Page 1 of 10 MIDTERM EXAM OF BIO

Transcription

1 Page 1 of 10 MIDTERM EXAM OF BIO Name: Student number: Day of your section: Monday Tuesday Thursday Friday Part I: Calculations NaCl: Water: 8 LiCl: MgCl 2: Part II: Bioinformatics Forward: Reverse: Part III: Theory (a) (b) (c) (d) Part IV: Problems 1a Insert size: Insertion site: 1b B in insert: B in vector: X in insert: X in vector: 1c 1d 1e

2 Page 2 of 10 MIDTERM EXAM OF BIO Part IV. Problems (Cont d) 2a Forward: Reverse: 2b Forward: Reverse: 2c 2d Intra: Inter: 2e Enzyme (s): Band sizes: 3a 3b BamHI: EcoRI: 3c 3d 3e

3 Page 3 of 10 MIDTERM EXAM OF BIO I. Calculations: Your final answers should be indicated to two significant digits after the decimal. Make sure to indicate your units. (2 points per question for 16 points) Consider the following information to answer questions 1-3 Solution X (Density: 1.6g/mL) contains: 110 ml of a 1M solution of solute A (MW 100g/mole; Density of solute A 1.2g/mL) 22 ml of a 100g/L solution of solute B (MW 50g/mole; Density of solute B 1.5g/mL) 55 ml of a 30% (m/v) solution of solute C (MW 40g/mole; Density of solute C 2.3g/mL) 363 ml of water 1. What is the final % (m/m) of solute B in solution X? 2. What is the final molarity of total solutes in solution X? 3. What would be the molar concentration of solute C in a 4% (m/v) solution of solution X? 4. The volume ratio in a solution between water (MW 18g/mole), 1.5M NaCl (MW 58g/mole), and 1.2M MgCl 2 (MW 95g/mole) is 7 : 4 : 1 respectively. What is the molar concentration of chloride ions (Cl - ) in the solution? 5. You add 1mL of a 1.2M solution of compound A to 5 ml of a 0.3M solution of compound A (MW of A : 90g/mole). What is the concentration of compound A in mg/ml in the final solution? 6. You have a DNA solution from which a 1/20 dilution has an absorbance at 260nm of 0.6. What volume in µl should be added to 10µL of water to obtain a final concentration of 120 pg/µl? 7. You wish to prepare 1L of a 5M solution of NaCl (MW: 58g/mole, density: 2.16g/mL). What mass of solid NaCl (in grams) and what volume of water (in milliliters) would you need to prepare the desired solution? 8. You wish to prepare a solution containing 10 g of Mg ++, and a final concentration of 0.5M LiCl. You have solid MgCl 2 (MW of MgCl 2 : 95g/mole, MW of Mg ++ : 24g/mole, MW of Cl 2 : 71g/mole; density of MgCl 2: 2.3g/mL) and a 1M stock solution of LiCl. What mass of MgCl 2 and what volume of the LiCl stock solution would you add to 100 ml of water to obtain the desired solution?

4 Page 4 of 10 MIDTERM EXAM OF BIO II. Bioinformatics (1.0 point/question for 6 points) Note: All sequences indicated may be obtained and copied from Brightspace. Quizzes>midterm (enter password). The password will be announced during the exam period. 1. What is the protein accession number corresponding to the gene with the greatest percentage identity to at least part of the following query sequence? CTCCTTCCAGGAGAACTTCTCCTACGTCTCTTCGACACCGTCGGAAGGTACCTGCTCC TCAGGAAAGAGTTGGGGAAATTAGCAAAACAGACGAAATGGGGTTTCTTTTCCCAAG 2. Claspin is a 1315 amino acid protein involved in the development of mice (Mus musculus). Using a general search, what is the protein accession number of claspin from Mus musculus? 3. Which two of the following primers would allow amplification of at least 500bp of the sequence with the accession number JQ658354? Indicate which primer is forward, which is reverse and the size of the amplicon? (a) ACACCGGCTGGAAGCTCCT (b) CCAAGCCTTGAATCGCGGC (c) GAGTTGTATCAGTCATGGC (d) GCTTGGTTTATGCTGCGAA 4. The complete sequence corresponding to the accession number JQ was amplified by PCR with primers that included XbaI restriction sites. Non-directional cloning of the XbaI digested amplicon was then done in puc19 digested with XbaI. What would be the sizes of the largest fragments in either orientations expected after a digestion of recombinants with PstI? 5. You perform a Southern analysis on a new variant of the human papilloma virus (HPV). To do so, you isolate genomic DNA, digest it with the restriction enzyme MfeI, fractionate on a gel and probe the digest with a probe representing the region spanned between positions from the HPV genome. Your probe reveals bands of 3131, 965, and 811 bp. Which band size (s) was (were) unexpected? (Accession number of original HPV genome: NC_001526). 6. Carry out the following steps on the following sequence: 5 -GCAAGGATCCGCAA-3. Step 1: Obtain the complement sequence. Step 2: Obtain the reverse complement of the sequence obtained in step 1 Step 3. Obtain the reverse sequence of the sequence obtained in step 2 Step 4: Obtain the complement sequence of the sequence obtained in step 3 Indicate the sequence obtained in step 4. Make sure to indicate your 5 and 3 ends. (Hint: keep track of your orientations.)

5 Page 5 of 10 MIDTERM EXAM OF BIO III. Theory (1.0 point/question for 5 points) 1. You performed a BLASTn search with the following query sequence of 20 bases: AACTGGTCACAGTCCATGCCT. This returned a hit with the following alignment: Query: (1) AACTGGTCACAGTCCATGC (18) Subject: (1) AACTGGTCACAGTCCATGC (150) Which of the following interpretations most accurately describes the results obtained? (a) 75% identity for a coverage of 83%. (b) 83% identity for a coverage of 90%. (c) 11% identity for a coverage of 11%. (d) 12% identity for a coverage of 11%. 2. Which restriction sites from list 1 would generate compatible ends that could be ligated to the ends generated from the restriction sites of list 2? List 1 List 2 A. GG ATCC W. CCAT GG B. AA ATTT X. GCGT ATACGC C. GAT C Y. A TAT D. CGATA TCG Z. G GATCC (a) D+Y and A+Y (b) C+Z, C+Y, and C+X (c) A+X, B+X, and C+W (d) B+Y and D+Z 3. The schematic (on the right) represents a single stranded template used for a PCR amplification using a pair of primers (indicated by arrows). How many molecules of the double stranded amplification product would you obtain from 100 molecules of the single stranded template after 10 PCR cycles? 4. On average, how many times would you expect to find the palindrome SAATTS. (S = G or C) within a 10 Kbp genome which is 35 % G/C? Round off to the nearest whole number.

6 Page 6 of 10 MIDTERM EXAM OF BIO Indicate whether each of the following statements is true (T) or false (F): (a) Ethidium bromide, which is positively charged, binds DNA by electrostatic interaction. Given this information, one would expect that the migration through an agarose gel of DNA stained with ethidium bromide would be slower than that of unstained DNA. (b) You ve discovered a new genome which is 100% A or T. The number of possible 12 base pair palindromes in this genome would be 64. (c) SphI (CGTAC G) and BbuI (CGTAC G) are isoschizomers from the same species. (d) In the alkaline lysis procedure, SDS is removed by differential sedimentation, whereas in the Qiagen method it is removed by chromatography. IV. Problems: Answer 2 of the 3 following problems (5 points/problem for 10 points) 1. Restriction enzyme analysis of a recombinant plasmid. Single and double digests were done on a recombinant plasmid with the enzymes B, H, and X. Lane UD represents the undigested recombinant plasmid. Lane V+E represents the vector (without insert) digested with E, which cuts once. Fragment sizes in kilobase pairs are indicated besides each band. The thickness of the bands represent the relative intensity of ethidium bromide staining. (a) What is the size of the DNA insert and in which restriction site (s) within the vector was the insert introduced? (b) Enzyme B cuts how many times in the vector; in the insert? Enzyme X cuts how many times in the vector; in the insert? (c) Which fragment size (s) represent (s) intermediate products resulting from a partial digestion? Indicate the lane (s) and the size (s) of the intermediate products. (d) Indicate the number of cut sites which remain to be cleaved in the intermediate product (s) identified in (c). (ex. 7Kb (3)) (e) Enzyme S cuts once within the insert at 5Kb from one of its ends. Which fragment size (s) would be cut by enzyme S?

7 Page 7 of 10 MIDTERM EXAM OF BIO Below is illustrated the complementary sequence of a 5 Kb gene ǀ ǀ ǀ 3'-TCCCATGGGGTACCATGGCG TACTTAAGGA GAGCTCATATCGTAAGG-5' You wish to PCR amplify the complete gene sequence and do a directional cloning of the amplification product in the multiple cloning site, shown below, of a 2.5 Kb vector with blue white screening. Restriction sites EcoRI : G AATTC EcoRI SacI KpnI XbaI KpnI : GGTAC C GA ATT CGA GCT CGG TAC C AGA TCT C SacI : GAGCT C Xba I : AGAT CT (a) Design primers of 10 bases which would allow you to amplify the complete sequence of the gene. Indicate which primer is forward and which one is reverse. Label your ends. (b) Analyze the above sequence and indicate which restriction site (s) you would add to the forward and reverse primers. (c) You successfully amplified the gene, digested the amplicon and the vector with the chosen enzymes and performed the following ligations: i. 30 ng of digested vector + DNA ligase ii. iii. iv. 30 ng of digested vector mixed + 60 ng of the digested amplicon + DNA ligase 30 ng of digested vector (No DNA ligase) 10 ng of undigested vector What was the ratio between insert : vector in reaction ii? (d) Below is indicated the number of colonies obtained for the transformations of the different mixtures indicated in (c). Unfortunately, the plates representing the different transformations were not labelled. Plate 1: 2500 blue colonies + 3 white colonies Plate 2: 75 blue colonies + 0 white colonies Plate 3: 75 blue colonies white colonies Plate 4: 0 blue colonies + 3 white colonies Indicate which plate shows the highest percentage of intramolecular ligation events and which plate shows the highest percentage of intermolecular ligation events. (e) You ve identified a potential recombinant and wish to verify that it possesses the insert in the correct orientation. Which enzyme (s) would you use to digest the recombinant and what fragment sizes would be expected if the insert is present in the correct orientation?

8 Page 8 of 10 MIDTERM EXAM OF BIO You performed a Southern hybridization on digestions of a linear viral genome of 20 Kbp. The probe used was a 14 Kbp EcoRI fragment. The table indicates the band sizes observed on the autoradiogram. Assume all digests were complete. Enzymes Band sizes (Kbp) BamHI 3, 7.5 and 9.5 EcoRI 14 BamHI + EcoRI 3, 5 and 6 (a) Draw all possible restriction maps which are in agreement with the results presented. Indicate the relative distance between each of the restricition sites. DO NOT INCLUDE MIRROR IMAGES. (b) How many times do BamHI and EcoRI cut within the region spanned by the probe? (c) A hybridization was also done on genomic DNA digested with EcoRI using a 2 Kbp probe representing one of the ends of the genome. This probe revealed bands of 1.5 and 14 Kbp. According to this information and your maps, what are the distances between the ends of the viral genome and the EcoRI sites. (d) A bioinformatics analysis of the sequenced genome generated the following map: To verify the computer generated map you perform a Southern hybridization on the genomic DNA digested with C, K or X. The following table presents the sizes (Kbp) of the bands observed using two different probes (probes 1 & 2). Enzyme Probe 1 Probe 2 C 7.5 and K 0.4 and , 10.6 and 9 X 9.8 and The results from the Southern indicate that the computer-generated map is in error. Indicate which restriction site (s) is (are) missing or not indicated and it's (their) position (s) in parentheses. (e) Acording to the results from the Southern hybridization and the bioinformatics map, what band sizes would be expected following a hybridization with probe 2 of a double digest with X and K?

9 Page 9 of 10 MIDTERM EXAM OF BIO Name: Student number: Part I: Calculations % M M M mg/ml µL 7 NaCl: 290g Water: 865mL 8 LiCl: ml MgCl 2: 39.9g Part II: Bioinformatics 1 XP_ NP_ Forward: C Reverse: A kb & 3.65 kb bp 6 3 -CGTTCCTAGGCGTT-5 Part III: Theory 1 B 2 C (a) T (b) T (c) F (d) F Part IV: Problems 1a Insert size: 12 Kb Insertion site: H 1b B in insert: 0 B in vector: 2 X in insert: 2 X in vector: 0 1c 1d 1e H+X 12Kb two 5, 12, and 16Kb

10 Page 10 of 10 MIDTERM EXAM OF BIO Part IV. Problems (Cont d) 2a Forward: GGAATGCTAT Reverse: AGGGTACCCC 2b Forward: SacI Reverse: XbaI 2c 1:1 2d Intra: Plate 1 Inter: Plate 3 2e Enzyme (s): EcoRI Band sizes: or a 3b BamHI: 2 EcoRI: 0 3c 4.5Kb and 1.5Kb 3d X(15.3) and C(5.0) should not be there. Should have a K at e 9.0 and 0.4 Kb