Our goal is to enable the analysis of any living thing, by any person, in any environment.

Transcription

1 Technology 1

2 2

3 Our goal is to enable the analysis of any living thing, by any person, in any environment. Nanopore DNA and direct RNA sequencing has been performed on board the International Space Station. Image composite credit: NASA s Johnson Space Center. 3

4 Nanopore sequencing How it works The nanopore processes the length of DNA or RNA presented to it. The user can control fragment length through the library preparation protocol utilised. (e.g. >2 Mb DNA has been recorded 1.) An enzyme motor controls the translocation of the DNA or RNA strand through the nanopore. Once the DNA or RNA has passed through, the motor protein detaches and the nanopore is ready to accept the next fragment. Nanopore reader DNA or RNA fragments pass through a nanoscale hole. The fluctuations in current during translocation are used to determine the DNA or RNA sequence. An electrically resistant membrane means all current must pass through the nanopore, ensuring a clean signal. The nanopore signal, captured by the ASIC in the device, is characteristic of the sequence of the DNA or RNA fragment. Algorithms are used to convert the signal into basecalled sequence data. 4

5 Sequencing with 1D and 1D 2 reads Translocation 1D The template and the complement strands are sequenced as individual strands. 1D analysis delivers high data yields from a wide variety of sample types. Library prep Whether using 1D or 1D 2, library preparation results in the addition of a sequencing adapter at each end of the fragment. Both the template and complement strands carry the motor protein which means both strands are able to translocate the nanopore. Template......Template... (Exit) Next molecule Y-adapter Y-adapter Translocation 1D 2 1D 2 library preparation deploys special adapters that increase the probability that the complement strand will immediately follow the template strand. This method of sequencing when used with 1D 2 analysis produces a higher accuracy read. Library DNA Template......Template... (Exit)...Complement 5

6 Only Oxford Nanopore can make all these possible 6

7 Long reads Real time Direct sequencing Scalable and cost efficient Choose your read lengths; <1 kb 100s kb Easier assembly Resolution of structural variants & repeat regions Full-length transcripts Sequence data available within seconds of adding sample User-controlled start & stop of experiments Rapid insight into sample status Fast species identification Sequence native DNA and RNA, not a copy Sequence with no amplification bias Access base modification information for DNA and RNA Phase modified bases with long reads One technology across all devices scale according to your needs $1,000 for MinION Starter Pack to ultra highthroughput PromethION No CapEx required Barcoding for even more samples Portable On demand Streamlined library prep New insights Take sequencing into the field Minimal lab and IT equipment required Simple ~10-minute library prep Sequence sample at source Sequence what you need, when you need it no sample batching required Portable, USB-powered MinION TM GridION TM X5 / PromethION TM with modular flow cells Enough data? Stop, wash and run again later Rapid 10-minute library prep Minimal hands-on time Straightforward protocols & expert support Automated, portable prep VolTRAX De novo assembly of any size genome Analysis of the real transcriptome Genomic variation with phasing Microbe identification in mixed populations 7

8 Long reads Real time Direct Scalable Portable On demand Streamlined New insights The power of long reads With nanopore sequencing, read lengths are only limited by the size of the DNA or RNA fragment presented to the device allowing users to generate the most suitable read lengths for their requirements. Reads in excess of 2 Mb have been published1. For DNA: Simplify de novo assembly and improve reference genomes2,3,4 Resolve structural variations and repetitive regions2,3,4 Investigate linkage and phasing2,5 Enable rapid metagenomic species ID and distinguish plasmid from genome6,7 We ve demonstrated the impact of ultra-long reads on assembly contiguity and their facility to resolve areas of the genome that have proven intractable to short-read sequencing, including telomeres, centromeres and highly variable regions. Dr. Matt Loose University of Nottingham Like a puzzle with larger pieces, the longer the read, the easier the assembly. Short read 8 Long read

9 For RNA: Characterise full-length transcripts 8 Quantify and study isoforms, splice variants and fusions 9,10,11 [Our results] demonstrate the power of long-read nanopore sequencing to elucidate the true nature of expressed genes. Dr. Michael Clark Garvan Institute of Medical Research Long nanopore reads can span full-length transcripts, simplifying their identification. 9

10 Long reads Real time Direct Scalable Portable On demand Streamlined New insights Real-time analysis Unlike traditional sequencing techniques that deliver data in bulk at the end of a run, nanopore technology provides dynamic, real-time sequencing for immediate access to results. Achieve results within minutes for time-critical applications such as pathogen identification 12,13 Stop sequencing once a result has been reached, wash and reuse flow cell * Get early sample insights, such as sample ID and quality Selectively sequence specific target molecules using Read Until 14 * Subject to maximum recommended run time per flow cell. We detected the first viral reads just 7 seconds after the start of sequencing. Dr. Sebastiaan Theuns Ghent University 10

11 Immediate access to results Example EPI2ME workflows The cloud-based EPI2ME platform provides easy access to a number of real-time data analysis workflows. What s In My Pot (WIMP) species-level identification and quantification of microbes from metagenomic samples ARMA builds on the WIMP workflow with full antibiotic resistance profiling Rapid identification and quantification of metagenomic samples using WIMP 16S genus-level identification of bacteria and archaea in metagenomic samples Human Alignment align human genomes and exomes against the GRCh38 reference 11

12 Long reads Real time Direct Scalable Portable On demand Streamlined New insights Direct sequencing of DNA and RNA Nanopore sequencing does not require amplification, strand synthesis or bisulfite conversion, reducing bias and allowing detection of modified bases alongside the nucleotide sequence. Sequence native DNA and RNA, not a copy Save time and money no need for bisulfite sequencing Eliminate sources of bias capture the true biological diversity Accurately quantify and characterise RNA isoforms using long, direct reads 9 Log count PCR-cDNA Direct cdna Direct RNA Pearson r = 0.048; p = 8.6 e GC content Log count Pearson r = 0.016; p = GC content Log count Pearson r = 0.013; p = GC content Nanopore sequencing provides accurate representation of sequence complexity regardless of GC content. We believe that direct RNA sequencing will become a versatile tool for transcriptome analysis in the complete genome era of the future. Dr. Intawat Nookaew University of Arkansas for Medical Sciences 12

13 Identification of modified bases Long, direct nanopore sequencing reads enable detection and phasing of modified bases (e.g. 5mC, pseudouridine, m6a) with all signals captured in raw data, allowing analysis at any time 9,15,17. X Human SSU rrna 88 bp 580 bp 590 bp 600 bp 610 bp 620 bp 630 bp 640 bp 650 bp 660 [0-0.99] Proportion of reads modified (Tombo prediction) Reference rrna modifications UA A AUCCUUUA ACGAGGAUCCAUUGGAGGGCA AGUCUGGUGCCAGCAGCCGCGGUA AUUCCAGCUCCA AUAGCGUAUAUUA A AGUUGC Am (2 -O-methyl A) Am Gm (2 -O-methyl G) Y (pseudouridine) Um (2 -O-meU) Gm Y Y Tombo, one of a number of analysis tools allowing the detection of modified bases from nanopore data. Methylation data can directly be obtained from the same WGS data set which makes time-consuming bisulfite conversion and specialized methylation assays (sequencing or hybridization-based) expendable. Dr. Philipp Euskirchen Institut du Cerveau et de la Moelle épinière 13

14 Long reads Real time Direct Scalable Portable On demand Streamlined New insights Scalable, cost-efficient sequencing Nanopore sequencing is fully scalable, delivering cost-efficient analysis for all applications and experimental requirements from small, single tests using Flongle, to the sequencing of very large genomes or sample numbers using GridION or PromethION. Adaptable to DNA and RNA sequencing Same library prep kits used across all devices scale according to your needs Select the device based on the amount of data required or the number of samples to be analysed Choose the number of flow cells used and the time they are used for Barcode up to 96 samples for even higher sample throughput and affordability Run nanopore sequencing in-house or outsource to a certified service provider Nanopore service provider Incorporating Oxford Nanopore technology into our service options allows us to provide a new enhanced genome service to our customers that delivers top quality genome assemblies for challenging microbial applications. Microbes NG Birmingham, UK View nanopore service providers in your area and find out how to become one at 14

15 No capital investment required Smartphone sequencing (in development) A MinION and GridION flow cell adapter for smaller tests or experiments Portable, USB-powered biological analysis 10s of Gb per flow cell Start sequencing immediately with a $1,000 starter pack Five flow cells As much as 150 Gb when utilising all five flow cells Available for sequencing service CapEx and OpEx options available High-throughput, high-sample number benchtop system 1,000s of Gb when utilising all 48 flow cells Available for sequencing service CapEx and OpEx options available In development Early access We ve gone from a situation where you can only do genome sequencing for a huge amount of money in well-equipped labs to one where we can have genome sequencing literally in your pocket just like a mobile phone. Dr. Nick Loman University of Birmingham PromethION generates such a lot of data in such a consistent way that we can more easily access any genome. Dr. Hans Jansen Future Genomics 15

16 Long reads Real time Direct Scalable Portable On demand Streamlined New insights Portable and accessible Oxford Nanopore is committed to increasing access to sequencing technology, opening new applications for field- and lab-based study. PREPARE SEQUENCE ANALYSE Library prep in as little as ten minutes with minimal lab equipment Portable automated library preparation with VolTRAX Sequence with MinION at sample source for rapid results Powered using the USB port on a laptop or the MinIT device and small enough to fit in a pocket, the MinION is uniquely transportable Analyse samples in real-time and collect more samples if required Local- or cloud-based analysis options using MinIT or a laptop 16

17 Using the MinION in Antarctica. Image courtesy of Dr. Sarah Stewart Johnson, Georgetown University. 17

18 Long reads Real time Direct Scalable Portable On demand Streamlined New insights On-demand sequencing Sequencing that puts you in control sequence what you need, when you need it, with no sample batching required. Run as many or as few samples as you need Enough data? Stop, wash and reuse the flow cell* MinION sequence anything, anywhere GridION X5 and PromethION deliver fully flexible, modular sequencing start and stop individual experiments and flow cells as required PromethION get as much as 200 Gb per flow cell and 9,600 Gb total yield** The GridION and PromethION platforms give us the flexibility to undertake a diverse range of projects from large whole genome studies to concurrent analysis of multiple DNA and RNA sequencing projects. The facility to use flow cells independently, in combination with real-time data streaming, has significantly enhanced our sequencing workflow. Dr. Lei Liu GrandOmics * Subject to maximum recommended run time per flow cell. ** Yield based on current internal PromethION Flow Cell performance of 200 Gb (January 2019). 18

19 Flexible, modular sequencing Start and stop individual flow cells as required Run many experiments simultaneously No sample batching required 19

20 Long reads Real time Direct Scalable Portable On demand Streamlined New insights Streamlined library preparation A range of streamlined library preparation products are available, with the same kits used across all devices delivering fully scalable sequencing to suit your experimental requirements. Rapid kits with simple 10-minute prep Ligation kits deliver high-performance libraries in 60 mins DNA / 115 mins RNA Sequence DNA and RNA directly or use amplification for lower inputs or targeted methods Barcoding and wash kits available for sample multiplexing Portable automated library preparation is available with VolTRAX The use of fast, simple and reliable tools for detection and identification of microbial life will help researchers respond to rapidly changing conditions and communities, or help direct hypotheses while in the field instead of post analysis in the lab. This is especially important in remote and hard to sample areas. Dr. Jacqueline Goordial McGill University 20

21 Expert support A range of support and training options are available, allowing you to rapidly implement and optimise nanopore sequencing for your chosen application. Comprehensive support is provided as standard, with direct access to our technical specialists Regular workshops at Oxford Nanopore s offices or on-site training courses Rapid starter days, bespoke consultancy and more Find out more about our support options at store.nanoporetech.com/services Nanopore Community All nanopore users get open access to the Nanopore Community, a thriving online hub supporting scientists to maximise the benefits of long-read, real-time nanopore sequencing. Optimise your experimental workflow using the online protocol builder Post your questions to expert users and browse the extensive knowledge base Network and collaborate with your peers Get the latest protocols and software downloads Discover more about the Nanopore Community at 21

22 Long reads Real time Direct Scalable Portable On demand Streamlined New insights Long-read, real-time nanopore sequencing provides new biological insights for a range of applications 22

23 Whole genome sequencing De novo assembly Scaffolding and finishing Variant analysis: structural variation Variant analysis: SNVs, phasing Resequencing Targeted sequencing Panels-amplicons, sequence capture, exome 16S rrna analysis Variant analysis: structural variation Variant analysis: SNVs, phasing RNA sequencing Direct RNA Splice structural variant analysis Transcriptome / gene expression Fusion transcript analysis snrna, mirna, ncrna Metagenomics Real-time, unbiased analysis of mixed samples Epigenetics Methylation Histone modification Non-coding RNA activity 23

24 Integrated real-time sequencing and analysis workflow Library preparation kits * (optional) Preparation Real-time sequencing * Flongle in development. 24

25 Bioinformatic capability needed EPI2ME TM Use the cloud-based EPI2ME platform for real-time analysis workflows. epi2me.nanoporetech.com/workflow Protocol builder Follow analysis recommendations provided by Oxford Nanopore Technologies in the protocol builder. community.nanoporetech.com Real-time analysis Communitydeveloped tools Run open-source tools written and developed by the Nanopore Community. community.nanoporetech.com Custom analysis pipelines All the data, raw or basecalled, can be used in custom analysis pipelines written by the user for specific applications. Get more information about implementing nanopore sequencing at 25

26 References 1. Payne, A. et al. biorxiv (2018). 2. Jain, M. et al. Nat Biotechnol 36(4): (2018). 3. Keller, M.W. et al. biorxiv (2018). 4. Michael, T.P. et al. Nat Commun. 9(1):541 (2018). 5. Cretu Stancu, M. et al. Nat Commun. 8(1):1326 (2017). 6. Pendleton, K.M. et al. Am J Respir Crit Care Med. 196(12): (2017). 7. Wick, R.R. et al. Microb Genom. 3(10) e (2017). 8. Oikonomopoulos, S. et al. Scientific Reports 6:31602 (2016). 9. Garalde, D.R. et al. Nat Methods. 15(3): (2018). 10. Minervini, C.F. et al. Exp Mol Pathol. 103(1):33-37 (2017). 11. Clark, M.B. et al. biorxiv (2018). 12. Greninger, A. L. et al. Genome Med 7, 99 (2015). 13. Batovska, J. et al. J Virol Methods 249:79-84 (2017). 14. Loose, M. et al. Nat Methods. 13(9):751-4 (2016). 15. Alexa, B.R. et al. biorxiv (2017). 16. Rand, A.C. et al. Nat Methods. 14(4): (2017). 26

27 27

28 Oxford Nanopore Technologies phone +44 (0) Oxford Nanopore Technologies, the Wheel icon, EPI2ME, Flongle, GridION, Metrichor, MinION, MinIT, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore Technologies in various countries. All other brands and names are the property of their respective owners Oxford Nanopore Technologies. All rights reserved. Flongle, GridION, MinION, PromethION and VolTRAX are currently for research use only. 28