Staphylococcus Clinical Strains

Transcription

1 ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, June 1993, p /93/ $02.00/0 Copyright 1993, American Society for Microbiology Vol. 37, No. 6 Distribution of mec Regulator Genes in Methicillin-Resistant Staphylococcus Clinical Strains EIKO SUZUKI,' KYOKO KUWAHARA-ARAI,1 JUDITH F. RICHARDSON,2 AND KEIICHI HIRAMATSUl* Department of Bacteriology, Juntendo University, Hongo, Bunkyo-ku, Tokyo, Japan,' and Central Public Health Laboratory, London, England2 Received 28 September 1992/Accepted 24 March 1993 The distributions of the mec regulator genes meci and mecr1, which were identified on the chromosome of meca-carrying Staphylococcus aureus N315, in methicillin-resistant staphylococci isolated in Japan and various countries were studied. Screening by dot blot hybridization by using polymerase chain reaction (PCR)- amplified probes revealed that at least the 5'-end region of the mecri gene was present in all strains tested, whereas about 40% of the strains were negative for the meci gene. The data suggested that these regulator genes were the original components of the additional mec region DNA of methicillin-resistant S. aureus as well as methicillin-resistant, coagulase-negative staphylococci of seven staphylococcal species (S. epidermidis, S. haemolyticus, S. hominis, S. sciuri, S. capitis, S. caprae, and S. warneri). The meci gene, which presumably codes for the repressor protein of the meca gene, was found to harbor a point mutation in all six meci-positive methicillin-resistant S. aureus strains, and their basal level of meca gene transcription was elevated compared with that of strain N315, which harbors a presumably intact counterpart of the meci gene. The data suggested that the meci gene encodes for a strong repressor function on meca gene transcription and is deleted or mutated in clinical methicillin-resistant S. aureus strains with high levels of resistance to methicillin. The intrinsic resistance of methicillin-resistant Staphylococcus aureus (MRSA) has been explained by the production of a characteristic penicillin-binding protein (PBP), designated PBP 2' or PBP 2a, that has a decreased binding affinity for beta-lactam antibiotics (2, 6-8, 40). The structural gene meca, which encodes PBP 2', has been cloned (22, 37) and has been found to be distributed among different species of staphylococci (3, 16, 23, 30, 33, 34, 36, 38). The nucleotide sequence and the predicted amino acid sequence of the meca gene suggest that the gene has evolved by fusion of the regulator region of a penicillinase (PCase) gene complex with the structural gene of a PBP of unknown origin (32). Even though the structural gene meca, which encodes for PBP 2', is located on the chromosome, it has been shown to be regulated by the PCase plasmid which is present in most MRSA strains (4, 21, 39). Elimination of the PCase plasmid from the cell changes the inducible mode of PBP 2' production to the constitutive mode in some MRSA strains (12, 27, 39). Recently, however, the chromosomal regulator region which down-regulates methicillin resistance has been identified by Tesch et al. (35) in methicillin-resistant S. epidermidis WT55 and by us (10, 20) in S. aureus N315. This regulatory region was located upstream of the meca gene. Subsequent nucleotide sequence determination of the region has identified two regulator genes, mecrl and meci (EMBL Accession no. X54660) (10), whose predicted protein sequences have strong homology with those of the staphylococcal bla regulator genes blai and blari (28) as well as those of Bacillus licheniformis (14, 17). The presence of the meci-mecrl regulator genes in some staphylococcal strains has been shown to be correlated with a strong repression of the meca gene, a very slow induction of meca gene transcription in the presence of inducer beta-lactams, and a low or marginal level of methicillin resistance (29). N315 is one of * Corresponding author the strains for which the methicillin MIC is low and is characteristic in its mode of PBP 2' production (20, 24); induced production of PBP 2' by N315 is achieved by stimulation with latamoxef or cefoxitin, but not with methicillin, and this inducibility is not abolished by elimination of the PCase plasmid from N315, suggesting the regulatory role of the meci-mecrl genes present on the chromosome of this strain (11, 24). In the study described here we investigated the distribution of the mec regulator genes among a methicillin-resistant population of clinical staphylococcal strains in order to understand the role of these presumptive regulator genes in the evolution of MRSA. We also studied the nucleotide sequences of the meci genes carried by these clinical strains as well as the transcription level of their meca genes in comparison with those of the meci and meca genes of strain N315 for a possible correlation of the integrity of the meci gene and its repressive function on meca gene transcription. (Part of this work was presented at the 32nd Interscience Conference on Antimicrobial Agents and Chemotherapy [34a].) MATERIALS AND METHODS Bacterial strains. A total of 26 epidemic strains of MRSA isolated from various countries were obtained from the collection of the Central Public Health Laboratory, Colindale, England. A total of 20 MRSA strains and 27 methicillinresistant, coagulase-negative staphylococcal (C-NS) strains were isolated in Japan from 1981 to They were isolated from clinical specimens of individual inpatients at three hospitals in Japan. All of the C-NS strains used in the present study have been described previously (34). The methicillin MICs for these strains were determined by the plate dilution method by using Mueller-Hinton agar plates with an inoculum size of 1 x 104 to 5 x 104 CFU of bacteria according to the recommendation of National Committee for

2 1220 SUZUKI ET AL. mecl mecrl meca D?."" A 1 Kb FIG. 1. Genomic organization of the mec region of S. aureus N315. The locations of the probes are indicated by the thick lines: A, meca gene probe; B, mecri gene probe MS; C, mecrl gene probe PB; D, meci gene probe. The arrows indicate the direction of transcription of each structural gene. Clinical Laboratory Standards (23). Growth of the cells was evaluated after incubation for 24 h at 32 C. DNA probes for hybridization. The locations of the four probes used for the detection of mec region sequences are indicated in Fig. 1. The meca probe, corresponding to nucleotides 1050 to 1335 of the reported nucleotide sequence of the meca gene (32), was prepared by amplification by the polymerase chain reaction as described previously (11). The three other probes were prepared by amplification by the polymerase chain reaction by using synthetic oligonucleotide primers according to the previous sequence data for the mec regulator genes (10). One of the mecri gene probes, designated MS (membrane spanning), representing the transmembrane domain of the mecri gene was prepared by using primers 5'-GTCTCCACG1TAATTCCATT-3' and 5'-GTCG TTCATTAAGATATGACG-3', which corresponded to the nucleotides from positions 357 to 376 and to the complementary nucleotides from positions 646 to 666, respectively, of the reported nucleotide sequence of mecri gene (10). The other mecri gene probe, designated PB (penicillin binding), representing the penicillin-binding domain of the mecri gene, was prepared by using the primers 5'-CAGGGAAT GAAAATITATfGGA-3' and 5'-CGCTCAGAAATFITGYTG TGC-3', which corresponded to the reported nucleotides from positions 1636 to 1656 and the complementary nucleotides from positions 1935 to 1954, respectively, of the mecri gene. The meci gene probe corresponding to the whole meci structural gene was prepared by using 5'- AATGGCGAAAAAGCACAACA-3' and 5'-GACTfGATT GT'llCCTCTGTT-3' as primers, which corresponded to the nucleotides from positions 1923 to 1942 and to the complementary nucleotides from positions 2283 to 2403, respectively, of the previously reported sequence data (10). For the C-NS strains, which were negative for the two mecri probes, the detection of the most proximal portion of the mecri gene by the polymerase chain reaction was performed by using the synthetic oligonucleotides 5'- ATCCTCCTTLATATAAGACTAC-3' and 5'-CATATCGTG AGCAATGAACTG-3' as primers, which corresponded to the nucleotides from positions 130 to 150 of the promoter region of the meca gene and the complementary nucleotides from positions 257 to 277 of the mecri gene, respectively (10). DNA dot blot hybridization. Cellular DNA was extracted from staphylococcal strains as described previously (5, 34) after lysing cell pellets with achromopeptidase (dissolved in 10 mm NaCl to 50,000 U/ml; Wako Pure Chemical, Osaka, Japan). Five microliters of each DNA solution containing about 100 ng of DNA was blotted onto a nylon membrane (Biodyne A; Pall Biosupport, Glen Cove, N.Y.) and was cross-linked by UV irradiation. Hybridization was performed by using digoxigenin-labeled DNA probes (100 ng of ANTIMICROB. AGENTS CHEMOTHER. DNA was labeled with a digoxigenin DNA labeling kit; Boehringer, Mannheim, Germany) under standard hybridization conditions as described previously (11). The hybridized filters were washed twice in lx SSC (lx SSC is 0.15 M NaCl plus M sodium citrate with 0.1% sodium dodecyl sulfate (SDS) for 5 min at room temperature, then once in 1 x SSC with 0.1% SDS for 30 min at 68 C, and then in 0.1x SSC with 0.1% SDS for 30 min at 68 C. Visualization of the signals was achieved by using an alkaline phosphataseconjugated antidigoxigenin antibody (Boehringer) and a chemiluminescent substrate (AMPPD; Tropix, Bedford, Mass.) by the procedure recommended by the manufacturer. RNA blot hybridization. RNA extraction was performed as described by Kornblum et al. (19). An overnight culture was diluted 20-fold in 20 ml of L broth and was incubated at 37 C with shaking to a cell density of 7 x 108 CFU/ml. Then, methicillin or cefoxitin was added to the culture at a concentration of 1,ug/ml. The induction time was ended by transferring a 0.7-ml portion of the culture to a 1.5-ml microcentrifuge tube containing 0.7 ml of prechilled (0 C) acetone-ethanol (1:1; vol/vol). Cells were collected by centrifugation at 15,000 x g for 2 min at 4 C, and then the supematant was removed. The cell pellet was resuspended in 0.25 ml of lysis buffer (100,ug of lysostaphin per ml, 20% sucrose, 20 mm Tris-HCl [ph 7.6], 10 mm EDTA, 50 mm NaCl), and the mixture was incubated for 10 min on ice. Cell lysis was completed by the addition of 0.25 ml of 2% SDS. Ten microliters of proteinase K (5 mg/ml in H20) was immediately added, and the mixture was quickly frozen in a dry ice-ethanol bath. The lysate was thawed at 45 C for 10 min and was extracted twice with phenol and once with phenol-chloroform-isoamyl alcohol (25:24:1); this was followed by ethanol precipitation. Digestion with DNase I and further purification steps were performed as described previously (1). The concentration of RNA was determined by measuring the optical densities at 260 and 280 nm. For slot blot hybridization, 2.0, 0.67, and 0.22,ug of RNA were blotted onto a nylon membrane (Biodyne B; Pall) by using the Bio-Rad slot blot apparatus. Hybridization was carried out in hybridization solution (50% formamide, 5 x SSC, 2% blocking reagent [Boehringer] 0.1% N-lauroylsarcosine, 1% SDS) containing 20 ng of the digoxigenin-labeled meca gene probe (see above) per ml for 16 h at 42 C. The hybridized filter was washed twice in 2x SSC with 0.1% SDS for 15 min at 68 C. Visualization of the signal was achieved as described above for DNA dot blot hybridization. The exposure time to the X-ray film was 30 min for all the experiments. DNA sequencing. The nucleotide sequence of the meci gene of MRSA was determined by the dideoxynucleotide termination method of Sanger et al. (31) by using the synthetic oligonucleotides as primers. The same set of primers used to prepare the meci gene probe was used for sequence determinations. Direct sequencing of the genomic DNAs of MRSA strains was carried out by using the PCR-amplified DNA fragments (with 30 thermal cycles of 95 C for 30 s, 50 C for 30 s, and 72 C for 2 min) as templates, after elution and purification of these by agarose gel electrophoresis. RESULTS Distribution of the mec regulator genes in MRSA clinical strains. A total of 26 MRSA strains isolated from various countries were analyzed by dot blot hybridization with the digoxigenin-labeled mecrl and meci probes to determine whether they carried mec regulator genes (Table 1). The

3 VOL. 37, 1993 mec REGULATOR GENES IN STAPHYLOCOCCI 1221 TABLE 1. Distributions of mec regulator genes in MRSA strains isolated from various countries Methicillin MIC Strain Country G/m)mecIPBM meca NCTC England 1, /6219 England /3846 England /4176 England mecrla 86/4372 England > 1, /1340 Yugoslavia 1, /1762 Hungary > 1, /1836a Germany (West) 1, /2082 New Zealand 1, /2111 Norway > 1, /2147 Hong kong >1, /3907 Germany (East) >1, /560 England /961a England /2652 England /5495 Saudi Arabia 1, /5328a Portugal /3619 Austria > 1, /3566 Holland 1, /2235 United States 1, /9580 South Africa >1, /9302 England /1774 Italy /4231 Canada > 1, /2232a United States >1, /4547 Israel 1, KA03 Japan <4 a Strains whose meci gene nucleotide sequences were determined. mecri probe MS, corresponding to the 310 bp of the transmembrane domain of the mecrl structure gene, hybridized with all of the tested strains. On the other hand, the mecri probe PB, corresponding to the 319 bp of the penicillin-binding domain of the mecri structure gene, hybridized only with 17 of 26 strains (65%). These 17 strains were also found to be positive for the meci probe (Table 1). The specificities of the mec gene probes that we used were verified by hybridizing these probes with purified DNA of S. aureus KA03 (18), which was introduced with the PCase plasmid derived from an MRSA strain, MR108 (Table 1), and also with up to 100 ng of the purified PCase plasmid DNA (data not shown). Therefore, it was concluded that the mec gene probes hybridized specifically with the mec region of DNA on the chromosome but not with the homologous bla regulator genes on the PCase plasmid. These hybridization studies showed that at least a portion of the 5'-end region of the mecri gene is carried by all MRSA strains isolated from various countries in various years. Dot blot hybridization analysis of mec regulator genes was performed with the high-level-resistant and the borderlineresistant MRSA strains isolated in Japan (Table 2). The distributions of the mec regulator genes among these strains were practically the same as those among MRSA strains from various countries; that is, the mecrl gene probe, MS, hybridized with all of the tested strains, whereas the mecrl gene probe, PB, and the meci gene probe hybridized with only 9 of 20 strains (45%). There was no correlation between the level of resistance and the presence or absence of mec regulator genes (Table 2); of the 8 high-level-resistant MRSA strains (MICs, >128,ug/ml), 5 strains (62.5%) were found to carry the meci gene, and of the 8 borderline-resistant MRSA strains (MICs, 3.13 or 6.25,ug/ml), 3 strains (38%) were found to carry the meci gene. Because seven of eight borderline-resistant strains (JO13, J018, J029, J056, J059, J060, and Y3) were the characteristic heterogeneous-type MRSA strains (11), the result indicated that the mere presence or absence of the meci gene does not correlate with the heterogeneous or homogeneous modes of resistance expression. Distributions of the mec regulator genes in methicillinresistant C-NS clinical strains. A total of 27 C-NS strains of seven species isolated in Japan were analyzed for the distributions of their mec regulator genes (Table 3). Of 27 C-NS strains, 24 were found to carry at least the 5' portion of the mecrl gene. The probe hybridized with all strains of the following species: S. epidermidis, S. caprae, S. hominis, S. sciuri, S. capitis, and S. warnei. However, S. haemolyticus strains (JB5, JB16, and JA178) were all negative for the two mecrl gene probes MS and PB. In order to test whether the more 5'-proximal portion of the mecri gene is conserved in the genomes of these S. haemolyticus strains, detection of the 5' end of mecrl gene was done by the polymerase chain reaction. The specific DNA bands were detected in all three S. haemolyticus strains and were the same size as that of strain N315. Therefore, at least the 53-bp 5'-end portion of the mecri gene was shown to be carried by all C-NS strains tested, including the S. haemolyticus strains. On the other hand, the PB mecri gene probe hybridized with 19 of 27 strains (70%) and the meci gene probe hybridized with 16 of 27 strains (60%). Three strains, S. epidermidis JA16L, S. caprae JA184, and S. caprae JA187, were remarkable in that

4 1222 SUZUKI ET AL. ANTIMICROB. AGENTS CHEMOTHER. TABLE 2. Distributions of mec regulator genes in high-level and borderline-resistant MRSA strains isolated in Japan Strain resistance type S Methicillin MIC mecre and yr of isolation Stram (,ug/ml)a meci PB MS meca High-level resistant 1981 MR108 > MR61 > MR6 > /19 > /20b > /22 > /25b > /27 > Borderline resistant, heterogeneous 1981 Y J J J J J J Borderline resistant, homogeneous, / a The MICs for borderline-resistant strains, which were described previously (9), were determined at 37 C. b The strain whose meci gene nucleotide sequence was determined. they were positive for the PB mecrl gene probe but were contained both meci and mecrl genes, they seemed to negative for the meci gene probe. Because the signal inten- retain a nearly complete mecrl structural gene. sities of hybridization of the mecrl gene probe PB with mecigenes are mutated in highly resistant MRSA strains. In these strains were comparable to those with the strain which order to determine the integrity of the meci gene in the TABLE 3. Distributions of mec regulator genes in methicillin-resistant, C-NS strains Methicillin MIC Strain Species (~Lg/ml) meipb Ms nc Ti S. epidermidis > T2 S. epidermidis > T4 S. epidermidis > T55 S. epidermidis JB45 S. epidermidis JA140 S. epidermidis JA16L S. epidennidis JA26 S. epidermidis > JA173 S. epidermidis JA175 S. epidermidis JA183 S. epidennidis > JA188 S. epidermidis > JA193 S. epidermidis > JB5 S. haemolyticus JB16 S. haemolyticus JA178 S. haemolyticus JB8 S. hominis JB21 S. hominis JB9 S. sciuri JB64 S. sciuri T12 S. caprae > JB74 S. caprae JA184 S. caprae > JA186 S. caprae > JA187 S. caprae > JB103 S. capitis > JB36 S. wameri mecri

5 VOL. 37, 1993 mec REGULATOR GENES IN STAPHYLOCOCCI 1223 ATGGATAATAAAACGTATGAAATATCATCTGCAGAATGGGAAGTTATGAATATCATTTGGATGAAAAAATATGCAAGTGCGAATAATATA 90 MetAspAsnLysThrTyrAspIleSerSerAlaGluTrpGluValMetAsnIleIleTrpMetLysLysTyrAlaSerAlaAsnAsnIle (A) 85/2232(U.S.A.) ATAGAAGAAATACAAATGCAAAAGGACTGGAGTCCAAAAACCATTCGTACACTTATAACGAGATTGTATAAAAAGGGATTTATAGATCGT 180 IleGluGluIleGlnMetGlnLysAspTrpSerProLysThrIleArgThrLeuIleThrArgLeuTyrLysLysGlyPheIleAspArg T 86/961(England), 85/1836(Germany), 85/5328(Portugal) A 87/20, 87/25(Japan) AAAAAAGACAATAAAATTTTTCAATATTACTCTCTTGTAGAAGAAAGTGATATAAAATATAAAACATCTAAAAACTTTATCAATAAAGTA 270 LysLysAspAsnLysIlePheGlnTyrTyrSerLeuValGluGluSerAspIleLysTyrLysThrSerLysAsnPheIleAsnLysval Asn TACAAAGGCGGTTTCAATTCACTTGTCTTAAACTTTGTAGAAAAAGAAGATCTATCACAAGATGAAATAGAAGAATTGAGAAATATNrTG 360 TyrLysGlyGlyPheAsnSerLeuValLeuAsnPheValGluLysGluAspLeuSerGlnAspGluIleGluGluLeuArgAsnIleLeu AATAAAAAA 369 AsnLysLys FIG. 2. Premature termination of the meci gene in MRSA clinical strains. In strain 85/2232, the T at position 143 was deleted, causing the gene to be prematurely terminated at position 145. In three strains (86/961, 85/1836, and 85/5328), a nucleotide substitution (C to T) was found at the position 202, producing a new termination codon (indicated by triple asterisks). In two strains from Japan (87/20 and 87/25), a nucleotide substitution from T to A was observed at position 260, which caused an amino acid substitution from Ile to Asn. meci-carrying MRSA strains, the nucleotide sequences of the meci genes were determined by using six arbitrarily chosen MRSA strains (85/2232, 86/961, 85/1836, 85/5328, 87/20, and 87/25). It was found that the meci genes in all six MRSA strains suffered from point mutations (Fig. 2). Premature termination of the meci gene was observed in four MRSA strains: one nucleotide deletion (T at position 143) that caused premature termination of the meci gene at position 145 in strain 85/2232 and one nucleotide substitution (C to T at position 202) that produced a new termination codon at position 201 in strains 86/961, 85/1836, and 85/5328. An amino acid substitution in the deduced meci gene product was observed in two strains (87/20 and 87/25); that is, one nucleotide substitution from T to A at position 260 caused an amino acid substitution from Ile to Asn (Fig. 2). Derepressed meca gene transcription in clinical strains with mutated meci genes. In order to determine whether meca gene transcription is derepressed in strains with mutated meci genes as well as those without a meci gene, a dot blot hybridization experiment with a meca gene probe was performed (Fig. 3). As a control, strain N315P (a derivative of strain N315 without the PCase plasmid), which carries an intact meci gene, was used. With N315P, meca gene transcription was scarcely visible before and even after stimulation with methicillin (Fig. 3A). An identical result was obtained with the parent strain N315 harboring the PCase plasmid (data not shown). The concentration of methicillin used to stimulate each strain was varied from 0.1 to 1.0,ug/ml, giving the same results as those presented in Fig. 3 (data not shown). However, the high level of transcription was observed with strains 87/20 (Fig. 3B) and 87/25 (data not shown), which carry the meci gene with an amino acid substitution (from Ile to Asn) in the predicted protein (Fig. 2). The amount of meca gene transcripts in these strains was unchanged before and after stimulation with methicillin; that is, the transcription was constitutive, which probably was associated with the fact that neither of the strains carried the PCase plasmid (data not shown). In contrast, efficient induction of meca gene transcription by stimulation with methicillin was observed with a PCase-positive strain, 85/1836 (Fig. 3C), an isolate containing a stop codon introduced in the midst of the meci gene (Fig. 2). However, the basal meca gene transcription level (before drug stimulation) in this strain was found to be about nine times greater than that in N315P. Essentially the same result that was obtained with strain 85/1836 was obtained with strains 85/2232, 86/961, and 85/5328, which carry mutations in their meci genes, as well as with strains MR108 and MR6, which have no meci gene (data not shown). Therefore, meca gene transcription was A FIG. 3. meca gene transcription before and after stimulation with methicillin in strain N315P and clinical MRSA strains with mutated meci genes. The RNAs (2, 0.66, and 0.22 plg, from the top in each column) of strains N315P (A), 87/20 (B), and 85/1836 (C), which were extracted before (lanes 1) and at is min (lanes 2), 30 mi (lanes 3), 45 min (lanes 4), and 60 min (lanes 5) after stimulation with 1 p.g of methicillin per ml, were blotted onto the nylon membrane; this was followed by hybridization with the meca gene probe. PCase was produced by strain 85/1836, but not by strain N315P or 87/20. -4

6 1224 SUZUKI ET AL. ANTIMICROB. AGENTS CHEMOTHER. mecl mecrl meca MRSA MR-CNS A :~s I % 59.3% B 0% 11.1% C 40.5% 18.5% D G 0% 11.1% 1 Kb FIG. 4. Schematic grouping of the mec regulator region and its prevalence in MRSA and methicillin-resistant C-NS strains. (A) The strain carrying the whole mec regulator region. The meci gene harbors a point mutation (indicated by an asterisk). (B) The strain whose meci gene was deleted, but that retained a nearly complete mecrl gene. (C) The strain whose meci gene and nearly half of the 3' end of the mecrl gene were deleted. (D) The strain carrying only the 5' end of mecrl gene. The last type was observed only in S. haemolyticus strains. derepressed in all eight strains tested whether their meci gene was mutated or deleted. DISCUSSION The presumptive repressor gene meci, identified on the chromosome of strain N315 upstream of the meca gene, was carried by 59.5% of the MRSA strains and 59.3% of the C-NS clinical strains of six species tested. On the other hand, the 5' end of mecri gene was present in all tested strains belonging not only to the species S. aureus but also the species S. epidermidis, S. haemolyticus, S. hominis, S. caprae, S. sciun, S. capitis, and S. wameni. This wide distribution of at least a portion of the mec regulator genes among various staphylococcal species suggests that they were the original components of the additional mec region of DNA and once were the intrinsic regulators of meca gene transcription. Recently, Tesch et al. (35) have identified the mec regulator region in a methicillin-resistant S. epidermidis strain, WT55, whose mecrl and meci gene nucleotide sequences are almost identical to those of S. aureus N315 (EMBL Accession no. X54660), except that two nucleotides are deleted from the meci gene of strain WT55, causing a frame shift and an extensive difference in the amino acid composition of the predicted meci gene product of WT55. The derangement of the meci gene sequence of WT55 is possibly a cloning artifact; S. aureus DNA fragments cloned into an Escherichia coli host are very frequently accompanied by sequence derangements, such as mutations or deletions (9). For this reason, in our previous study (10), the nucleotide sequences of N315 mec regulator genes were confirmed by direct sequencing of genomic DNA. When nucleotide sequences per se were compared, however, the mec regulator regions derived from two different staphylococcal species were found to be extremely well conserved. This observation may well be explained by postulating that the entire mec regulator region, together with the meca gene, is transmitted actively from one staphylococcal species to another by an as yet unknown mechanism (34). A rough grouping of the mec regulator region of the MRSA and C-NS strains are presented in Fig. 4. Two major types were observed in MRSA strains (A and C in Fig. 4), whereas four types were found in methicillin-resistant C-NS strains (A, B, C, and D in Fig. 4). There seem to be more varieties of the mec regulator region in methicillin-resistant C-NS strains than in MRSA strains. It is of interest that MRSA strains from three different countries (England, Germany, and Portugal) shared a common point mutation in the meci gene, while the strains from the United States and Japan shared another one (Fig. 2). Sequencing of the meci gene combined with more detailed mapping of the deletion endpoint of mecrl (Fig. 4) in each strain may be a useful tool for the evolutionary as well as the epidemiological study of methicillin-resistant staphylococcal strains widely distributed throughout the world. It is curious that the first reported MRSA strain, NCTC 10443, which was isolated in 1961 in England, lacked the meci gene in its genome, although it possessed the 5' portion of the mecrl gene. A similar result, that the meci gene is absent in MRSA strains isolated in the 1960s, was recently reported by Hurlimann-Dalei et al. (13). This may be interpreted as follows. The old epidemic strains of MRSA carried only the meca gene, and the mec regulator genes were acquired at a later time. We have, however, found that the additional MRSA-specific DNA fragments that map at more than 7 kb upstream of the meci gene do exist in all of the MRSA strains, which was shown by a dot blot hybridization experiment by using cloned genomic DNA fragments from N315 as probes (15). Therefore, we consider that it is more likely that the old epidemic MRSA strains lost the meci gene by a deletional event after they had acquired the meci gene as an original component of the additional MRSA-specific DNA. According to the homology with bla regulator genes, the mecrl and the meci genes are considered to encode the coinducer and repressor proteins, respectively, that are specific for the regulation of methicillin resistance. An S. aureus strain, which carries a complete set of mecrl and meci genes (10), strain N315, is characteristic in that the production of PBP 2' is not inducible with methicillin, and the strain is considered to be susceptible to methicillin according to the standard plate dilution MIC determination recommended by the National Committee for Clinical Laboratory Standards (20, 24). meca gene transcription of strain N315 was also nonresponsive to methicillin stimulation (Fig. 3). In view of these characteristics of N315, it is tempting to hypothesize that the meci-mecrl regulator system is not responsive to methicillin in PBP 2' induction, thus causing relative methicillin susceptibility, and that the repression

7 VOL. 37, 1993 caused by this regulator system should be destroyed and replaced by the bla regulator system (the bla regulator genes have been shown to regulate meca gene transcription [26]) for the efficient induction of resistance to occur in response to methicillin. This hypothesis may be supported by the observation that the clinical MRSA strains, for which the methicillin MICs are definitely high, as measured by a standard plate dilution method, either do not have the meci gene (40.5%) or have point mutations in their meci genes, as far as we have tested. The observation that the basal levels (in the absence of inducers) of meca gene transcription in these clinical MRSA strains were at least severalfold greater than that in N315 also coincides well with this hypothesis (Fig. 3). Another observation in support of this hypothesis was provided by our recent experiments, as follows. By selecting with methicillin-containing medium, methicillinresistant subclones were obtained from strain N315 at high frequencies (10-5 to 10-6). The nucleotide sequences encompassing the whole meca regulator region (including the meca promoter region and the mecrl and meci genes) of these subclones were analyzed (so far, six independent subclones have been tested). All of the subclones were found to carry point mutations in their meci genes, whereas the other parts of the mec regulator region remained intact. The basal levels of meca gene transcription of these strains were raised at least severalfold compared with that of parent strain N315 (20). If the hypothesis described above holds true, it follows that the majority of clinical MRSA strains have emerged following two steps of genetic alteration; the first step was acquisition of the meca gene, together with its intrinsic regulator genes, and the second step was either the deletional loss or the mutational inactivation of the meci gene to achieve derepression of meca gene transcription. However, it is premature to conclude unequivocally that the meci gene encodes the repressor function and that those mutations of meci genes found in clinical MRSA strains as well as in methicillin-resistant N315 subclones really inactivate the repressive function of the meci gene product. Final proof of this hypothesis awaits comparative quantitation of meca gene transcription in the presence of an intact as well as mutated meci genes by cloning and introducing these meci genes into a restriction-negative S. aureus laboratory strain. ACKNOWLEDGMENT This work was supported by grant from the Japanese Ministry of Education. REFERENCES 1. Ausbel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.) Current protocols in molecular biology. John Wiley & Sons, Inc., New York. 2. Brown, F. J., and P. E. Reynolds Intrinsic resistance to beta-lactam antibiotics in Staphylococcus aureus. FEBS Lett. 122: Chambers, H. F Coagulase-negative staphylococci resistant to beta-lactam antibiotics in vivo produce penicillin-binding protein 2a. Antimicrob. Agents Chemother. 31: Chambers, H. F., B. J. Hartman, and A. Tomasz Increased amounts of a novel penicillin-binding protein in a strain of methicillin-resistant Staphylococcus aureus exposed to nafcillin. J. Clin. Invest. 76: Dyer, D. W., and J. J. landolo Rapid isolation of DNA from Staphylococcus aureus. Appl. Environ. Microbiol. 46: Georgopapadakou, N. H., S. A. Smith, and D. P. Bonner mec REGULATOR GENES IN STAPHYLOCOCCI 1225 Penicillin-binding proteins in a Staphylococcus aureus strain resistant to specific beta-lactam antibiotics. Antimicrob. Agents Chemother. 22: Hartman, B. J., and A. Tomasz Low-affinity penicillinbinding protein associated with beta-lactam resistance in Staphylococcus aureus. J. Bacteriol. 158: Hayes, M. V., N. A. C. Curtis, A. W. Wyke, and J. B. Ward Decreased affinity of a penicillin-binding protein for betalactam antibiotics in a clinical isolate of Staphylococcus aureus resistant to methicillin. FEMS Microbiol. Lett. 10: Hiramatsu, K. Unpublished data. 10. Hiramatsu, K., K. Asada, E. Suzuki, K. Okonogi, and T. Yokota Molecular cloning and nucleotide sequence determination of the regulator region of meca gene in methicillin-resistant Staphylococcus aureus. FEBS Lett. 298: Hiramatsu, K., H. Kihara, and T. Yokota Analysis of borderline-resistant strains of methicillin-resistant Staphylococcus aureus using polymerase chain reaction. Microbiol. Immunol. 36: Hiramatsu, K., E. Suzuki, H. Takayama, Y. Katayama, and T. Yokota Role of penicillinase plasmids in the stability of the meca gene in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 34: Hurlimann-Dalei, R. L., C. Ryffel, F. H. Kayser, and B. Berger- Bachi Survey of the methicillin-associated genes meca, mecri-meci, and fema-femb in clinical isolates of methicillinresistant Staphylococcus aureus. Antimicrob. Agents Chemother. 36: Imanaka, T., T. Himeno, and S. Aiba Cloning and nucleotide sequence of the penicillinase antirepressor genepenj of Bacillus licheniformis. J. Bacteriol. 169: Ito, T., E. Suzuki, and K. Hiramatsu. Unpublished data. 16. Kanda, K., E. Suzuki, K. Hiramatsu, T. Oguri, H. Miura, T. Ezaki, and T. Yokota Identification of a methicillinresistant strain of Staphylococcus caprae from a human clinical specimen. Antimicrob. Agents Chemother. 35: Kobayashi, T., Y. F. Zhu, N. J. Nicholls, and J. 0. Lampen A second regulatory gene, blari, encoding a potential penicillin-binding protein required for induction of P-lactamase in Bacillus licheniformis. J. Bacteriol. 169: Kondo, I., and Y. Yoshizawa Transformation in the staphylococcal system. Zentralbl. Bakteriol. Parasitenkd. Infektionskr. Hyg. Abt. 1 Orig. 14: Kornblum, J. S., S. J. Projan, S. L. Moghazeh, and R. P. Novick A rapid method to quantitate non-labeled RNA species in bacterial cells. Gene 63: Kuwahara-Arai, K., E. Suzuki, and K. Hiramatsu. Unpublished data. 21. Lacey, R. W Antibiotic resistance in Staphylococcus aureus and streptococci. Br. Med. Bull. 40: Matsuhashi, M., M. D. Song, F. Ishino, M. Wachi, M. Doi, M. Inoue, K. Ubukata, N. Yamashita, and M. Konno Molecular cloning of the gene of a penicillin-binding protein supported to cause high resistance to beta-lactam antibiotics in Staphylococcus aureus. J. Bacteriol. 167: National Committee for Clinical Laboratory Standards Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 2nd ed. Approved standard, NCCLS document M7-A2. National Committee for Clinical Laboratory Standards, Villanova, Pa. 24. Okonogi, K., Y. Noji, M. Kondo, A. Imada, and T. Yokota Emergence of methicillin-resistant clones from cephamycinresistant Staphylococcus aureus. J. Antimicrob. Chemother. 24: Pierre, J., R. Williamson, M. Bornet, and L. Gutmann Presence of an additional penicillin-binding protein in methicillin-resistant Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, and Staphylococcus simulans with a low affinity for methicillin, cephalothin, and cefamandole. Antimicrob. Agents Chemother. 34: Projan, S. J. Personal communication. 27. Rossi, L., E. Tonin, Y. R. Cheng, and R. Fontana Regulation of penicillin-binding protein activity: description of a

8 1226 SUZUKI ET AL. methicillin-inducible penicillin-binding protein in Staphylococcus aureus. Antimicrob. Agents Chemother. 27: Rowland, S. J., and K. G. H. Dyke TnS52, a novel transposable element from Staphylococcus aureus. Mol. Microbiol. 4: Ryffel, C., F. H. Kayser, and B. Berger-Bachi Correlation between regulation of meca transcription and expression of methicillin resistance in staphylococci. Antimicrob. Agents Chemother. 36: Ryffel, C., W. Tesch, I. Birch-Machin, P. E. Reynolds, L. Barberis-Maino, F. H. Kayser, and B. Berger-Bachi Sequence comparison of meca genes isolated from methicillinresistant Staphylococcus aureus and Staphylococcus epidermidis. Gene 94: Sanger, F., S. Nicklen, and A. R. Coulson DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: Song, M. D., M. Wachi, M. Doi, F. Ishino, and M. Matsuhashi Evolution of an inducible penicillin-target protein in methicillin-resistant Staphylococcus aureus by gene fusion. FEBS Lett. 221: Stratton, C. W., M. S. Gelfand, J. L. Gerberding, and H. F. Chambers Characterization of mechanisms of resistance to beta-lactam antibiotics in a methicillin-resistant strain of Staphylococcus saprophyticus. Antimicrob. Agents Chemother. 34: Suzuki, E., K. Hiramatsu, and T. Yokota Survey of methicillin-resistant clinical strains of coagulase-negative staphylococci for meca gene distribution. Antimicrob. Agents ANTIMICROB. AGENTS CHEMOTHER. Chemother. 36: a.Suzuki, E., K. Kuwahara-Arai, and K. Hiramatsu Program Abstr. 32nd Intersci. Conf. Antimicrob. Agents Chemother., abstr Tesch, W., C. Ryffel, A. Strassle, F. H. Kayser, and B. Berger- Bachi Evidence of a novel staphylococcal mec-encoded element (mecr) controlling expression of penicillin-binding protein 2'. Antimicrob. Agents Chemother. 34: Tesch, W., A. Strassle, B. Berger-Bachi, D. O'Hara, P. Reynolds, and F. H. Kayser Cloning and expression of methicillin resistance from Staphylococcus epidermidis in Staphylococcus carnosus. Antimicrob. Agents Chemother. 32: Ubukata, K., R. Nonoguchi, M. Matsuhashi, and M. Konno Expression and inducibility in Staphylococcus aureus of the meca gene, which encodes a methicillin-resistant S. aureusspecific penicillin-binding protein. J. Bacteriol. 171: Ubukata, K., R. Nonoguchi, M. D. Song, M. Matsuhashi, and M. Konno Homology of meca gene in methicillin-resistant Staphylococcus haemolyticus and Staphylococcus simulans to that of Staphylococcus aureus. Antimicrob. Agents Chemother. 34: Ubukata, K., N. Yamashita, and M. Konno Occurrence of a beta-lactam-inducible penicillin-binding protein in methicillinresistant staphylococci. Antimicrob. Agents Chemother. 27: Utsui, Y., and T. Yokota Role of an altered penicillinbinding protein in methicillin- and cephem-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 28: Downloaded from on December 29, 2018 by guest