Supplementary Table 1. Patients characteristics. n (%) or Mean±SD

Transcription

1 Supplementary Table 1. Patients characteristics. n (%) or Mean±SD Age, (years) 63±10 Women 90 (19) Body Mass Index, (kg/m 2 ) 26.3±4 Hypertension 280 (58) Diabetes 135 (28) Smoker 175 (36) Dyslipidemia 264 (55) Familial history 128 (27) Previous History of CAD 115 (24) Betablockers 365 (76) ACE Inhibitors 354 (73) Calcium Antagonists 56 (12) Aspirin < 100 mg 482 (100) PPI 421 (87) Statins 451 (94) LV Ejection Fraction 54±8 Creatinin, (µmol/l) 111±31

2 Supplementary Table 2. Platelet Parameters according to PON1 rs662 genotypes. Platelet Reactivity with ADP 10 µmol/l induced platelet aggregation (ADP- Ag) and specific pharmacological response to clopidogrel by the Platelet reactivity Index VASP (PRI VASP). After 600 mg Loading Dose On 150 mg maintenance Therapy ADP- Ag (%) PRI VASP (%) ADP- Ag (%) PRI VASP (%) PON1 rs662 QQ192 (AA) (n=240) 45±17 43±21 51±15 38±17 QR192 (AG) (n=194) 45±16 46±22 52±15 42±19 RR192 (GG) (n=48) 50±21 51±22 54±13 44±19 P =0.20 P =0.11 P =0.22 P =0.05 Supplementary Table 3. Platelet Parameters according to CYP2C19 rs genotypes. Platelet Reactivity with ADP 10 µmol/l induced platelet aggregation (ADP- Ag) and specific pharmacological response to clopidogrel by the Platelet reactivity Index VASP (PRI VASP). After 600 mg Loading Dose On 150 mg maintenance Therapy ADP- Ag (%) PRI VASP (%) ADP- Ag (%) PRI VASP (%) CYP2C19 rs *2 / *2 (AA) (n=16) 60±16 60±18 63±17 54±20 *1 / *2 (AG) (n=119) 47±18 50±22 57±15 45±17 *1 / *1 (GG) (n=347) 44±16 43±21 49±14 38±17 P=0.007 P =0.002 P < P <0.0001

3 Supplementary File 1. METHODS Statistical analysis Statistical analysis was performed using the Graphpad Prism Software (v 4.00; Graphpad Software, Inc). Continuous variables were expressed as mean ± SD and qualitative variables as n(%). One- way analysis of variance was used for comparisons across genotypes and to generate p values for trend tests. Values of P <0.05 were considered statistically significant. Blood samples: Platelet Parameters and Genotyping Platelet Parameters Blood samples for testing platelet reactivity were drawn at least 12 h after the loading dose of aspirin and clopidogrel, and before administration of GPIIbIIIa antagonist if needed. Blood was immediately collected in vacutainer tube containing 3.8% trisodium citrate, filled to capacity, and sent immediately to the haemostasis laboratory. The blood- citrate mixture was centrifuged at 120 g for 5 min. The resulting platelet- rich plasma (PRP) was kept at room temperature for use within 1 h. The platelet count was determined in the PRP sample. Platelets were stimulated with ADP (10 µmol/l) and aggregation was assessed with a PAP4 Aggregometer (Biodata Corporation, Wellcome, Paris, France). Aggregation was expressed as the percentage change in light transmittance from baseline with PPP as reference. Here we report data on maximal intensity of ADP- induced platelet aggregation (ADP- Ag) previously associated with ischemic risk after ACS (1). The coefficient of variation of maximal intensity of platelet aggregation with ADP was measured at 6.5 %.

4 To determine the VasoActive Stimulated Phosphoprotein (VASP) phosphorylation state of whole blood, we used a standardized flow cytometric assay [Platelet VASP ; Diagnostica Stago (Biocytex), Asnières, France] (2). Briefly, a citrated blood sample was incubated with PGE1 or with PGE1 and ADP 10 µmol/l for 10 min and fixed with paraformaldehyde, after which the platelets were permeabilized with non- ionic detergent. The cells were labelled with a primary monoclonal antibody against serine 239- phosphorylated VASP (16C2), followed by a secondary fluorescein isothiocyanate- conjugated polyclonal goat antimouse antibody. The total duration of the preparation according to the procedure described by the supplier did not exceed 30 min. Analyses were performed on EPICS XL- MCL flow cytometer (Beckman Coultronics, Margency, France), the platelet population was identified from its forward and side scatter distribution and platelets were gated. A Platelet Reactivity Index VASP (PRI VASP) was calculated from the median fluorescence intensity (MFI) of samples incubated with PGE1 or PGE1 and ADP according to the formula: PRI VASP = [(MFI (PGE1) - MFI (PGE1+ADP) /MFI PGE1 ] x 100. Genotyping Genomic DNA was extracted from peripheral blood leukocytes by the salting- out method. CYP2C19*2 (rs ) genotyping: was done using ARMS- PCR. The primers (Invitrogen, CA, USA) are as follows: *2: forward: cag agc ttg gca tat tgt atc, *2 reverse: tat cgc aag cag tca cat aac, *2 G specific (sens): act atc att gat tat ttc ccg and *2 A specific (antisens): gta att tgt tat ggg ttc ct. The size of the PCR products generated are: CYP2C19 *2 forward/reverse: 373 pb, *2 G (normal allele): 283 pb and *2 A (mutated) allele: 129 pb. Reactions were made in a final volume of 12.5 µl, using 200nM of primer except for *2 A primer (300 nm), 0.15 unit of Taq DNA polymerase (Qbiotaq, MP Biomedicals, OH, USA) in its accompanying buffer, 200 µm of accompanying dntps, and 25 ng of genomic DNA. Cycling conditions are a touchdown program: a first denaturing step: 1'30 at 94 C, then 10 cycles of 30" 94 C, 30" 65 C and 50" at 72 C, followed by 10 cycles with a decrease of 0.5 C per cycle for annealing temperature, then 15 cycles with an annealing temperature of 60 C (the rest of the program doesn't change), and then a final extension step of 3' at 72 C, and cooling to 15 C. PCR products were run on 2% agarose gels and genotypes were assigned according the

5 PCR products sizes observed. The sequence variation: c.681g>a in the CYP2C19 gene was screened to determined the presence of the allele wild- type (wt) or 2*. Base numbering and allele definitions follow the nomenclature of the Human Cytochrome P450 (CYP) Allele Nomenclature Committee ( according to den Dunnen recommendations at http// PON1 Q192R (rs662) genotyping: was done by three distinct methods: ARMS- PCR, RFLP- PCR and Sanger sequencing. ARMS genotyping primers (Invitrogen by Life Technologies, CA, USA) are as follows: forward: 5 - ctgtaatgttcaataccttcac, reverse: 5 - gatatctcctgagaatctgag; A specific: 5 - ttcttgacccctacttaca, G specific: 5 - aaatacatctcccaggat). Size of generated PCR product is: forward/reverse: 309 bp, A specific: 195 bp, G specific: 151 bp. Reactions were made in a final volume of 12.5 µl, using 200nM of primers, 0.15 unit of Taq DNA polymerase (Qbiotaq, MP biomedicals, OH, USA) in its accompanying buffer, 200 µm of accompanying dntps, and 15 ng of genomic DNA. Cycling conditions consist of a first denaturing step: 1'30 at 94 C, then 35 cycles of 30" 94 C, 30" 60 C and 50" at 72 C, and a final extension step of 3' at 72 C, followed by cooling to 15 C until use. PCR products were run on 2% agarose gels and genotypes were assigned according the PCR products sizes observed. For RFLP- PCR we used the same PCR conditions except that we only kept forward/reverse primers for locus amplification. The PCR products were then digested with 2.5U of DpnII (New England Biolabs, MA, USA) in its accompanying buffer (NEB3) at 37 C for 90 mn. Digested PCR products were then ran on 2% agarose gels and genotyped according to digestion products size: A: bp; G: bp (the latest is hardly seen). 16 selected patients were also sequenced: locus was amplified as described for RFLP- PCR except for PCR volume: 25 µl, purified using Millipore UFC (Millipore, MA, USA) according to manufacturer s instructions, and then sequenced using reverse primers and Big Dye Sequencing kit (ref , Applied Biosystems by Life technologies, CA, USA), according to manufacturer s instructions. Purified sequencing reactions were ran on a 8 capillary Genetic Anlyser 3500 (Applied Biosystems), and subsequently analysed by 2 independent trained people.

6 REFERENCES 1. Cuisset T, Frere C, Quilici J, Barbou F, Morange PE, Hovasse T, Bonnet JL, Alessi MC. High post- treatment platelet reactivity identified low- responders to dual antiplatelet therapy at increased risk of recurrent cardiovascular events after stenting for acute coronary syndrome. J Thromb Haemost 2006; 4: Aleil B, Ravanat C, Cazenave JP, Rochoux G, Heitz A, Gachet C. Flow cytometric analysis of intraplatelet VASP phosphorylation for the detection of clopidogrel resistance in patients with ischemic cardiovascular diseases. J Thromb Haemost 2005;3:85-92.