Perform HiFi PCR Purify PCR-mixture using PCR-clean up kit and determine concentration

Transcription

1 IGEM EXPERIMENT 2 CONSTRUCTION OF PSB#X#-T7CCDB Strategy Cloning Flow Chart (using restriction/ligation): 1. In silico design of cloning Design a cloning strategy (in case of insert/backbone): o Using RE: Check for 2 single cutters with different compatible ends (preferable sticky) Choose REs which cut in same buffer, same temperature, same time period Add additional nucleotides upstream the RE in the primer to increase efficiency Simulate the cloning strategy in silico 2. Amplification of the fragments Perform HiFi PCR Purify PCR-mixture using PCR-clean up kit and determine concentration 3. Preparative RD Perform prep. RD on purified PCR and/or plasmid Use ~1g DNA in 50l reaction with ~40units RE Make sure you use equivalent amounts for each RE (check concentration units/l) 4. Gel purification of DNA fragments Run a prep. agarosegel and purify the correct fragments using gelextraction purification kit Determine concentration 5. Ligation Use excel-file ligation calculator to determine volumes of the different pieces in the ligation mixture Check that buffer smells good (DTT) 6. Transformation Transform in DH5 subcloning cells Check colonies by colony PCR (if colony PCR don t work use analytical RD) Select positive clones for sequencing igem Experiment 2 Construction of psb#x#-t7ccdb Page 1

2 SOP 1. Purification of backbone plasmids psb#x# and pxspfrt-t7ccdb DNA Kit Plate Instructions To use the DNA in the Distribution Kit you may follow these instructions: 1. With a pipette tip, punch a hole through the foil cover into the corresponding well of the Biobrick -standard part that you want. Make sure you have properly oriented the plate. We recommend that you do not remove the foil cover, as it could lead to cross contamination between the wells. 2. Pipette 10uL of dh2o (distilled water) into the well. Pipette up and down a few times and let sit for 5 minutes to make sure the dried DNA is fully resuspended. We recommend that you do not use TE to resuspend the dried DNA. 3. Transform 1 or 2uL of the resuspended DNA into your desired competent cells, plate your transformation with the appropriate antibiotic* and grow overnight. 4. Pick a single colony and inoculate broth (again, with the correct antibiotic) and grow for 16 hours. 5. Use the resulting culture to miniprep the DNA AND make your own glycerol stock (for further instruction on making a glycerol see this page). We recommend using the miniprepped DNA to run QC tests, such as restriction digests and sequencing. 1. Transform the selected plasmids from the distribution DNA kit in E. coli DH5 subcloning cells 2. Inoculate E. coli DH5 + psb3t5, DH5 + psb4a5, DH5 + psb6a1 and E. coli One Shot ccdb Survival 2 T1R + p5spt7ccdb, One Shot ccdb Survival 2 T1R + p10spt7ccdb and One Shot ccdb Survival 2 T1R + p20spt7ccdb 3. Purify plasmids using Qiagen Spin minikit: psb3t5 (plate 2, 8D): psb4a5 (plate 5, 5I): psb6a1 (plate 2, 2L): p5spfrt-t7ccdb: p10spfrt-t7ccdb: p20spfrt-t7ccdb: igem Experiment 2 Construction of psb#x#-t7ccdb Page 2

3 2. Cloning of fragments 1. Perform a HiFi PCR using Takara PS polymerase with MDM0586 & MDM0587: a. Design primers to amplify ccdb operon adding the BioBrick prefix G00000 and suffix G Make 12.5 µm work solution Primer name MDM0586_Fw-Trc-ccdB-G00000 MDM0587_Rv-Trc-ccdB-G00001 Sequence (5 3 ) TAGAGAATTCGCGGCCGCTTCTAGAGTGCGCCTGATCATGTTCGTC TATGACTGCAGCGGCCGCTACTAGTAGAAAAAGGCCATCCGTCAGG b. Add in PCR-tube: Per Rxn: 5 x PrimeStar Buffer 10 µl 2.5 mm dntp 4 µl 12.5 M Primer work stock 2 µl Template 0.5 µl PrimeStar Polymerase 0.5 µl MQ-H 2O 33 µl 50 µl c. Incubate according to following temperature cycle: Temp. cycli: 1x x x x - 16 [expected fragment of ~2300bp] d. Purify PCR fragment using Qiagen Qiaquick PCR purification kit: PCR_LacIq-T7ccdB: ~2300bp - igem Experiment 2 Construction of psb#x#-t7ccdb Page 3

4 2. Generate RD-fragments a. Add in Eppendorf: T7-ccdB psb3 psb4 psb6 10x NEB CutSmart buffer 5 µl 5 µl 5 µl 5 µl PstI-HF (10,000U/ml) 3 µl 3 µl 3 µl 3 µl XbaI (20,000U/ml) 1.5 µl 1.5 µl 1.5 µl 1.5 µl template (~ 1 µg) µl µl µl µl MQ-H2O µl µl µl µl 50 µl 50 µl 50 µl 50 µl b. 37C for minimal 2h30min [expected fragments bp] c. Gel purify RD-fragment using Qiagen Qiaquick gel extraction kit: RD_T7-ccdB: 2157bp - RD_pSB3: 3229bp - RD_pSB4: 3372bp - RD_pSB6: 3999bp - 3. Ligation Add in Eppendorf (use LigationCalculator.exe file to calculate the volumes): psb3 psb4 psb5 T7-ccdB µl µl µl plasmid µl µl µl MQ-H 2O µl µl µl 10x T4 DNA ligase buffer 2 µl 2 µl 2 µl T4 DNA ligase buffer 1 µl 1 µl 1 µl 20 µl 20 µl 20 µl Vortex shortly and spin short Incubate for 1h at RT 4. Transformation a. Transform ligation mixture in E. coli DH5 subcloning cells according to SOP of Invitrogen: Melt 50 µl competent cells (already aliquoted) on ice (~ 20 ) Add 10µl to melted cells and swirl gently Incubate on ice for 20 Heat shock cells by incubation at 42C for 30 and place immediately on ice for 5 Add 450µl sterile SOC and 37C for 1h Plate 200µl transformation mixture on LB+Sp-agar plates Incubate plates 37C igem Experiment 2 Construction of psb#x#-t7ccdb Page 4

5 b. Check transformants by cpcr using MDM0602 & CLG0019: psb3t5-t7ccdb 503bp MDM0095 & CLG0019: psb4a5-t7ccdb 443bp MDM0096 & CLG0019: psb6a1-t7ccdb 437bp Primer name MDM0095_Fw-SEQAmpR820 MDM0096_Rv-SEQAmpR40 MDM0039_Rv-SEQrrnBTT MDM0060_Fw_SEQLacIq930 MDM0602_Fw-SeqTetR1075 CGL0019_Rv_seqLacIq_50 Sequence (5 3 ) AGACAGATCGCTGAGATAGG AAAGGGAATAAGGGCGACAC GCGCTACGGCGTTTCACTTC AGGCGGTGAAGGGCAATCAG GATCGTCACGGCGATTTATG GGGAAACGGTCTGATAAGAG Add in PCR-tube: Per 2 Rxn: 5 x Crimson buffer 10 µl 10 mm dntp 1 µl Primer work stock 2 µl Crimson Polymerase 0.5 µl MQ-H 2O 36.5 µl 2x 25 µl Incubate according to following temperature cycle: Temp. cycli: 1x x x x - 16 [Expected fragment of ~950bp, 1402bp for original plasmid] Check cpcr fragments on 1% TAE agarose gel c. Sequence positive colony: Incubate colony in 10 ml LB+Sp 37C Purify plasmid using Qiagen Qiaprep spin mini kit psb3t5-t7ccdb: psb4a5-t7ccdb: psb6a1-t7ccdb: Sequence plasmid using psb3t5-t7ccdb: MDM0602, MDM0060 & MDM0039 psb4a5-t7ccdb: MDM0095, MDM0060 & MDM0039 psb6a1-t7ccdb: MDM0096, MDM0060 & MDM Archive strains a. Create new strain number in smemo strain list b. Add 0.5 ml o/n culture to 0.5 ml sterile 70% glycerol c. Mix thoroughly and -80C igem Experiment 2 Construction of psb#x#-t7ccdb Page 5