Recombineering and its application for tailor made production strains. Marlen Schmidt Gene Bridges GmbH. June 2016

Transcription

1 Recombineering and its application for tailor made production strains Marlen Schmidt Gene Bridges GmbH June 2016

2 Gene Bridges founded in 2000 EMBL spin-off no venture capital located at Technology Park Heidelberg exclusive rights for commercialization of patents regarding recombination based on l red genes or rece/rect genes filed by EMBL

3 Recombineering Recombination-mediated genetic engineering mediated by a protein pair: Reda/b from l phage or RecE/T from Rac prophage linear DNA molecule necessary short homology arms from bp no limitation to restriction sites no specific recombination sites required nucleotide-precise at any desired position applicable to any DNA engineering tasks on very large constructs efficient genetic engineering of E. coli by targeted gene knock-outs or knock-ins and other user defined modifications

4 Application of recombineering: efficient genetic engineering of E. coli strain development

5 Production strain improvement: E. coli BL21(DE3) deletion of E. coli chromosome region (knock-out) Example 1 removal of 89% (= 38 kb) DE3 prophage sequence from E. coli chromosome improved safety regarding plaque formation (phage activity) E. coli BL21(DE3) modified strain E. coli T7E1

6 Production strain improvement: E. coli BL21(DE3) deletion of E. coli chromosome region (knock-out) consistent bacteria growth and heterologous protein expression pattern in comparison to wildtype E. coli BL21(DE3) Example 1 E. coli T7E1

7 Production strain improvement: E. coli BL21(DE3) gene knock-in in E. coli T7E1 gluconoylation E. coli BL21(DE3) is pgl-deficient PGL catalyzes hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate prevents accumulation and random gluconoylation of cellular proteins Example 2

8 Production strain improvement: E. coli BL21(DE3) gene knock-in in E. coli T7E1 gluconoylation Example Da Da

9 Production strain improvement: E. coli BL21(DE3) gene knock-in in E. coli T7E1 Example 2 integration of pgl gene from E. coli MG1665 in the genome of E. coli T7E1, while simultaneous removing of cryptic Rac prophage no gluconoylation of heterologous expressed protein at all in modified strain E. coli T7E2, in contrast to 6.4% gluconoylation of the target protein in wildtype no undesired gluconoylation E. coli BL21(DE3) E. coli T7E2 Noll et al., 2013, Gezielte Optimierung von Escherichia coli BL21(DE3), Biospektrum, 19, 211

10 Production strain improvements: E. coli T7E2 gene knock-in: genomic integration of expression cassette genomic expression construct Example 3 oric E. coli T7 E2 approx. 4,570 kb T7RNAP pgl ter circular map of the E. coli T7 E2 genome and potential expression cassette integration sites

11 Production strain improvements: E. coli T7E2 gene knock-in: genomic integration of expression cassette genomic expression construct Example 3 kda M Site 1 Site 2 Site 3 Site 4 plasmid t0 t4 t0 t4 t0 t4 t0 t4 M t0 t4 batch fermentation of E. coli T7E2 genomic expression constructs ml, 37 C, 225 rpm, + 1mM IPTG without antibiotics!

12 Plasmid maintenance without antibiotics collaboration with University of Stockholm/PlasEX AB transfer of an essential gene to the plasmid Example 4 conventional aat infa serw infa-based aat serw E. coli BL21(DE3) E. colibl21(de3) ΔinfA infa laci pt7 TNFα pqe-t7-tnfα 5746 bp ori km R km R laci pt7 pqe-t7-infa- TNFα 5345 bp ori infa TNFα WO A3 infa coding for translation factor 1, IF1 Hägg et al., 2004, Journal of Biotechnology 111: 17-30

13 Plasmid maintenance without antibiotics collaboration with University of Stockholm/PlasEX AB Example BL21(DE3) pqe-t7-tnfa kda t o t 1 t 2 t 3 t 6 t 9 t 12 BL21(DE3) DinfApQE-infA-T7-TNFa kda t o t 1 t 2 t 3 t 6 t 9 t 12 lg OD600nm 1 BL21(DE3) pqe-t7-tnfa BL21(DE3) DinfApQE-infA-T7-TNFa TNFa TNFa 0,1 t 1 t 2 t 0 t 3 t 6 t 9 t t (min) TB km 50 TB favorable from cost and safety perspectives applicable in defined and broth media; no risk of cross-feeding WO A3

14 Plasmid maintenance without antibiotics collaboration with University of Stockholm/PlasEX AB Example lg OD kda t 0 t 1 t 2 t 3 t 6 t 9 t 12 TNFα cfu x ,1 t 0 t 1 t 2 t 3 t 6 t 9 t t (min) 0 LB LB cm 50 WO A3

15 Pathway engineering: multiple knock-outs enhancing succinate production GLC?ptsG Example 5 G6-P F6-P improved succinate production up to 47% F1,6-P DHAP GAP DHA LAC dhaklm?ldha?adhe PEP PYR AC -CoA EtOH?pykA?pykF?pflB ACTP AC?pta?ackA FOR OA MAL CO 2 FUM E. coli (MG1655) WT H 2 DpflB, DldhA S1 SUCC DackA-pta, DpykA, DpykF DdhaKLM S2 DpflB, DldhA, DadhE S3 DackA-pta, DpykA, DpykF DdhaKLM, DptsG S4 DackA-pta, DpykA, DpykF DdhaKLM, DptsG, DadhE S5

16 Pathway engineering: genomic knock-ins Example 6 promoter fine tuning replacement of native genomic localized pgi promoter (fused to lacz) by a synthetic promoter library: N 5 TTGACAN 17 TATAATN 5 AAATCAGAAGAGTATTGCTAATG promoter sequences with 25% 570% activity of native promoter in blue white screening Braatsch et al., 2008, Escherichia coli strains with promoter libraries constructed by Red/ET recombination pave the way for transcriptional fine-tuning, BioTechniques, 45, 335

17 ycce agp ycce agp Multiple knock-outs: eliminating prophage Mu: approx. 37 kda E. coli G Mu prophage (37 kb) Example 7 Km R cassette 1 E. coli G::km R FRT-Cm R -FRT cassette 2 tail fiber proteins E.coli ΔMu::cm R kb M PCR ΔMu 3 PCR E.coli ΔMu 0,8 0,6 0,4 Lösch et al., 2007, Red/ET Recombination. λ vs. Mu: base-precise modification of the E. coli genome, BIOspektrum

18 picture.: Weizmann Institute of Science Genomic knock-ins: reporter fusion in cooperation with Weizmann Institute of Science, Israel cfp FRT drug R FRT Example 8 target gene selection 1 target gene - cfp FRT drug R FRT Flp-recombination 2 target gene - cfp FRT Arbel-Goren et al., 2013, Effects of post-transcriptional regulation on phenotypic noise in Escherichia coli, Nucl. Acid Res., 9, 4825

19 Other applications 1) Boston Mountain Biotech, USA - Lotus platform, links downstream contaminating host cell proteins (HCPs) to potential upstream cell line modifications - identifying cellular proteins that exert the greatest burden on downstream processing and then shutting off these genes in the production strain - Lotus E. coli manufacturing platform: Separatome-based protein expression and purification platform (US ), cataloged E. coli s separatome collection of proteins that bind to the purification column, and subsequent knock-out of the corresponding genes

20 Other applications 2) BAC-based Expression System Technology in mammalian cells (BESTcell TM ) stable mammalian cells for bio-production (The Antibody Lab GmbH, Austria) - reliable high yield expression - shorten timeline to stable clones in comparison to classical methods - utilizing BACs as carriers - expression independent of the integration site in the host chromatin - expression dependent on the copy numbers integrated - high levels of expression - expression should be stable over time Zboray et al., 2015, Heterologous protein production using euchromatin-containing expression vectors in mammalian cells, Nucl. Acid Res., doi: /nar/gkv475

21 Gene Bridges recombineering technology and experience enables a defined and rapid access to any chromosomal and plasmid modification for your strain optimization. Please contact: Dr. Marlen Schmidt Business marlen.schmidt@genebridges.com Gene Bridges GmbH P Im Neuenheimer Feld 584 F Heidelberg Germany