Mitochondria Targeted DNA Nanoprobe for Real-Time Imaging and Simultaneous Quantification of Ca 2+ and ph in Neurons

Transcription

1 Supplementary information Mitochondria Targeted DNA Nanoprobe for Real-Time Imaging and Simultaneous Quantification of Ca 2+ and ph in Neurons Zhichao Liu, Hao Pei, Limin Zhang, and Yang Tian* Shanghai Key Laboratory of Green Chemistry and Chemical Processes, Department of Chemistry, School of Chemistry and Molecular Engineering, East China Normal University, Dongchuan Road 500, Shanghai , China. *Corresponding author: Table of Contents 1. Supplementary Methods 2. Supplementary Discussions 3. Supplementary Tables and Figures 3.1 DNA oligonucleotides used in this work (Table S1) 3.2 Synthesis and characterization of CaL (Scheme S1, Figure S1-S10) 3.3 Characterition of CDs, DNA and nanoprobe (Figure S11-S16) 3.4 Fluorescence enhancement mechanism of towards Ca 2+ (Figure S17) 3.5 Calibration of nanoprobe by commercial probes (Table S2, Figure S18) 3.6 Cross-talk, FRET, selectivity and anti-interference investigation of nanosensor (Figure S19-S20) 3.7 Cytotoxicity and biocompatibility of nanosensor and commercial probe (Figure S21-S24) 3.8 Co-localization experiments of mitochondria-targeted nanoprobe (Figure S25-S27) 3.9 Ca 2+ and ph imaging in neurons using the developed nanoprobe and mixed probes (Figure S28-S32 and Table S3) 3.10 The effect of PcTX1 on O - 2 -induced neuron death (Figure S33) 3.11 Co-localization experiments of cytoplasmic nanoprobe (Figure S34) 3.12 Confocal fluorescence images of neurons stimulated by O - 2 and Aβ (Figure S35- S38) S1

2 1. Supplementary Methods 1.1 Chemicals and Reagents. 2-nitrophenol, 1,2-dibromoethane, carbon powder (C), ethylbromoacetate (C 4 H 7 BrO 2 ), dimethyl formamide (DMF), p-phenylenediamineby (p-pd) and (3- azidopropyl) triphenylphosphonium bromide (TPP) were purchased from Aladdin Industrial Corporation (Shanghai, China). Ferric trichloride (FeCl 3 ), n-hexane, acetonitrile, methanol (CH 3 OH), and ethyl alcohol (EtOH) were provided by Macklin Reagent Company (Shanghai, China). Hydrazine hydrate (N 2 H 4 H 2 O), sodium iodide (NaI), methylbenzene, anhydrous sodium sulfate (Na 2 SO 4 ), phosphorus oxychloride (POCl 3 ), sodium hydroxide (NaOH), and sodium bicarbonate (NaHCO 3 ) were obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). MitoTracker Green and CellTracker Green CMFDA were purchased from Thermo Fisher scientific (U.S.A.). All chemicals were of analytical grade and were used without further purification and modification. All samples were prepared by deionized water purified by Milli-Q water purification system. DNA oligonucleotides modified with different groups were synthesized and purified by TaKaRa Biotechnology Co., Ltd (Dalian, China) and listed in Table S1. Aβ 1-42 peptide fragment and PcTX1 were synthesized and purified by KE Biochem Co., Ltd (Shanghai, China). 1.2 Apparatus and Instruments. Nuclear magnetic resonance (NMR) spectrum was recorded on a Bruker 500 MHz spectrometer (Bruker, Germany). Mass spectroscopy (MS) was carried out on an Agilent 6890 (Agilent, USA). The UV-Vis absorption spectrum and fluorescence spectrum were obtained with an UH5300 spectrophotometer (Hitachi, Japan) and F-4500 fluorescence spectrophotometer (Hitachi, Japan), respectively. Transmission electron microscope (TEM) image was collected with a JEM-2100F transmission electron microscope (JEOL, Japan). Atomic force microscope (AFM) image was recorded using the ScanAsyst mode with a Multimode NanoscopeIIIa atomic force microscope under ambient conditions (Bruker, Germany). Bio-fast AFM image was recorded with a Dimension Icon & FastScan Bio scanning probe microscope under liquid conditions (Bruker, Germany). Fourier transform infrared spectroscopy (FT-IR) was obtained using a Thermo Scientific Fourier Transform Infrared spectrometer (Thermo Fisher scientific, USA) at resolution of 4 cm -1 in the range of cm -1. The absorbance of cytotoxicity was recorded by a Varioskan LUX multimode microplate reader (Thermo Fisher scientific, USA). The apoptosis assay was conducted at a FACS Calibur flow cytometry (Becton, Dickinson and Company, USA). Fluorescence confocal imaging was performed with a Leica TCS-SP8 confocal scanning microscope using a 63x oil objective and a numerical aperture of 1.40 (Leica, Germany). 1.3 Synthesis of Ca 2+ ligand (CaL). CaL was synthesized according to the protocol reported in the literatures with modification (J. Biol. Chem. 1985, 260, ), as shown in Scheme S1. Compound I: 1, 2-bis(2-nitrophenoxy)ethane. A mixture of NaOH (4.8 g, 12 mmol), H 2 O (4.5 ml) and o-nitrophenol (15.30 g, 11 mmol) in 30 ml DMF was heated to 60 o C for 30 min with stirring. Then 1, 2-dibromoethane (5.1 ml) was added and heated to 130 o C for 3 h. After cooling down to room temperature, the mixture was diluted to 100 ml with water and filtered. The precipitate was washed with 10% (w/w) NaHCO 3 and water for at least three times. Recrystallization from ethanol S2

3 yielded 1.17 g compound I. Yield: 70% (Figure S1). 1 H NMR (DMSO, 500 MHz), δ: 7.85 (d, 2H, J=8.1), 7.65 (t, 2H, J=8.0), 7.43 (d, 2H, J=8.5), 7.14 (t, 2H, J=7.8), 4.54 (s, 4H). Compound II: 2, 2'-(ethane-1,2-diylbis(oxy))dianiline. A mixture of compound I (4.56 g, 15 mmol), carbon powder (0.24 g, 20 mmol) and FeCl 3 (0.032 g, 0.2 mmol) was heated to 80 o C in 90% (w/w) methanol (45 g) under N 2 atmosphere. Then 85% N 2 H 4 H 2 O (3 ml) was added dropwise within 20 min. The mixture was refluxed for 5 h. It was filtered while hot and washed with hot methanol. The combined filtrate was evaporated and recrystallized from ethanol to give 2.20 g faint yellow crystals. Yield: 60% (Figure S2). 1 H NMR (DMSO, 500 MHz), δ: 6.87 (dd, 2H, J=8.0), 6.71 (td, 2H, J=7.4), 6.66 (dd, 2H, J=7.8), 6.53 (td, 2H, J=7.6), 4.66 (s, 4H), 4.28 (s, 4H). Compound III: Tetraethyl 2,2',2'',2'''- (((ethane-1,2-diylbis(oxy)) bis (2,1-phenylene)) bis (azanetriyl)) tetraacetate. A mixture of compound II (1.54 g, 6.32 mmol), NaI (0.38 g, 2.53 mmol), K 2 HPO 4 (7.212 g, 31.6 mmol) and ethyl bromoacetate (4 ml, 36.4 mmol) in 25mL anhydrous acetonitrile was refluxed under nitrogen for 18 h. Toluene was added after distilling the solvent. The solution was washed with water and saturated brine. Organic layer was dried over Na 2 SO 4 and evaporated. Recrystallization from ethanol gave 2.23 g product as white powder. Yield: 60% (Figure S3). 1 H NMR (DMSO, 500 MHz), δ: (m, 2H), 6.86 (tt, 4H, J=7.4), (m, 2H), 4.21 (s, 4H), 4.10 (s, 8H), 3.97 (m, 8H, J=7.1), 1.08 (t, 12H, J=7.2). CaL ester: A mixture compound III (0.882 g, 1.5 mmol) and 150 μl pyridine was dissolved in 3mL DMF. Then 1.2 ml POCl 3 was dropped slowly at 0 o C. The reaction mixture was stirred at room temperature for 30 min and heated to 60 o C for 1 h and then back to room temperature for 20 h. The mixture was poured into aqueous NaOH mixed with ice. The aqueous layer was extracted with CH 2 Cl 2 for three times. The combined organic layer was washed with water and saturated brine for three times. After drying with Na 2 SO 4 and evaporation, the residue was chromatographed on silica in petroleum ether: ethyl acetate = 4:1 (v/v) to yield 193 mg CaL ester. Yield: 20% (Figure S4-6). 1 H NMR (DMSO, 500 MHz), δ: 9.78 (s, 2H), 7.45 (dd, 2H, J=8.3), 7.38 (d, 2H, J=1.8), 6.73 (d, 2H, J=8.3), 4.23 (d, 12H, J=10.4), 3.97 (q, 8H, J=7.1), 1.05 (t, 12H, J=7.1). 13 C NMR (DMSO, 500 MHz): δ = , , , , , , , , 67.44, 60.89, 53.92, ppm. CaL: CaL ester (130 mg, 0.2 mmol) was added into 3mL KOH solution (1M, dissolved in EtOH), then 1 ml CH 2 Cl 2 was added. The mixture was stirred at 37 o C for 24 h. After that, the mixture was adjusted to a ph range of 4-5 by HCl. The solid was filtered and product was extracted with abundant CH 2 Cl 2. After drying with Na 2 SO 4 and evaporation, 65 mg CaL ester was obtained. Yield: 60% (Figure S7-9). 1 H NMR (DMSO, 500 MHz), δ: (s, 4H), 9.75 (s, 2H), 7.44 (dd, 2H, J=8.4), 7.38 (d, 2H, J=1.8), 6.71 (d, 2H, J=8.4), 4.30 (s, 4H), 4.16 (s, 8H). 13 C NMR (DMSO, 500 MHz): δ = , , , , , , , , 67.49, ppm. 2. Supplementary Discussions 2.1 The assessment of detection accuracy of nanoprobe In order to confirm the accuracy of the developed nanoprobe, mitochondria were isolated from cells and the calibration curves were established in mitochondrial lysis. Meanwhile, the commercial probe for either Ca 2+ or ph was employed to calibrate our determined linear curves, respectively. Using the developed probe, the fluorescence of FITC decreased with decreasing ph and while that of AF660 kept no obvious change (Figure 1f). The fluorescence ratio (F FITC /F AF660 ) displays a good S3

4 linearity with ph in the range of (R 2 =0.994), as shown in Equation (1): F FITC /F AF660 = ph (1) On the other hand, the fluorescence of CD@CaL increased with increasing concentration of Ca 2+, while that of AF660 maintained almost constant. The ratio of F CD@CaL /F AF660 demonstrates a linear relationship with Ca 2+ concentration ([Ca 2+ ]) in the range of μm (R 2 =0.993), as summarized in Equation (2): F CD@CaL /F AF66 = [Ca 2+ ] (2) Next, the commercial probe for either Ca 2+ or ph was employed to calibrate our established standard curves. Firstly, the commercial mitochondria-targeted Ca 2+ probe (Rhod-2 AM) was used to calibrate the determined plot of Ca 2+. In briefly, according to Equation (3): [Ca 2+ ] = K d (F - F 0 ) / (F m - F) (3) Where F 0 is the fluorescence intensity of the indicator in the absence of Ca 2+, F m is the maximum fluorescence of Rhod-2 AM when Ca 2+ is saturated. K d =570 nm according to the data given by Thermofisher Scientific (U.S.A.) and literature (Am. J. Physiol. 1998, 274, H ). Then, T-test method was used to compare the determined results from Rhod-2 AM probe and those from our developed nanoprobe. As summarized in Table S2, no significant difference was obtained between two probes. Then, individual FITC was employed with the same concentration for ph sensing in mitochondrial lysis. As shown Figure S18, the fluorescence intensity decreased with the decreasing ph, and the fluorescence intensity displays a good linearity with ph from 8.0 to 5.6 with a pka of 6.85, which was similar with the results obtained by our developed nanoprobe. All these results prove the developed nanoprobe shows the same accuracy with the commercial probes. 2.2 Stability of nanoprobe in mitochondria In order to prove the developed nanoprobe stably located in mitochondria even upon stimulation, co-localization imaging experiments were also performed when the present nanoprobe was stimulated by O - 2 and aggregated Aβ As shown in Figure S25c, the fluorescence of our nanoprobe (tdna-tpp+cd@cal+af660) merged well with that of MitoTracker Green after the neurons were stimulated by O - 2 and aggregated Aβ The Person s correlation coefficient between our probe and commercial dye was calculated to 0.94 and 0.95 after the cells were stimulated by O - 2 and aggregated Aβ 1-42, respectively, which were almost same as the original values (Figure 3a). Then, mitochondria were isolated from cells after the neurons were stimulated by O - 2 and aggregated Aβ Compared with the situation without stimulation, the fluorescence intensities of mitochondrial and cytoplasmic solution show no obvious changes after the cells were stimulated by O - 2 and aggregated Aβ 1-42 (Figure S25d,e). These results further confirm that the developed nanoprobe stably stay in mitochondria even after the neurons were stimulated by O - 2 and aggregated Aβ The stability of the developed nanoprobe in mitochondria at different ph. In order prove the stability of developed nanoprobe in mitochondria at different ph, colocalization experiments were carried out after tdna-tpp+cd@cal+af660 probe was coincubated with commercial MitoTracker Green in the presence of different ph values (7.8, 7.2 and S4

5 6.0), respectively. As shown in Figure S27a, the fluorescence of probe merged well with the fluorescence of MitoTracker Green in the presence of different ph values. The Person s correlation coefficient was calculated as 0.94 at ph 7.8 while the Person s correlation coefficient was 0.95 at ph 7.2. Meanwhile, the Person s correlation coefficient was 0.94 at ph 6.0. On the other hand, mitochondria and cytoplasm were isolated and purified from cells after the developed nanoprobe (tdna-tpp+fitc+cd@cal+af660) was co-incubated with cells for 1 h at different ph values (7.8, 7.2 and 6.0). As show in Figure S27b, the fluorescence intensity of the isolated mitochondrial solution and cytoplasmic solution were ~75% and ~10% of the original fluorescence intensity of our nanoprobe at ph 7.8, respectively. Meanwhile, the fluorescence intensity of the isolated mitochondrial solution and cytoplasmic solution were ~75% and ~10% of the original fluorescence intensity of our nanoprobe at ph 7.2 while the fluorescence intensity of mitochondrial solution and cytoplasmic solution were ~75% and ~10% of the original fluorescence intensity of our nanoprobe at ph 6.0 (Figure S27c, d). All these results prove that the developed nanoprobe was stable in the mitochondria at different ph. Thus, the different local ph would not affect the ph-sensitive FITC of the developed nanoprobe in mitochondria. 2.4 Stability of cytoplasmic probe in cytoplasm In order to prove the developed cytoplasmic probe (tdna-fitc+cd@cal+af660) stably localized in cytoplasm during the applications, co-localization imaging experiments were also carried out. As shown in Figure S34a, the fluorescence of cytoplasmic probe merged well with that of CellTacker Green CMFDA (a commercial cytoplasmic dye), and the Person s correlation coefficient was calculated to No obvious changes were observed for the Person s correlation coefficient after the neurons were stimulated by CCCP for 5 min (Figure S34a). Then, mitochondria and cytoplasm were isolated and purified from the cells after the developed cytoplasmic probe was co-incubated with cells for 1 h. As shown in Figure S34b, the fluorescence intensity of the isolated cytoplasmic solution and mitochondrial solution were ~76% and ~5% of the original fluorescence intensity of the cytoplasmic probe. In addition, the co-localization imaging experiments were also performed after the neurons were stimulated by O - 2 and aggregated Aβ 1-42, respectively. As shown in Figure S34c, the fluorescence of cytoplasmic probe still merged well with that of CellTacker Green CMFDA, and the Person s correlation coefficient was calculated to 0.85 and 0.86 after the neurons were stimulated by O - 2 and aggregated Aβ 1-42, respectively, which were almost same as the original values before stimulation. Moreover, compared with the situation without stimulation, the fluorescence intensities of the isolated mitochondrial solution and cytoplasmic one have no obvious change after the neurons were stimulated by O - 2 and aggregated Aβ 1-42 (Figure S34d,e). It should be pointed out that the fluorescence of cytoplasmic probe merged badly with that of MitoTracker Green (a commercial mitochondrial dye), and the Person s correlation coefficient was calculated to 0.10 (Figure S34f). These results prove that the developed cytoplasmic probe mostly localized in cytoplasm with good stability even after the neurons were stimulated by O - 2 and aggregated Aβ Mitochondrial ph and Ca 2+ sensing and imaging by mixed probes The mixed probe 2 with concentration ratio of 1:1:1 (tdna-tpp+fitc, tdna- TPP+CD@CaL and tdna-tpp+af660) were also used for sensing and imaging of mitochondrial S5

6 ph and Ca 2+. As shown in Figure S30, with the increasing concentration of Ca 2+, the fluorescence intensity of channel became brighter while AF660 channel kept no obvious change. Meanwhile, the fluorescence of FITC increased with the increasing concentration of Ca 2+. On the other hand, the mixed probe 2 can be used for ph sensing (Figure S31). It should be pointed out that the fluorescence intensity ratio between FITC, CD@CaL and AF660 channels was calculated as 10.1:2.39:1, 11.1:2.41:1, 12:2.55:1 after the neurons treated with the mixed probe 2 in three parallel experiments. The ratios of three fluorescence intensities were different in the parallel experiments owing to the concentration ratio of the mixed probe 2 entered into mitochondria was very hard to be controlled. In addition, F-test method was used to compare the determined results from Rhod-2 AM probe and those from the mixed probe 2. As summarized in Table S3, significant difference was observed between two kinds of probes. These results suggest that the mixed probes 2 was difficult for simultaneous quantification and imaging of mitochondrial ph and Ca 2+ at the same localization. Morever, the fluorescent spectrum of mixed probe 1 (DNA-FITC, DNA-TPP, DNA-AF660 and CD@CaL) was further measured, as shown in Figure S32a, no obvious difference was observed from that spectra of the developed nanosensor and the mixed probe 2. However, after the neurons incubated with mixed probe 1 for 1 h, the fluorescence intensity of FITC channel was only 5% of the fluorescence intensity for FITC channel after the neurons incubated with the developed nanoprobe even at 400 μm Ca 2+ (Figure S32b). Meanwhile, no obvious fluorescence was observed from AF660 channel after the neurons incubated with mixed probe 1 for 1 h. The similar results were also observed from FITC channel and AF660 channel after the neurons incubated with mixed probe 1 for 1 h at different ph (Figure S32c). All these results indicated that mixture of single labeled-dna probe is not suitable for cell imaging, not the mention detection of mitochondrial ph and Ca 2+ simultaneously. 2.6 Comparison of nanoprobe with commercial Rhod-2 AM probe The cytotoxicity and biocompatibility of commercial Rhod-2 AM probe were also estimated. As shown in Figure S24a, the cell viability of Rhod-2 AM maintained only ~50% at concentration of 40 μm, which was much lower than that of our developed nanoprobe at the same concentration (~88%), indicating the higher cytotoxicity of Rhod-2 AM probe than our developed probe. Besides, more apoptotic or dead cells were observed using Rhod-2 AM than those using our developed probe from apoptosis assay (Figure S24b-e). In addition, the fluorescence intensity of Rhod-2 AM decreased ~12.9% after explored to Xe lamp (90 W) for 2 h (Figure S15c), which was much greater than that of CD@CaL (~0.4%). S6

7 3. Supplementary Tables and Figures 3.1 DNA oligonucleotides used in this work Table S1. Oligonucleotides used in this work purchased from Takara Bio Company. Name Sequences (5 3 ) 5 Label A1-CHO CCCTGTACTGGCTAGGAATTCACGTTTTAAT CHO (DNA-CHO) CTGGGCTTTGGGTTAAGAAACTCCCCG A1 CCCTGTACTGGCTAGGAATTCACGTTTTAAT CTGGGCTTTGGGTTAAGAAACTCCCCG A2 CGCTGGAGGCGCATCACCGTTTGCGTATGTG TTCTGTGCGGCCTGCCGTCCCGTGTGGG B1-FITC CGGTGATGCGCCTCCAGCGCGGGGAGTTTCT Fluorescein (DNA-FITC) TAACCCTTTCCGACTTACAAGAGCCGG B1 CGGTGATGCGCCTCCAGCGCGGGGAGTTTCT TAACCCTTTCCGACTTACAAGAGCCGG B2 GCGAGACTCAGGTGGTGCCTTTGGCATTCGA CCAGGAGATATCGCGTTCAGCTATGCCC C1-AF660 CCCATGAGAATAATACCGCCGATTTACGTCA Alexa Fluor 660 (DNA-AF660) GTCCGGTTTCCCACACGGGACGGCAGGC C1 CCCATGAGAATAATACCGCCGATTTACGTCA GTCCGGTTTCCCACACGGGACGGCAGGC C2 CGCACAGAACACATACGCTTTGGGCATAGCT GAACGCGATATCTCCTGGTCGAATGCC D1-TPP (DNA-TPP) GCCCAGATTAAAACGTGAATTCCTAGCCAGT ACAGGGTTTCCGGACTGACGTAAATCGG Triphenylphosphine (TPP) D1 GCCCAGATTAAAACGTGAATTCCTAGCCAGT ACAGGGTTTCCGGACTGACGTAAATCGG D2 CGGTATTATTCTCATGGGTTTGGCACCACCT GAGTCTCGCCCGGCTCTTGTAAGTCGG 3.2 Synthesis and characterization of CaL Scheme S1. Synthesis of Ca 2+ ion ligand (CaL) with two aldehyde groups. S7

8 Figure S1. 1 H NMR spectrum (500 MHz) of compound I in DMSO. Figure S2. 1 H NMR spectrum (500 MHz) of compound II in DMSO. S8

9 Figure S3. 1 H NMR spectrum (500 MHz) of compound III in DMSO. Figure S4. 1 H NMR spectrum (500 MHz) of CaL ester in DMSO. S9

10 Figure S5. 13 C NMR spectrum (500 MHz) of CaL ester in DMSO. Figure S6. Elemental composition report by Mass spectrum (MS) for CaL ester. S10

11 Figure S7. 1 H NMR spectrum (500 MHz) of CaL in DMSO. Figure S8. 13 C NMR spectrum (500 MHz) of CaL in DMSO. S11

12 Figure S9. Elemental composition report by Mass spectrum for CaL. Figure S10. FT-IR spectra of other characteristic groups of CaL. (a) the characteristic peaks emerged at 3039 cm -1 belongs to the stretching vibration of C-H from benzene. (b) The typical peaks of methyl and ethyl. (c, d) The typical peaks of C=O. (e) The characteristic peak of C-N. (f) The typical peak of ether connecting with benzene. S12

13 3.3 Characterition of CDs, DNA and nanoprobe Figure S11. (a) Diameter distribution of CDs. (B) AFM image of CDs. Insert is the height of CDs along the line shown in b. S13

14 Figure S12. (a) Mass spectrum of TPP conjugated onto DNA (D1-TPP). (b) Mass spectrum of FITC conjugated onto DNA (B1-FITC). (c) Mass spectrum of AF660 conjugated onto DNA (C1-AF660). S14

15 Figure S13. (a) Bio-fast AFM image of tdna. Inset shows overhead view of single tdna. Scale bar = 1 μm. (b) Native PAGE analysis of tdna. From left to right are Marker, tdna (ABCD), DNA-ABC, DNA-C 1 D, DNA-AB 1, DNA-A, DNA-B, DNA-C and DNA-D, respectively. tdna consists of four edges, named as DNA-A, DNA-B, DNA-C and DNA-D. Each edge consists of two short single DNA strand, for example, A=A 1 +A 2, B=B 1 +B 2, C=C 1 +C 2, D=D 1 +D 2. Figure S14. Dynamic light scattering (DLS) data of CD@CaL, tdna- TPP+FITC+AF660 and nanoprobe. S15

16 Figure S15. (a) Agarose electrophoresis (2%) analysis of tdna and nanoprobe. From left to right are cytoplasm, tdna, tdna incubated with cytoplasm for 12 h, tdna incubated with mitochondrial lysis for 12 h, the present nanoprobe the present nanoprobe incubated with cytoplasm for 12 h, the present nanoprobe incubated with mitochondrial lysis for 12 h, and mitochondrial lysis. (b) Normalized fluorescence intensity of FITC, and AF660 obtained from nanoprobe upon explored to Xe lamp (90 W). (c) Fluorescence stability of Rhod-2 AM probe upon explored to Xe lamp (90 W). Figure S16. (a) Absorption and emission spectra of DNA-FITC (1 μm). (b) Absorption and emission spectra of (0.3 mg/ml). (c) Absorption and emission spectra of DNA-AF660 (1 μm). (d) Absorption spectrum of nanoprobe S16

17 3.4 Fluorescence enhancement mechanism of towards Ca 2+ Figure S17. (a) Fluorescence lifetime decay of CDs and (b) Fluorescence lifetime decay of in the presence of different concentration of Ca 2+ (0, 150, 250, 350 and 450 μm). (c) UV-vis absorption spectra of in the presence of different concentration of Ca 2+ ion (0, 150, 250, 350 and 450 μm). (d) Typical absorption spectra of in the presence of different concentration of Ca 2+ ion (0, 150, 250, 350 and 450 μm) between 265 and 320 nm. 3.5 Calibration of nanoprobe by commercial probes Table S2. T-test results of Ca 2+ using Rhod-2 AM probe and our developed nanoprobe (α=0.05, f=4). Added Ca 2+ (μm) Rhod-2 AM probe (μm) Mean ± SD (n=3) Our nanoprobe (μm) Mean±SD (n=3) t (t α, f ) ± ± (2.78) ± ± (2.78) Figure S18. (a) Fluorescence spectra of FITC with different ph values (8.01, 7.74, 7.42, 7.11, 6.80, 6.51, 6.23, 5.91, and 5.60). (b) Calibration curves between fluorescence intensity and various ph values in a. S17

18 3.6 Cross-talk, FRET, selectivity and anti-interference investigation of nanosensor Figure S19. (a) Average lifetime of and AF660 in response to different ph values (7.9, 7.4, 7.0, 6.5 and 6.1). (b) Average lifetime of FITC and AF660 in response to various concentrations of Ca 2+ (0, 90, 210, 300 and 420 μm). The excitation wavelength was 488 nm. The lifetime of FITC at ph 7.4 consists of two components: 3.14 ns (95.26%) and 0.19 ns (4.74%), thus the average lifetime of FITC at ph 7.4 can be calculated as 3.00 ns. The lifetime of AF660 consists of two components: 2.35 ns (87.80%) and 0.30 ns (12.2%), thus the average lifetime of AF660 can be calculated as 2.10 ns. S18

19 Figure S20. Selectivity and competition tests of nanoprobe towards various (a, b) metal ions, (c, d) amino acids and (e, f) common ROS, respectively. The gray bars represent the influence of potential interferences to (a, c, e) FITC and (b, d, f) channels on the nanoprobe. The blue bars represent the subsequent change of 0.5 ph with the existence of potential interferences. The red bars represent the subsequent addition of Ca 2+ to the nanoprobe solution with potential interferences. The concentration of metal ions (except K +, Na + and Cu 2+ ): 300 μm. The concentrations of K +, Na + and Cu 2+ : 50 mm, 100 mm and 10 μm, respectively. S19

20 3.7 Cytotoxicity and biocompatibility of nanosensor and commercial probe Figure S21. (a) Viabilities of WT neurons after incubation for 24 h (grey bars) or 48 h (red bars) with different concentrations of nanoprobe at 37 C, respectively. (b) Viabilities of HeLa after incubation for 24 h (grey bars) or 48 h (red bars) with different concentrations of nanoprobe at 37 C, respectively. Figure S22. WT neurons incubated with nanosensor at concentrations of 0 μm (a), 5 μm (b), 20 μm (c) and 40 μm (d) for 24 h. S1, S2, and S3 represent the regions of early apoptotic, late apoptotic and dead cells, respectively. S20

21 Figure S23. HeLa incubated with nanosensor at concentrations of 0 μm (a), 5 μm (b), 20 μm (c) and 40 μm (d) for 24 h. S1, S2, and S3 represent the regions of early apoptotic, late apoptotic and dead cells, respectively. Figure S24. (a) Cell viabilities of WT neurons after incubated with different concentrations of Rhod-2 AM probe at 37 C for 24 h. (b-e) WT neurons incubated with Rhod-2 AM probe at concentrations of 0 μm (b), 5 μm (c), 20 μm (d) and 40 μm (e) for 24 h, respectively. S1, S2, and S3 represent the regions of early apoptotic, late apoptotic and dead cells, respectively. S21

22 3.8 Co-localization experiments of mitochondria-targeted nanoprobe Figure S25. Co-localization imaging experiments for the developed nanoprobe. (a) Confocal fluorescence microscopic images of HeLa cells treated with probe and MitoTracker Green before and after the cells were stimulated by CCCP for 5 min. (b) Confocal fluorescence microscopic images of neurons treated with tdna-tpp+cd@cal+af660 probe and MitoTracker Green after neurons stimulating by CCCP (2 μm) for 5 min. (c) Confocal fluorescence microscopic images of the neurons treated with tdna-tpp+cd@cal+af660 probe and MitoTracker Green after the neurons were stimulated by O - 2 with 20 min and aggregated Aβ 1-42 with 24 h, respectively. (d, e) Fluorescence emission spectra of (I) the developed nanoprobe before co-incubated with cells, (II) mitochondrial solution and (II) cytoplasmic solution. The mitochondrial and cytoplasmic solution were isolated and purified from the neurons after stimulated by (d) O - 2 with 20 min and (e) aggregated Aβ 1-42 with 24 h. Scale bars = 25 μm. S22

23 Figure S26. Confocal fluorescence microscopic images of (a) AF660 channel, (b) channel (c) MitoTracker Green channel from the neurons treated with tdna- probe and MitoTracker Green in another imaging plane (Z 2 position). (d) The overlay imaging of a and c. (e) The overlay imaging of bright field image and d. (f) Correlation image of a and c. Figure S27. (a) Confocal fluorescence microscopic images of neurons treated with tdna-tpp+cd@cal+af660 probe and MitoTracker Green in the presence of different ph values (7.8, 7.2 and 6.0). (b, c, d) Fluorescence emission spectra of (I) the developed nanoprobe before co-incubated with cells, (II) mitochondrial solution and (III) cytoplasmic solution. The mitochondrial and cytoplasmic solution were isolated and purified from neurons after the neurons co-incubated with the developed nanoprobe for 1 h at ph 7.8 (b), ph 7.2 (c) and ph 6.0 (d), respectively. S23

24 3.9 Ca 2+ and ph imaging in neurons using the developed nanoprobe and mixed probes Figure S28. (a) Confocal fluorescence microscopy images of WT neurons collected from FITC, and AF660 channels treated with nanoprobe in the presence of different concentration of Ca 2+ (0, 100, 200 and 400 μm), respectively. (b, c) Summary data for mitochondrial ph and Ca 2+ changes in a. F FITC, F CD@CaL and F AF660 were the fluorescence intensity collected in the range of , and nm from FITC, CD@CaL and AF660 channel, respectively. The excitation wavelength was 488 nm. Scale bar = 25 μm. Figure S29. (a) Confocal fluorescence microscopy images of WT neurons collected from FITC, CD@CaL and AF660 channels treated with nanoprobe at different ph (7.8, 7.2, 6.6 and 6.0), respectively. (b, c) Summary data for mitochondrial ph and Ca 2+ changes in a. F FITC, F CD@CaL and F AF660 were the fluorescence intensity collected in the range of , and nm from FITC, CD@CaL and AF660 channel, respectively. The excitation wavelength was 488 nm. Scale bar = 25 μm. S24

25 Figure S30. (a) Confocal fluorescence microscopy images of WT neurons collected from FITC, and AF660 channels treated with the mixed probe 2 (tdna-tpp+fitc, tdna- TPP+CD@CaL, and tdna-tpp+af660) in the presence of different concentrations of Ca 2+ (0, 100, 200 and 400 μm), respectively. (b, c) Summary data for mitochondrial ph and Ca 2+ changes in a. F FITC, F CD@CaL and F AF660 were the fluorescence intensity collected in the range of , and nm from FITC, CD@CaL and AF660 channel, respectively. The excitation wavelength was 488 nm. Scale bar = 25 μm. Figure S31. (a) Confocal fluorescence microscopy images of WT neurons collected from FITC, CD@CaL and AF660 channels treated with the mixed probe 2 (tdna-tpp+fitc, tdna- TPP+CD@CaL and tdna-tpp+af660) in the presence of different ph values (7.8, 7.2, 6.6 and 6.0), respectively. (b, c) Summary data for mitochondrial ph and Ca 2+ changes in a. F FITC, F CD@CaL and F AF660 were the fluorescence intensity collected in the range of , and nm from FITC, CD@CaL and AF660 channel, respectively. The excitation wavelength was 488 nm. Scale bar = 25 μm. S25

26 Table S3. F-test results of Ca 2+ using Rhod-2 AM probe and the mixed probes (α=0.05, f1 = f2 = 2). Added Ca 2+ (μm) Rhod-2 AM probe (μm) Mean ± SD (n=3) Mixed nanoprobe (μm) Mean ± SD (n=3) F (F α, f1,f2 ) ± ± (19) ± ± (19) Figure S32. (a) Fluorescence emission spectra of the developed nanoprobe, mixed probe 1 (DNA- FITC, DNA-TPP, DNA-AF660 and CD@CaL) and mixed probe 2 (tdna-fitc, tdna-tpp, tdna-af660 and CD@CaL). (b) Confocal fluorescence microscopy images of WT neurons collected from FITC, CD@CaL, and AF660 channels treated with the mixed probe 1 in the presence of different concentrations of Ca 2+ (0, 200 and 400 μm), respectively. (c) Confocal fluorescence microscopy images of WT neurons collected from FITC, CD@CaL, and AF660 channels treated with the mixed probe 1 with different ph values (7.8, 7.2 and 6.0) The effect of PcTX1 on O 2 - -induced neuron death Figure S33. Summary data of neuron viability stimulated by 20 μm O 2 - in the presence of 100 nm PcTX1 for different time (1, 5 and 15 h), respectively. For comparison, cell viability of ASIC1a -/- neurons stimulated by 20 μm O 2 - for different times (1, 5 and 15 h) were also conducted. S26

27 3.11 Co-localization experiments of cytoplasmic nanoprobe Figure S34. Co-localization imaging experiments for the developed cytoplasmic nanoprobe. (a) Confocal fluorescence microscopic images of the neurons treated with probe and CellTracker Green CMFDA before and after the neurons were stimulated by CCCP for 5 min. (b) Fluorescence emission spectra of (I) the developed nanoprobe before co-incubated with cells, (II) mitochondrial solution and (III) cytoplasmic solution. The mitochondrial and cytoplasmic solution were isolated and purified from the neurons after co-incubated with the present nanoprobe for 1 h. (c) Confocal fluorescence microscopic images of the neurons treated with tdna- CD@CaL+AF660 probe and CellTracker Green CMFDA after the neurons were stimulated by O - 2 with 20 min and aggregated Aβ 1-42 with 24 h, respectively. (d, e) Fluorescence emission spectra of (I) the developed nanoprobe before co-incubated with cells, (II) mitochondrial solution and (II) cytoplasmic solution. The mitochondrial and cytoplasmic solution were isolated and purified from the neurons after stimulated by (d) O - 2 with 20 min and (e) aggregated Aβ 1-42 with 24 h. (f) Confocal fluorescence microscopic images of the neurons treated with tdna-cd@cal+af660 probe and MitoTracker Green before and after the neurons were stimulated by CCCP for 5 min. Scale bar = 25 μm. S27

28 3.11 Confocal fluorescence images of neurons stimulated by O 2 - and Aβ Figure S35. Confocal fluorescence images of FITC, CD@CaL and AF660 channels with tdna- FITC+CD@CaL+AF660 probe (a) and tdna-tpp+fitc+cd@cal+af660 probe (b) at different time points. Scale bar = 25 μm. Figure S36. (a) Confocal fluorescence microscopy images of WT neurons collected from cytoplasmic FITC, CD@CaL and AF660 channels stimulated by 80 μm O - 2, 80 μm O - 2 in the presence of 2 mm GSH, 80 μm O - 2 in the presence of 300 μm DIDS, 80 μm O - 2 in the presence of 100 nm PcTX1, respectively. For comparison, the image of ASIC1a -/- neurons stimulated by 80 μm O - 2 was also obtained. (b) Summary data of O - 2 -induced cytoplamsic ph and Ca 2+ changes in a. Scale bar = 25 μm. S28

29 Figure S37. (a) Confocal fluorescence microscopy images of WT neurons collected from mitochondrial FITC, and AF660 channels after the neurons were stimulated by 80 μm O - 2, 80 μm O - 2 in the presence of 2 mm GSH and 80 μm O - 2 in the presence of 300 μm DIDS. (b) Summary data of mitochondrial ph and Ca 2+ changes in a. Scale bar = 25 μm. Figure S38. Confocal fluorescence microscopy images of WT neurons collected from cytoplasmic FITC, CD@CaL and AF660 channels treated with 50 μm Aβ 1-42 and 50 μm Aβ 1-42 in the presence of 200 nm PcTX1 after 24 h, respectively. F FITC, F CD@CaL and F AF660 were the fluorescence intensity collected in the range of , and nm from FITC, CD@CaL and AF660 channels, respectively. The excitation wavelength was 488 nm. Scale bar = 25 μm. S29