Supporting Information

Transcription

1 Supporting Information Risser and Callahan /pnas SI Text Plasmid Construction. Plasmid pdr211 is a mobilizable shuttle vector containing P pete -pats. A fragment containing P pete was amplified via PCR using primers Xho-Bam-PpetE-F and PpetE- Nde-Pst-R, cloned into pgem-t (Promega), and subsequently moved into pbluescript (SK ) (Stratagene) as a XhoI-PstI fragment. A fragment containing the pats gene was amplified using primers pats-ndei-f and pats-sali-spei-r, cloned into pgem-t, and subsequently cloned into pbluescript (SK ) containing P pete as an NdeI-SpeI fragment. P pete -pats was then moved into pam504 (1) as a BamHI-SacI fragment to create pdr211. Plasmid pdr292 is a mobilizable shuttle vector used to express recombinant HetR-GFP in E. coli. A fragment containing P hetr -hetr was amplified via PCR using primers PhetR- BamHI-F and hetr-smai-r and cloned into psmc232 (2) as a BamHI-SmaI fragment to create pdr292. Plasmid pdr306 is a mobilizable shuttle vector containing P pete -hetr(h69y)-gfp. A fragment containing P pete -hetr(h69y) was amplified from plasmid pdr293 using overlap extension PCR (3) with the primers PpetE-BamHI-F, hetr-h69y-f, hetr-h69y-r, and hetr-smai-r, and cloned into psmc232 as a BamHI-SmaI fragment to create pdr306. Plasmid pdr320 is a mobilizable shuttle vector containing P pete -hetn. A fragment containing P pete -hetn was amplified from chromosomal DNA of Anabaena strain 7120PN (4) with primers PpetE-BamHI-F and hetn-saci-r and cloned into pam504 as a BamHI-SacI fragment to create pdr320. Plamsid pdr321 is a mobilizable shuttle vector containing P pete -hetn(s134d, G135A). A fragment containing P pete - hetn(s134d, G135A) was amplified from chromosomal DNA of 7120PN via overlap extension PCR using primers PpetE- BamHI-F, hetn-gs134 5SD-F, hetn-gs134 5SD-R, and hetn-saci-r, and cloned into pam504 as a BamHI-SacI fragment to create pdr321. Plasmid pdr327 is a suicide vector used to replace the chromosomal hetr-locus with P pete -hetr-gfp. A 3,605-bp fragment starting 1,691-bp upstream and ending 1,014-bp downstream of the hetr-coding region was amplified via PCR using PCC 7120 chromosomal DNA as template with the primers hetr5 for and hetr-chr-saci-r and cloned into prl277 (5) as a BglII-SacI fragment using restriction sites introduced on the primers to create pdr325. A fragment containing P pete -hetr-gfp was amplified via PCR from pdr293 (2) using primers PpetE- NcoI-F and gfp-spei-r and cloned into pdr325 as a NcoI-SpeI partial digest fragment to create pdr327. Plasmid pdr346 is a suicide vector used to delete cleanly the pats coding region. A fragment from psmc147 (6) was cloned into prl277 as a BglII-SacI fragment to create pdr346. Plasmid pdr348 is a suicide vector used to delete cleanly the hetn coding region. A fragment from the pgem-t (Promega) intermediate used in the construction of psmc182 (6) was cloned into pbluescript (SK ) (Stratagene) as a SacI-KspI fragment and subsequently cloned into prl277 as a XhoI-SacI fragment to create pdr348. Plasmid pdr355 is a suicide vector used to replace the chromosomal hetr locus with P pete -hetr(s179n)-gfp. pdr117 was created as previously described for pdr120 (7), with the exception that hetr was amplified from Anabaena strain 216 (8) chromosomal DNA. A fragment containing P pete -hetr(s179n) was amplified via PCR from pdr117 using primers PpetE- BamHI-F and hetr-smai-r and cloned into psmc232 as a BamHI-SmaI fragment to create pdr295. A fragment containing P pete -hetr(s179n)-gfp was amplified via PCR from plasmid pdr295 using primers PpetE-NcoI-F and gfp-spei-r and cloned into pdr325 as a NcoI-SpeI partial digest fragment to create pdr355. Plasmid pdr377 is a suicide vector used to replace the chromosomal hetr locus with P pete -hetr. A fragment containing P pete -hetr was amplified via PCR from pdr293 using primers PpetE-NcoI-F and hetr-spei-r and cloned into pdr325 as a NcoI-SpeI fragment to create pdr377. Plasmid pdr383 is a suicide vector used to integrate P pete -gfp into the chromosomal hetr locus. A fragment containing P pete - gfp was amplified via PCR from plasmid psmc138 (2) using primers PpetE-NcoI-F and gfp-spei-r and cloned into pdr325 as a NcoI-SpeI partial digest fragment to create pdr383. Plasmids pdr395 and pdr396 are mobilizable shuttle vectors containing P pete -pats or P pete -hetn, respectively, along with P nir -gfp, used in construction of mosaic filaments. A fragment containing P nir -gfp was amplified using pdr324 as template and the primers Pnir-BamHI-F and gfp-bamhi-r and cloned into pdr211 or pdr320 as a BamHI partial digest fragment to create pdr395 and pdr396, respectively. Strain Construction. Clean deletion or replacement of chromosomal DNA was performed as previously described (6) with the following combinations of strains and plasmids: PCC 7120 and pdr377 for P pete -hetr; UHM109 (9) and pdr327 for construction of pata, P pete -hetr-gfp; UHM109 and pdr377 for construction of pata, P pete -hetr; UHM103 (6) and pdr327 for P pete -hetr-gfp; UHM103 and pdr355 for P pete -hetr(s179n)-gfp; UHM132 and pdr327 for hetf, P pete -hetr-gfp. For strain hetr, pats, hetn plasmid pdr348 was introduced into UHM103 to create hetr, hetn. pdr346 was then introduced into hetr, hetn to create hetr, pats, and hetn. For strain pata, P pete -gfp pdr383 was introduced into UHM101 (6) and maintained as a single recombinant with the plasmid integrated at the hetr locus. For all strains constructed, PCR with primers that anneal outside of the region of PCC 7120 DNA used on the plasmid for strain construction was performed, and the size of the various PCR products was used to confirm the presence of the mutation. Construction of mosaic filaments was performed as previously described by conjugal transfer of pdr395 or pdr396 into P pete -hetr(s179n)-gfp (2). 1. Wei T-F, Ramasubramanian R, Golden JW (1994) Anabaena sp. strain PCC 7120 ntca gene required for growth on nitrate and heterocyst development. J Bacteriol 176: Risser DD, Callahan SM (2008) HetF and PatA control levels of HetR in Anabaena sp. strain PCC J Bacteriol 190: Higuchi R, Krummel B, Saiki RK (1988) A general method of in vitro preparation and specific mutagenesis of DNA fragments: Study of protein and DNA interactions. Nucleic Acids Res 16: Callahan SM, Buikema WJ (2001) The role of HetN in maintenance of the heterocyst pattern in Anabaena sp. PCC Mol Microbiol 40: Black TA, Cai Y, Wolk CP (1993) Spatial expression and autoregulation of hetr, a gene involved in the control of heterocyst development in Anabaena. Mol Microbiol 9: Borthakur PB, Orozco CC, Young-Robbins SS, Haselkorn R, Callahan SM (2005) Inactivation of pats and hetn causes lethal levels of heterocyst differentiation in the filamentous cyanobacterium Anabaena sp. PCC Mol Microbiol 57: of6

2 7. Nayar AS, Yamaura H, Rajagopalan R, Risser DD, Callahan SM (2007) FraG is necessary for filament integrity and heterocyst maturation in the cyanobacterium Anabaena sp. strain PCC Microbiology 153: Buikema WJ, Haselkorn R (1991) Characterization of a gene controlling heterocyst development in the cyanobacterium Anabaena Genes Dev 5: Orozco CC, Risser DD, Callahan SM (2006) Epistasis analysis of four genes from Anabaena sp. strain PCC 7120 suggests a connection between PatA and PatS in heterocyst pattern formation. J Bacteriol 188: of6

3 Fig. S1. Light (left panels) and fluorescence (right panels) micrographs of strain pata, P pete -gfp grown in BG-11 medium supplemented with 3 M copper without the addition of RGSGR peptide (A) and 3 h after the addition of RGSGR peptide to a concentration of 2 M (B). 3of6

4 Fig. S2. Western blot analysis (as described in Fig. 3 with the exception that 25 g total protein were loaded) of strains overexpressing lacz, pats,orhetn (as indicated). 4of6

5 Table S1. Strains and plasmids used in this study Relevant Characteristic(s) Source or ref. Strain Anabaena sp. strain PCC 7120 Wild type Pasteur culture collection P pete -hetr PCC 7120 with the chromosomal P hetr replaced by P pete pata, P hetr -hetr-gfp pata-deletion strain with chromosomal allele of hetr replaced by hetr-gfp pata, P pete -hetr-gfp pata-deletion strain with chromosomal P hetr -hetr replaced by P pete -hetr-gfp pata, P hetr -gfp pata-deletion strain with P hetr -gfp integrated into the chromosome at the hetr locus pata, P pete -gfp pata-deletion strain with P pete -gfp integrated into the chromosome at the hetr locus pata, P pete -hetr pata-deletion strain with chromosomal P hetr -hetr replaced by P pete -hetr P pete -hetr-gfp Anabaena sp. strain PCC 7120 with chromosomal P hetr -hetr replaced by P pete -hetr-gfp P pete -hetr(s179n)-gfp Anabaena sp. strain PCC 7120 with chromosomal P hetr -hetr replaced by P pete -hetr(s179n)-gfp hetf, P pete -hetr-gfp hetf-deletion strain with chromosomal P hetr -hetr replaced by P pete -hetr-gfp hetr hetr-deletion strain 1 hetr, pats, hetn hetr-, pats-, hetn-deletion strain Plasmids pdr211 Mobilizable shuttle vector carrying P pete -pats pdr292 Mobilizable shuttle vector carrying P hetr -hetr-gfp pdr306 Mobilizable shuttle vector carrying P pete -hetr(h69y)-gfp pdr327 Suicide vector carrying P pete -hetr-gfp pdr320 Mobilizable shuttle vector carrying P pete -hetn pdr321 Mobilizable shuttle vector carrying P pete -hetn(rgdar) pdr346 Suicide vector for deletion of pats pdr348 Suicide vector for deletion of hetn pdr350 Mobilizable shuttle vector carrying P pete -lacz 2 pdr355 Suicide vector carrying P pete -hetr(s179n)-gfp pdr377 Suicide vector carrying P pete -hetr pdr383 Suicide vector carrying P pete -gfp pdr395 Mobilizable shuttle vector carrying P pete -pats, and P nir -gfp pdr396 Mobilizable shuttle vector carrying P pete -hetn, and P nir -gfp 1. Borthakur PB, Orozco CC, Young-Robbins SS, Haselkorn R, Callahan SM (2005) Inactivation of pats and hetn causes lethal levels of heterocyst differentiation in the filamentous cyanobacterium Anabaena sp. PCC Mol. Microbiol. 57: Risser DD, Callahan SM (2008) HetF and PatA control levels of HetR in Anabaena sp. strain PCC J. Bacteriol. 190: of6

6 Table S2. Oligonucleotides used in this study Primer hetr5 for hetr-chr-saci-r PhetR-BamHI-F hetr-smai-r PpetE-NcoI-F gfp-spei-r TNL-GFP-R hetr-spei-r PpetE-BamHI-F hetr-h69y-f hetr-h69y-r Xho-Bam-PpetE-F PpetE-Nde-Pst-R pats-ndei-f pats-sali-spei-r hetn-saci-r hetn-gs134 5SD-F hetn-gs134 5SD-R Pnir-BamHI-F gfp-bamhi-r Oligonucleotide sequence 5 3 TTTAGATCTGCTGTCGTTCTCAGCCACAGAGATTTGTCC ATATAGAGCTCATGTCTTGGCTCAGTCGCGGATGATGG ATATAGGATCCAACCCTTATGACAAAGGAC ATATACCCGGGAATCTTCTTTTCTACCAAACACC ATATACCATGGCTGAGGTACTGAGTACACAG ATATAACTAGTTTATTTGTATAGTTCATCCATGCCATG ACAGAGCTCTTATTTGTATAGTTCATCCATGCCATG ATATAACTAGTTTAATCTTCTTTTCTACCAAACACC ATATAGGATCCCTGAGGTACTGAGTACACAG GACATTTGCACTATCTAGAGCCAAAACGGGTC GTTTTGGCTCTAGATAGTGCAAATGTCCGGTCATCC TATATCTCGAGGGATCCGCTGAGGTACTGAGTACACAGC ATATACTGCAGCATATGGTTCTCCTAACCTGTAGTTTTATTTTTC CATATGAAGGCAATTATGTTAGTGAATTTCTGTGATGAG ACTAGTGTCGACCTATCTACCACTACCGCGCTCATCACAG ATATAGAGCTCTCATGAGCGATGAGACTCAAC GATGGAACGCAGTGATGGTCGGATTGTCAATATTGCTTC CAATCCGACCATCACTGCGTTCCATCATGCTGGGTAG GCGCGCGGATCCAGCTACTCATTAGTTAAGTGTAATG ATATAGGATCCTTATTTGTATAGTTCATCCATGC 6of6