DEVELOPMENT OF A PCR INTERNAL AMPLIFICATION CONTROL FOR THE DETECTION OF SHIGA TOXIN PRODUCING ESCHERICHIA COLI

Transcription

1 Bull Vet Inst Pulawy 48, , 2004 DEVELOPMENT OF A PCR INTERNAL AMPLIFICATION CONTROL FOR THE DETECTION OF SHIGA TOXIN PRODUCING ESCHERICHIA COLI KINGA WIECZOREK AND JACEK OSEK Department of Hygiene of Food of Animal Origin, National Veterinary Research Institute, Puławy, Poland josek@piwet.pulawy Received for publication April 19, Abstract An internal amplification control (IAC) for the PCR-based method for the detection of Shiga toxin-producing E. coli is presented. IAC was constructed in order that the same primer can be applied to amplify the target DNA and coamplify with IAC, but gave the different size products. The primers have the 5 -end sequences identical to the diagnostic stx gene primers and the 3 -end sequences complementary to the appropriate puc19 plasmid sites. PCR amplification with target and puc19 DNAs gave two predicted PCR products without any non-specific bands. The obtained results showed that the presented method is sensitive and simple for standardization and can be utilized for specific identification of STEC in different matrices. Key words: E. coli, internal amplification control, PCR, false negative results. Polymerase chain reaction (PCR) offers the great possibility for the detection and molecular typing of food-borne pathogens, but there are some drawbacks of this method. The possibility of false-negative or falsepositive results are the most important pitfalls. Using proper equipment and anti-contamination procedures false-positive results can be avoided. False-negative results, which could be caused by substances inhibiting the polymerase enzyme, incorrect PCR mixture, or malfunction of the thermal cycler, turn a risk into a threat for the humans so, the chosen method should guarantee that the negative results are truly negative. If PCR mixture contains an internal amplification control (IAC), which is a non-target DNA sequence present in the same sample reaction and co-amplified simultaneously with the target sequence, a control signal will always be produced when the PCR has not failed. Thus, a positive IAC result indicates that DNA amplification has occurred. The IAC is usually distinguished from the target amplicon by a difference in molecular mass detectable by agarose gel electrophoresis (3, 9, 17, 19). There are various methods to create internal amplification control. One of them uses the same primer binding sequences as the target DNA but gives the IAC and the target gene products different in size. The use of internal standards in PCR analyses has been described previously for the detection of viruses and bacteria of medical significance (4, 5, 10, 13, 16). Shiga toxin-producing Escherichia coli (STEC) is one of the most important group of foodborne pathogens which are responsible for many serious diseases such as haemorrhagic colitis (HC) and haemolitic uraemic syndrome (HUS). STEC, with their most common serotype O157:H7, possess several virulence factors - among them the most important is Shiga toxin (Stx) existing in two main variants: Stx1 and Stx2 (15). In the present study the internal amplification control was designed and tested in PCR by using the stx gene of the reference strain E. coli B2, which belongs to serotype O157:H7. The used primers amplified Shiga toxin gene segments of all known Stx 1 or 2 types and these fragments were not detected in any of non-stec strains (11). IAC was constructed in order that the same primer pair can be applied to amplify the target DNA and co-amplify with puc19 but gave the products of different sizes (2, 19). The developed method should improve the detection and identification of STEC among other groups of clinical E. coli isolates, especially when rough material (e.g. meat) is used for the PCR analysis. Material and Methods DNA extraction. DNA of E. coli B2 strain was prepared for the PCR analysis using two approaches. For the first method, a genomic DNA isolation kit (Bio-Rad) was used according to the manufacturer s instruction. The purity and concentration of the DNA preparations were estimated using spectrophotometry at 260 and 280 nm. DNA was also prepared from whole cell suspension by suspending the

2 398 Luria Bertani (LB) grown bacteria in 1 ml of 0.85% NaCl and then centrifuged at g for 10 min to pellet the cells. The pellet was then resuspended in 0.85% NaCl, heated at 100 C for 10 min and then centrifuged as above. The resulted supernatant was used as DNA template for PCR amplifications. Primer design. The strategy of construction of the IAC is illustrated in Fig. 1. The primer sequences were designed in order that the 5 -ends of these primers are almost identical to the sequences of diagnostic primers MK1 TTTACGATAGACT TCTCGAC and MK2 - CACATATAAATTATTTCGCTC, which generate the PCR amplicon of 230 bp (11), whereas 3 - ends are complementary to the chosen puc19 commercial plasmid s sites (2, 19). The changes were made in diagnostic primers sequences such as the GCGC clamp was added to the 5 -ends in order to stabilize the annealing of the new long primer to its DNA target. The final IAC primers have the following sequences: MK1-1 GCTTTACGATAGACTTCTCGGGTGTTGG CGGGTGTC and MK2-1 GCGCCACATATAAATTATTTCGCTCGAGTGAGC G AGGAAGCGGAAGAGC. PCR amplification. The PCR mixture (50 µl) used for DNA amplification contained: 5 µl of the PCR buffer (10-times concentrated), 5 µl of dntps (Fermentas, Vilnius, Lithuania, final concentration 200 µm), 10 µl of MgCl 2 (final concentration 5 mm), 2.5 µl of each primer MK1-1 and MK2-1 (final concentration of 0.5 µm each), 2 µl (2 U) of the Taq thermostable DNA polymerase (Fermentas), 5 µl of the bacterial template DNA, 5 µl of the puc19 plasmid (different concentrations), and DNase-, RNase-free deionized water (Biomedicals). Amplification was carried out in a thermal cycler (PTC-100, MJ Research, Watertown, USA) using the following programme: one cycle of two minutes at 94 o C, followed by 30 cycles of one minute at 44 o C, one minute at 72 o C, one minute at 94 o C, and one final extension step for ten minutes at 72 o C. The analysis of the amplified products was performed in 2% agarose (Sigma) in Tris-Acetated EDTA (TAE) buffer at 100 V. The DNA bands were visualized by staining with ethidium bromide, analysed under UV light (300 nm) and photographed using the Gel Doc 2000 documentation system (Bio-Rad). Sensitivity of the PCR assay. To determine the sensitivity of the PCR test serial bacterial dilutions of E. coli B2 strain were prepared and the cells were counted both by using spectrophotometry at 600 nm and by determining the CFU on agar plates. A known number of B2 bacterial cells, ranging from 10 5 /ml to 5x10 1 /ml, were suspended in 1 ml of 0.85% NaCl then processed as described above and tested in the PCR according to conditions presented earlier. Each experiment was repeated three times. A MK1-1 GCGCGCTTTACGATAGACTTCTCGGGTGTTGGCGGGTGTC MK2-1 CACATATAAATTATTTCGCTCGAGTGAGCGAGGAAGCGGAAGAGC MK1 puc19 MK2 puc19 B C Fig. 1. Scheme of the construction of the PCR internal amplification control. A primers MK1-1, MK2-2 have the 5 -end sequences which are almost identical to those of the diagnostic primers MK1 and MK2 (bold letters) and the 3 -end sequences, which are complementary to the puc19 plasmid sites (italic and underlined letters); B designed primers bind with MK1 and MK2 parts to the stx target sequences of the STEC DNA, generating amplicon of 230 bp; C - designed primers with complementary sequences bind to the puc19 sites and produce the 630 bp PCR product.

3 399 Results The first PCR test was established to determine whether the suitable product for Shiga toxin genes (230 bp) will be observed when MK1-1 and MK2-1 primers were used. Initially, the different amount of E. coli B2 DNA was added without any internal amplification control (puc19). Both crude bacterial preparation and isolated DNA were used. Intensities of the PCR products observed corresponded to the dilutions of bacterial target DNA or to the amount of isolated DNA added to the PCR mixture (Fig. 2, lanes 1-6). Moreover, IAC (without target STEC DNA) and DNAnegative control were also tested. (Fig. 2, lanes 7 and 8, respectively). It was shown that the PCR amplifications gave predicted PCR product of 230 bp (stx gene) and IAC 630 bp (puc19 target) without any non-specific bands. Moreover, using the serial dilutions of puc19 DNA the optimal concentration, which coamplified with target bacterial DNA, was estimated for 1 pg/µl. To determine the detection limit, serial dilutions of purified genomic DNA of E. coli B2 were tested. The concentration 10 pg/µl gave the reliable band when PCR mixture with 1 pg/µl of puc19 DNA was used (Fig. 3). The sensitivity of the PCR assay with the internal amplification control was analysed with different numbers of E. coli B2 target bacterial cells added to the PCR mixture. The amount of bacteria tested was estimated using spectrophotometry at 600 nm and then confirmed by viable count method. The sensitivity of the assay was estimated to be between 110 and 50 CFU in 1 ml when 1 pg/µl of puc19 DNA was added (Fig. 4, lanes 5 and 6, respectively) and 950 to 110 in 1 ml in case of 2 pg/µl of puc19 included into the PCR mixture (Fig. 5 lanes 3 and 4, respectively). These results showed that sensitivity of the developed assay strongly depended on the amount of the internal control DNA applied into the PCR test. M M 630 bp 230 bp Fig. 2. The PCR results obtained with primers MK1-1 and MK2-1 and different bacterial and DNA concentrations; lane M, 100 bp DNA marker; lanes 1 3: PCR stx target product (230 bp) of E. coli B2 in concentrations: 10 4 /ml (lane 1), 10 3 /ml (lane 2) and 10 2 /ml (lane 3). Lanes 4 6: PCR product obtained with isolated bacterial DNA in concentrations: 50 pg/µl (lane 4), 10 pg/µl (lane 5), and 1 pg/µl (lane 6). Lane 7 - internal control product (630 bp) obtained with puc19 DNA, 1 pg/µl; lane 8 negative control (H 2 O). M bp 230 bp Fig. 3. The PCR results of bacterial target DNA and puc19 co-amplification; lane M, 100 bp DNA marker; lanes 1-5: internal amplification control product (630 bp) of puc19 in constant concentration 1 pg/µl and target DNA product (230 bp) of E. coli B2. Different concentrations of isolated bacterial DNA were used: lane pg/µl, lane 2-50 pg/µl, lane 3-10 pg/µl, lane 4 1 pg/µl, lane 5-0,5 pg/µl.

4 400 M M 630bp 230bp Fig. 4. The PCR results of crude bacterial target DNA and puc19 co-amplification; lane M, 100 bp DNA marker; lanes 1-6: internal amplification control product (630 bp) of puc19 in constant concentration 1 pg/µl and target DNA product (230 bp) of E. coli B2. Different bacterial cell numbers were used: lane /ml, lane /ml, lane /ml, lane 4 5x10 2 /ml, lane /ml, lane 6 5x10 1 /ml. M bp 230 bp Fig. 5. The PCR results of crude bacterial target DNA and puc19 co-amplification; lane M, 100-bp DNA marker; lanes 1-6: internal amplification control product (630 bp) of puc19 in constant concentration of 2 pg/µl and target DNA product (230 bp) of E. coli B2. Different bacterial cell numbers were used: lane /ml, lane /ml, lane /ml, lane /ml. Discussion There are several publications describing different PCR based methods for the detection STEC, especially those belonging to serotype O157 (7, 8, 14, 15). The limitation of the broad application of this technique as a molecular diagnostic tool is mainly the lack of validated and standardized protocols as well as variable quality of the PCR reagents and equipment. One of the important standardization steps is a multicenter collaborative trial and only these PCR tests can be used, which include the appropriate internal amplification control for monitoring the sample inhibitors (12). Abdulmawjood et al. (1) elaborated diagnostic PCR assay based on amplification of the rfbe gene, including an internal amplification control, for the specific detection of E. coli O157. This method was developed and validated in the collaborative trial. The obtained results showed that the PCR test was reproducible between laboratories as well as repeatable within one laboratory. It should be mentioned that this was the first published E. coli O157 assay which included an IAC. The aim of the present study was to develop an IAC which could be used for simultaneous amplification of the target bacterial Shiga toxin gene and commercial puc19 plasmid. This approach is very important for the indication of possible PCR inhibitors derived from the sample tested. Many previous studies demonstrated that the inclusion of IAC into PCR tests improves the reliability of the assays for bacterial identification in e.g. meat or meat products. However, it was difficult to compare the present approach with other IACs since different construction methods and target bacterial DNA were used (5, 6, 10). Internal amplification control according to Sachdyn et al. (19) and developed previously by Abdulmawjood et al. (2) as well as in the present study seems to be simple to standardize; it also possesses a sufficient sensitivity. This approach also makes possible avoiding complicated and time consuming cloning procedures used previously by other authors (4, 5, 20). The matter under discussion is the appropriate concentration of IAC DNA which always competes with the target DNA and could give false negative results. Rosenstraus et al. (18) determined the amount of target DNA required to suppress the IAC

5 401 signal by testing a set of samples that contained the increasing amount of target DNA. Nevertheless, once the optimal concentration of IAC is determined, the examined PCR-based method shall appear to be useful for detection of food born pathogens (2). This statement was also proved in our analysis. In conclusion, the method of internal amplification control construction used in the present study is very fast and comprehensive. The obtained results suggested that, after additional studies, it could be very useful for monitoring PCR inhibiting components which are very often present in food samples. References 1. Abdulmawjood A., Bulte M., Cook N., Roth S., Schonenbrucher H., Hoorfar J.: Toward an international standard for PCR-based detection of Escherichia coli O157. Part 1. Assay development and multi-center validation. J Microbiol Methods 2003, 55, Abdulmawjood A., Roth S., Bulte M.: Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction. Mol Cell Probes 2002, 16, Altwegg M.: General problems associated with diagnostic applications of amplification methods. J Micrbiol Methods 1995, 23, Ballagi-Pordány, A., Belák S.: The use of mimics as internal standards to avoid false negatives in diagnostic PCR. Mol Cell Probes 1996, 10, Betsou F., Beaumont K., Sueur J.M., Orfila J.: Construction and evaluation of internal control DNA for PCR amplification of Chlamydia trachomatis DNA from urine samples. J Clin Microbiol 2003, 41, Cubero J., van der Wolf J., van Beckhoven J., Lopez M. M.: An internal control for the diagnosis of crown gall by PCR. J Microbiol Methods 2002, 51, Fach P., Perelle S., Grout J., Dilasser F.: Comparison of different PCR tests for detecting Shiga toxinproducing Escherichia coli O157 and development of an ELISA-PCR assay for specific identification of the bacteria. J Microbiol Methods 2003, 55, Gryko R., Sobieszczanska B.M., Stopa P.J., Bartoszcze M.A.: Comparison of multiplex PCR, and an immunochromatographic method sensitivity for the detection of Escherichia coli O157:H7 in minced beef. Acta Microbiol Pol 2002, 51, Hoorfar J., Cook N., Malorny B., Wagner M., De Medici D., Abdulmawjood A., Fach P: Making internal amplification control mandatory for diagnostic PCR. J Clin Microbiol 2003, 41, Jacobson M., Englund S., Ballagi-Pordany A.: The use of a mimic to detect polymerase chain reactioninhibitory factors in feces examined for the presence of Lawsonia intracellularis. J Vet Diagn Invest 2003, 15, Karch H., Meyer T.: Single primer pair for amplifying segments of distinct Shiga-like-toxin genes by polymerase chain reaction. J Clin Microbiol 1989, 27, Malorny B., Tassios P.T., Radstrom P., Cook N., Wagner M., Hoorfar J.: Standardization of diagnostic PCR for the detection of foodborne pathogens. Int J Food Microbiol 2003, 83, Moalic P. Y., Gesbert F., Kempf I.: Utility of an internal control for evaluation of a Mycoplasma meleagridis PCR test. Vet Microbiol 1998, 15, Osek J.: Development of a multiplex PCR approach for the identification of Shiga toxin-producing Escherichia coli strains and their major virulence factor genes. J Appl Microbiol 2003, 95, Osek J., Dacko J.: Development of a PCR-based method for specific identification of genotypic markers of shiga toxin-producing Escherichia coli strains. J Vet Med B 2001, 48, Pham D. G., Madico G. E., Quinn T. C., Enzler M. J., Smith T. F., Gaydos C. A.: Use of lambda phage DNA as a hybrid internal control in a PCR-enzyme immunoassay to detect Chlamydia pneumoniae. J Clin Microbiol 1998, 36, Rijpens N.P., Herman L.M.: Molecular methods for identification and detection of bacterial food pathogens. J AOAC Int 2002, 85, Rosenstraus M., Wang Z., Chang S.Y., DeBonville D., Spadoro J.P.: An internal control for routine diagnostic PCR: design, properties, and effect on clinical performance. J Clin Microbiol 1998, 36, Sachadyn P., Kur J.: The construction and use of a PCR internal control. Mol Cell Probes 1998, 12, Stocher M., Leb V., Berg J.: A convenient approach to the generation of multiple internal control DNA for a panel of real-time PCR assays. J Virol Methods 2003, 108, 1-8.