Linköpings Universitet. Site-directed mutagenesis of proteins

Transcription

1 IFM/Kemi August2011/LGM Linköpings Universitet Site-directed mutagenesis of proteins

2 Competent E. coli cells Site-specific mutagenesis Analysis on agarose gel Transformation of plasmids in E. coli Preparation of plasmids Analysis of plasmids on agarose gel DNA sequencing Analysis of DNA sequences, transformation of mutant variants Figure1. Schedule of the site-specific mutagenesis lab exercise..

3 Site-specific mutagenesis Introduction In vitro site-specific mutagenesis is an invaluable technique for e.g study the correlation between protein structure and function or modification of vectors for cloning purposes Over the last decade there has been a number of efficient and reliable means of creating location-specific mutations in DNA using synthetic oligonucleotides. In this course we will make use of a relatively new method called "Quik-change sitedirected mutagenesis kit commercialized by Stratagene. The main advantage of this method is that it does not require single-stranded DNA (ss- DNA), this results in elimination of subconing steps in M13 based bacteriophages to obtain single-stranded DNA (ss-dna). In addition, this method requires no specialized vectors or unique restriction sites but you can basically use any double stranded plasmid. This method is based on the use of the enzyme Pfu Turbo DNA polymerase II. This is a heat-resistant DNA polymerase that replicates both DNA strands with great accuracy without displacing the mutant oligonucleotide. In this mutagenesis method a double-plasmid vector with a gene to be modified is used. Using two synthetic oligonucleotide "primers", each complementary to one of the DNA strands of the vector with mismatches corresponding to the desired mutation. The DNA strands are extended DNA during temperature cycles (PCR) using (Figure 2). The extension of the DNA strands gives a "nicked" DNA and after the temperature cycle the sample is treated with the enzyme DpnI endonukleas. The enzyme DpnI endonukleas is specific for methylated and hemimetylerat DNA and used to break down the original DNA strand and select for the mutant containing DNA strand. Nearly all the DNA isolated from E. coli is methylated and therefore available for degradation with DpnI.

4 Fig Figure. 2 Schematic drawing of the Quikchange metoden

5 Fatty acid binding protein (FABP) Bakgrund: Fatty acid binding protein (FABP) is a cytosolic protein that transports various fatty acids. To study this protein, we cloned FABP from a desert ant, and can express the protein in E. coli. This protein consists of 134 amino acids with a His-Tag construction of 20 amino acids to facilitate purification of the protein (see the appendix for the construction of the clone). A common way of studying proteins is the use of a spectroscopic method such as tryptophan fluorescence. One difficulty in studying FABP from desert ant is that it lacks the tryptophan to be used as spectroscopic probes. With the help of location-specific, we will achieve three different variants of FABP an amino acid tryptophan is introduced at various positions in the protein. In order to find suitable positions for the Trp's, we have used the "threading", where the three dimensional structure of FABP from rat was used as a template. Figure 3. Aligned simulated structure of FABP from Desert ant (lightblue) and FABP from rat (green). Illustrated side chains are the positions (red) and corresponding amino acids in FABP from rat (blue).

6 Materiel: Site-specific mutagenesis Double stranded plasmid (~10 ng) Mutagenesis primer (forward) Mutagenesis primer (reverse) Controll plasmid, pwhitescript (4.5 kb, 10 ng/ul) Controll primer (forward) Controllprimer (reverse) 10x Reaction buffer Pfu Turbo DNA polymerase DpnI restriction enzyme dntp mix Sterile water Autoclaved PCR-tubes In a PCR-tube add: Sample: 2.5 µl 10x reaction buffer 1 µl (10ng) double stranded plasmid 1 µl Mutagenesis primer (forward) 1 µl Mutagenesis primer (Reverse) 0.5 µl dntp mix Sterile water to a final volume of 25µl

7 Finally, add0.5µl Pfu Turbo DNA Polymerase (2.5U/µl). Mix by centrifugation a few seconds. Controll: (only 1 controll/labgroup) 2.5µl 10x reaktion buffer 1µl (10ng) pwhitescript (Controll plasmid) 0.6 µl Controll primer (forward) 0.6µl Controll primer (reverse) 0.5µl dntp mix Sterile water to a final volume of 25µl Finally, add 0.5µl Pfu Turbo DNA Polymerase (2.5U/µl) Mix by centrifugation a few seconds. 1) Put the PCR tube(s) in a PCR machine and set following temperature cycle: 95 C (30 seconds).55 C (1 minute).68 C (6 minutes) To be repeated 16 times. Note! Temperature and times are approxiamtions depending on the type of vector. (Labassistant decide what cycle that should be used) 2) When the PCR cycle is finished, SAVE 5µl for analysis on an agarose gel in a new eppendorf tube. 3) To the rest of the mixture. Add 0.5µl DpnI restrictionsenzyme, Mix by centrifugation a few seconds. Incubate 1 hour at 37 C. 4) The samples are now ready for transformation and the remaining of the samples will be stored at -20 C.

8 Further readings: Mutagenesis: Gene Cloning and DNA analysis(6th edition)sid: Stratagene Quikchange Site-Directed Mutagenesis Kit, Instruction manual

9 Transformation of plasmid after Site-specifik mutagenesis Material: Agarplates with Kanamycin or Ampicillin NZY+ Broth (Or LB-medium) IPTG X-Gal Sample1 after site-specifik mutagenesis Controll after site-specifik mutagenesis Transformationskontroll, puc18 Epicurian Coli XL1-Blue supercompetent cells 1) Thaw the super-competent XL1-blue cells portioned in 20µl's portions for Sample 1 (and Control and/or transformation control) 2) To each 20µl's portion of the super-competent cells are added to 1µl of Sample1, control or transformation control. 3) Mix gently with pipette tip and incubate on ice for 30 minutes. 4) "Heat shock" the cells by placing the tubes in heating block 45 seconds at 42 C; then place the tubes on ice for 2 minutes. 5) To the cells, add 100µl of preheated (42 C) NZY + Broth culture medium (or LB medium) and incubate the transformation reaction 1 hour at 37 C. 6) Spread 100 µl of transformation reaction of Sample1 on agar-kanamycin plates. Note for control and puc18 transformationskontroll treat the agar plates as follows Add 20µl 10% (w / v) X-gal and IPTG to 100mM 20µl 100µl NZY + Broth culture medium (or LB medium) and spread on the agar plate and let dry 37 C 30 minutes before the transformation.

10 7) The day after the transformation (approximately 16 hours) check the transformation rate. Count number of colonies on the agar media. 8) Pick ~12 colonies and transfer to a grid on an agar plate. 9) All agar plates are stored in cold room wrapped in parafilm. Further reading Competent cell and transformation Gene Cloning and DNA analysis(6th edition)sid: 72-79

11 Preparation af plasmids Material: 25 ml Culture tubes LB-medium Kanamycin (stock solution) Qiaprep spin column kit Autoclaved eppendorf tubes and pipette tips Sterile water Preparation of plasmid For preparation of plasmid, a complete "kit" to be used (QiaPrep spinnkit). This "kit" is based on plasmid DNA purified on a mini-column where the DNA is bound up in a silicagel. The day before plasmid preparation an overnight cultures of E. coli with the desired plasmid is prepared. Cultivation flasks containing 10ml culture medium and Kanamycin. Added to this has been a bacterial colony containing the desired plasmid, from an LB- Kanamycin plate from a previous transformation. The cultures are allowed to grow over night at 37 C with shaking. The plasmid prepared on this course will be used for similar exercises in other courses later on! 1) Each group fills two 1.5 ml eppendorfrör with overnight culture of E. coli with the plasmid that you want to prepare. 2) Centrifuge in table top centrifuge 10,000 rpm for 5 min 3) Suction of all supernatant with Pasteur pipette or decant. 4) Resuspend the pellet in a total of 250 µl (125 µl of each epp.rör) Buffer 1. Dissolve the cells completely and bring together the two tubes into one. 5) Set to 250 µl buffer 2 6) Mix by inverting the tube a few times, the cell suspension should clear up almost immediately. 7) Add 350 µl buffer N3 and mix immediately by inverting the tube a few times. It will form white "clouds" in the pipe. 8) Centrifuge at 13,000 rpm for 10 minutes to collect the cloud on the pipe wall. 9) Decant the supernatant into the column.(it is also possible to use a pipette with a sterile pipette to transfer the supernatant.) Ensure that the column sits in a plastic tube. 10) Centrifuge at rpm for 1 minute.

12 11) Add 750µl PE buffer and centrifuge 13,000 rpm 1 min. 12) Pour off the buffer from the tube and centrifuge again. 13) Transfer the column to a clean (sterile) eppendorfrör. 14) Add 50 µl H 2 O. 15) Centrifuge 13,000 rpm 1 min. The plasmid is now eluted in the eppendorf tube.

13 Agarosgelelektrofores 1) In a 250 ml bottle is added g agarose and 10ml 10x TBE buffer and diluted with water to total volume of 100ml. 2) Heat the agarose gel until it is completely liquid in a microwave. Let the mixture cool for a while (about 60oC) and pour agarose gel. Allow the gel to cool for at least 30 minutes. Electrophoretic separation of DNA 1) Mix 4 µl loading buffer with 5 µl DNA and 11 µl H 2 O. 2) Add 5 µl premixed molecular weight marker 3) Add agarose gel in electrophoresis apparatus and fill with 1X TBE buffer to cover gel. 4) Apply gently and slowly the samples in sample wells with a pipette 5) Separate the DNA fragments by applying a voltage ~ 100 Volts. Remember that DNA is negatively charged. 6) When the blue marker has reached about 2 / 3 down the gel is interrupted electrophoresis and DNA fragments stained with ethidium bromide. Ethidium Bromide as intercalated with DNA can be seen by the gel is illuminated with nm light at a transluminator. Protect your eyes by using safety glasses and wear gloves when working with Ethidium Bromide. 7) Photograph of the gel and estimate the amount of DNA you have received. Furher readings: T.A Brown Gene Cloning and DNA analysis, 6 th edition, sid 56-62

14 Appendix Primers for mutagenesis of FABP: F42W_forward: 5'-gtagcgaaaatttcgacgattggatgaaggcactcggcgtag-3' F42W_reverse: 5'-ctacgccgagtgccttcatccaatcgtcgaaattttcgctac-3' F80W_forward: 5'-gtatactctaaagacgactagtacctggaaaaacacggaaataaaattcaaact-3' F80W_reverse: 5'-agtttgaattttatttccgtgtttttccaggtactagtcgtctttagagtatac-3' V98W_forward: 5'-gaagaattcgatgaagacacctgggacggtagaaaagtgaagag-3' V98W_reverse: 5'-ctcttcacttttctaccgtcccaggtgtcttcatcgaattcttc-3' DNA sequence of FABP from Desert ant 5 - ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCA TATGTCCATCAACGAGATTCTTGGAAAACGTTACAAGCTCTCTAGTAGCGAAAATTTCG ACGATTTTATGAAGGCACTCGGCGTAGGTATGGTGACGCGGAAAATGGGTGCTACGGTC AGTCCCGTCGTCGAATTGACGGAGAAAGACGGAGTGTATACTCTAAAGACGACTAGTAC CTTCAAAAACACGGAAATAAAATTCAAACTTGGCGAAGAATTCGATGAAGACACCGTGG ACGGTAGAAAAGTGAAGAGTGTCTGCACTCTGGAAGGTAATAAACTCATACAGGTGCAG AAAGGTGATAAGAATACTACGATTGAAAGGGAATTCACACCTACAGAGATGGAAGCGAT CATGAAAGTTGATGACATAGTTTGCACAAGAGTATATAAGATCCAGGAATAA-3

15 DNA and amino acid sequence of FABP from Desert ant 5 -atgggcagcagccatcatcatcatcatcacagcagcggcctggtgccgcgcggcagccat M G S S H H H H H H S S G L V P R G S H atgtccatcaacgagattcttggaaaacgttacaagctctctagtagcgaaaatttcgac M S I N E I L G K R Y K L S S S E N F D gattttatgaaggcactcggcgtaggtatggtgacgcggaaaatgggtgctacggtcagt D F M K A L G V G M V T R K M G A T V S cccgtcgtcgaattgacggagaaagacggagtgtatactctaaagacgactagtaccttc P V V E L T E K D G V Y T L K T T S T F aaaaacacggaaataaaattcaaacttggcgaagaattcgatgaagacaccgtggacggt K N T E I K F K L G E E F D E D T V D G agaaaagtgaagagtgtctgcactctggaaggtaataaactcatacaggtgcagaaaggt R K V K S V C T L E G N K L I Q V Q K G gataagaatactacgattgaaagggaattcacacctacagagatggaagcgatcatgaaa D K N T T I E R E F T P T E M E A I M K Gttgatgacatagtttgcacaagagtatataagatccaggaataa-3 V D D I V C T R V Y K I Q E - Konstruction of pet28 vector

16