAGACT[(CH 2 ) 6 Py]CAAAGTAGTCTAGGATTCGGCGTG H2 Py-(CH 2 ) 6 AGTCTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACTACTTTG H1* Py-(CH 2 ) 6 TTAACCCACGCCGAATCCTAGACTCAAAGTAGTCTAGGATTCGGCGTG-(CH 2 ) 6 -Py H2* Py-(CH 2 ) 6 AGTCTAGGATTCGGCGTGGGTTAACACGCCGAATCCTAGACTACTTTG-(CH 2 ) 6 -Py T (matched) T (mismatched) T(deleted) T(inserted) AGTCTAGGATTCGGCGTGGGTTAA AGTCTAGGATTCAGCGTGGGTTAA AGTCTAGGATTC_GCGTGGGTTAA AGTCTAGGATTC[T]GGCGTGGGTTAA The design of the hairpin probes was adapted from the literature [1]. In the hairpin sequences, loops are italicized and sticky ends are underlined. Figure S2. Comparison of the effect of pyrene label position methods by steady-state fluorescence measurement. [Hairpin probes] = 500 nm, [T] = 100 nm, λ Ex = 340 nm. (1) H1 and H2 ; (2) H1 and H2*; (3) H1* and H2*. The inset illustrates the different pyrene label positions in the propagating DNA polymer. From the results, no excimer signal was observed using T with H 1 and H 2, but maximal excimer signal was observed using T with H 1 * and H 2 *. Lack of excimer formation when the pyrene pairs are located at the middle of the H1 segment may be caused by the twin-screw conformation of the DNA double-helix, which may prevent two pyrene molecules from being properly oriented. Comparing curves 2 and 3, it is clear that doubling the number of pyrene excimers increases the fluorescence signal. Based on these results, H 1 * and H 2 * were chosen as the HCR probes for subsequent studies.

4 Figure S3. Figure 1. Polyacrylamide gel demonstrates amplification of different concentrations of target DNA recognition (lane 1: 1 µm H1*; lane 2: 1 µm H1* and 1 µm H2*; lane 3: 1 µm H1* + 1 µm H2* µm T; lane 4: 1 µm H1* + 1 µm H2* µm T; lane 5: 1 µm H1* + 1 µm H2* µm T; lane 6: 1 µm H1* + 1 µm H2* µm T; lane 7: DNA ladder). Lanes 3-6 correspond to four different concentrations of target (0.5, 0.25, 0.1, and 0.05 µm) in a 1 µm mixture of H1* and H2*. Lanes 1, 2 and 7 correspond to H1* only, a mixture of H1* and H2* without T, and DNA ladders with 50-bp and 500-bp increments, respectively. Figure S4. Visual detection of target after illumination with a UV lamp. Solution of 500 nm of each HCR probe incubated without (Left) or with (Right) 1 nm DNA target for 1 hour at room temperature. Figure S5. Real-time monitoring of fluorescence intensities of HCR probes at 485 nm over a range of target DNA concentrations. The target concentrations in curves from top to bottom are 4, 0.04, 0.004, and 0 nm, respectively. [H1*] = [H2*] = 500 nm, λ Ex =340 nm.

5 Counts Figure S6. The fluorescence ratio of excimer (λ=485 nm) over monomer (λ=375 nm) as a function of target DNA concentration. The inset denotes the low concentration of target. [H1*] = [H2*] = 500 nm, λ Ex = 340 nm nm 50 nm 10 nm 0 serum Time (ns) Figure S7. Fluorescence decays (485 nm) of 500 nm HCR probes in 20% human serum with various concentrations of target DNA. Because there are many fluorescent species in the solution. The Decay Kinetics can be described by multiexponetial equation:[2,3] where α 1 is the background fluorescence intensity at time t = 0, τ 1 is the lifetime of background (including all other fluorescent molecules except pyren); α 2 is the pyrene fluorescence intensity at time t = 0 and τ 2 is the lifetime of pyrene. So the equation was used to fit the Figure S7. The results are shown as following:

6

7

8 Matter τ 1 (standard error) τ 2 (standard error) Serum + probes nm target 3.51 (0.009) (0.042) Serum + probes + 50 nm target 2.32 (0.006) (0.033) Serum + probes + 10 nm target 1.72 (0.004) (0.031) Serum + probes 1.50 (0.003) (0.026) Serum 1.39 (0.002) 8.76 (0.019) The data were calculated by Origin Pro.8.1 software. τ 1 and τ 2 are the lifetime of background and pyrene, respectively.

9 Normalized Decay Area ( ns) 8 6 Equation y = a + b*x Adj. R-Square Value Standard Error B Intercept B Slope Concentration of target DNA in Serum Figure S8. The response of normalized decay area ( ns) was caculated for each concentration of target DNA in human serum. [1] R. M. Dirks, N. A. Pierce, Proc. Natl. Acad. Sci. USA. 2004, 101, [2] E. Kuwana, E. M. Sevick-Muraca, Biophys J. 2002, 83(2), [3] Schmidt, W. Optical Spectroscopy in Chemistry and Life Sciences, WILEY-VCH. Germany