Supporting Information

Transcription

1 Supporting Information Powell and Xu /pnas SI Methods Design of Estrogen Receptor (ER) Fusion Constructs for Use in Bioluminescence Resonance Energy Transfer (BRET) Assay. Because the degree of resonance energy transfer that may be achieved in any given BRET assay depends on the degree of spectral overlap between donor and acceptor proteins, the distance between donor and acceptor, the relative orientation of the fusion proteins within a dimerized unit, and the donor lifetime, we chose to pursue a BRET 1 assay as opposed to the more recently developed BRET 2 assay. BRET 1 is characterized by employing the more stable RLuc substrate coelenterazine h, which decays less rapidly than the BRET 2 substrate DeepBlueC. Coelenterazine h causes RLuc to emit at a peak wavelength of 470 nm, which is ideal for excitation of the acceptor protein YFP, which in turn emits at a peak of 530 nm; thus, YFP was chosen as an acceptor protein because the degree of spectral overlap was optimal for allowing acceptor excitation while still allowing sufficient spectral separation between emission spectra. Furthermore, difficulties in isolating ER / heterodimers from homodimers of either subtype have contributed to prevention of the crystallization of these heterodimers, and hence, the orientation of ER and ER within the heterodimer is unknown. Thus, the relative orientation of the RLuc and YFP fusions to ERs upon dimerization is difficult to predict. Therefore, we separately fused RLuc and YFP to both the N and C termini of ER and ER within the pcmx-pl2 expression plasmid so that all possible combinations of N- and C-terminal fusions to both ER and ER could be tested for maximal BRET signal output. This cloning strategy resulted in the successful cloning of 6 constructs; pcmx-er -YFP and pcmx-er -RLuc were not successfully cloned. ER -RLuc denotes that RLuc is fused to the C terminus of ER, whereas YFP-ER indicates that YFP is fused to the N terminus of ER. Fusion Plasmid Construction. The pcmx-er, pcmx-yfp, and pcmx-pl2 expression plasmids were generous gifts of Ron Evans (The Salk Institute, La Jolla, CA). A truncated form of ER lacking the 50 N-terminal amino acids was a kind gift of Dean P. Edwards (Baylor College of Medicine, Houston, TX). The truncated form was ligated into the pcmx-yfp vector such that YFP was fused to the N terminus of ER. Subsequently, our laboratory created the full-length ER within this vector by amplifying from cdna the N-terminal portion. HindIII restriction digestion of pcmx-yfp- ER yielded pcmx-er, which was subsequently used for cloning ER fusion constructs. The pcmx-er -YFP, pcmx-er - RLuc, pcmx-yfp-er, pcmx-er -YFP, and pcmx-er - RLuc constructs were constructed by PCR amplifying ER and ER from their respective parent pcmx-er and pcmx-er vectors. pcmx-rluc-er was constructed by PCR amplifying RLuc from pcmx-rluc. The 5 to 3 primer sequences are as follows: pcmx-er -YFP: forward, GATCGGTACCATGACCAT- GACCCTCCACAC and reverse, GCTTCTCGAGTCCGGCAC- CGACTGTGGCAGGGAAACC; pcmx-er -RLuc: forward, GATCGGTACCATGACCATGACCCTCCACAC and reverse, GCTTCTCGAGGACTGTGGCAGGGAAACC; pcmx-er - YFP: forward, TACCACTAGTATGGATATAAAAAACT- CACCATCTAGCCTTAATTCTC and reverse, GCTTCTC- GAGTCCGGCACCCTGCTCCATCGTTGCTTCAG; pcmx- ER -RLuc: forward, TACCACTAGTATGGATATAAAAAACT- CACCATCTAGCCTTAATTCTC and reverse, GCTTCTC- GAGTCCGGCACCCTGCTCCATCGTTGCTTCAG; pcmx- YFP-ER : forward, CGGGGGATCCATGACCATGACCCTCCA- CAC and reverse, ACTAGCTAGCGACTGTGGCAGGGAA- ACCC; pcmx-rluc-er : forward, GATCCTCGAGATGACTTC- GAAAGTTTATGATCCAGAACAAAGG and reverse, GCTTA- AGCTTTTGTTCATTTTTGAGAACTCGCTCAACG. The restriction enzymes used for PCR insert DNA and parent vector are as follows: pcmx-er -YFP, KpnI and XhoI; pcmx- ER -RLuc, KpnI and XhoI; pcmx-er -YFP, SpeI and XhoI; pcmx- ER -RLuc, SpeI and XhoI; pcmx-yfp-er, BamHI and NheI; pcmx-rluc-er, XhoI and HindIII. DNA encoding the ORFs of full-length ER and ER were subcloned to the N and C termini of YFP and RLuc in the pcmx-yfp and pcmx-rluc parent vectors. Each fusion construct was designed to include a 10- to 14-aa linker between the receptor and YFP or RLuc. LBD mutants for pcmx-er -RLuc, pcmx-er -YFP, pcmx-yfp-er, and pcmx-rluc-er were generated by using the site-directed mutagenesis QuikChange system (Stratagene) according to the manufacturer s instructions. Primers were designed to induce a glycine to arginine mutation at amino acid 521 of ER and amino acid 491 of ER to ablate E 2 binding. The 5 to 3 primer sequences are as follows: ER G521R forward, CACATGAGTAACAAACGCATGGAGC and reverse, GTACAGATGCTCCATGCGTTTGTTAC; ER G491R forward, CATGCGAGTAACAAGCGCATGGAAC and reverse, GCAGATGTTCCATGCGCTTGTTACTC. Cell Culture and Transfection. HEK293 cells were cultured in DMEM supplemented with 10% FBS. Cell cultures were split 1:10 when they reached 90% of confluence (3 days). One day before transfection, HEK293 cells were seeded onto 6-well plates in phenol red-free DMEM (Invitrogen) supplemented with 10% FBS stripped 6 times with charcoal and dextran. Cells were transfected with 435 ng of totalconstruct DNA by using LT1 transfection reagent (Mirus Bio) according to the manufacturer s instructions. Assessment of Fusion Construct Functionality. Construct DNAs were transiently transfected into HEK293 cells, and Western blotting with antibodies against ER (HC-20; Santa Cruz Biotechnology) or ER (68-4; Upstate Biosciences) was used to assess relative protein expression levels of each construct. Hsp90 was used as a loading control (H-114; Santa Cruz Biotechnology). Retained ability of the constructs to dimerize was assessed by coimmunoprecipitation of transiently cotransfected fusion proteins into HEK293 cells via immunoprecipitation with the ER HC-20 antibody and Western blotting with the ER 68-4 antibody. Whole-cell ligand-binding assays were also performed to demonstrate the retained ability of the fusion constructs to bind E 2. Briefly, fusion construct DNA was transiently transfected (LT1 transfection reagent; Mirus) into HEK293 cells; 24 h after transfection the cells were trypsinized, counted on a hemacytometer, and resuspended at cells per ml in DMEM supplemented with 10% charcoal-dextran-stripped FBS (SFS) and plated onto a sterile 24-well tissue culture-treated dish. [ 3 H]E 2 (2.25 nm) in the presence and absence of a 200-fold excess cold competitor diethylstilbesterol (DES) was added to the cells, and the mixture was incubated for 2hat37 Cat5% CO 2. Cells were then transferred to prechilled Eppendorf tubes, placed on ice, and washed 3 times with cold PBS 0.1% BSA and twice with cold PBS 0.1% methylcellulose to remove residual [ 3 H]E 2. The pellet was then lysed in room temperature ethanol with vigorous vortexing, and radioactivity was measured 1of7

2 on a scintillation counter. Cells were transfected in batches, and data are means of triplicate scintillation counts of specific E 2 binding obtained in the presence vs. the absence of the cold competitor DES. A portion of the transfected cells was isolated from the population, and protein expression was used to normalize scintillation counts with TotalLab software (Nonlinear Dynamics). Those samples showing greater than wild-type ligand binding may be caused by the discrepancies during semiquantitative measurement of ER expression on Western blotting X-ray film. To assess the ability of fusion proteins to transcriptionally activate an estrogen response element (ERE), individual construct DNAs were transiently cotransfected (LT1 transfection reagent; Mirus) with a 3 vitellogenin ERE-luciferase reporter construct into HEK293 cells, and protein was allowed to express for 48 h total. Twenty-four hours after transfection, transfected cells were treated with vehicle (DMSO) or 50 nm E 2 for 24 h, at which point cells were lysed and assayed for luciferase emission, which was correlated to construct activity on the reporter ERE. All values were normalized to -gal for transfection efficiency. The ability of the fusion constructs to bind directly to an ERE was assessed by electrophoretic mobility shift assays. Fusion construct DNA was transiently transfected into HEK293 cells maintained in DMEM 10% FBS. After allowing 48 h for protein expression, cells were trypsinized, and nuclear extract lysates were isolated and run on a nondenaturing polyacrylamide gel in the presence of 32 P-labeled ERE. Each sample was run in the presence or absence of a prebound ER or ER antibody (Santa Cruz Biotechnology H-184 or serum isolated from peptide-exposed rabbit 4111, respectively) for supershifting. The gel was dried, and radioactive bands were visualized on a Typhoon Imager (Amersham Biosciences). 2of7

3 Fig. S1. BRET methodology. (A) Schematic representing resonance energy transfer between RLuc and YFP fusions. (B) The BRET ratio is calculated as a ratio of YFP emission to RLuc emission with subtraction of background and a correction factor (CF) for emission spectra isolation. The broad tail of the RLuc emission spectrum leaks into the range of detection for the peak emission of YFP at 530 nm. The CF, obtained by expressing the RLuc-ER construct in the absence of the YFP fusion construct, allows for the separation of the contributions of YFP and RLuc to the emission intensity measured at 530 nm. 3of7

4 Fig. S2. Efficiency of resonance energy transfer depends on the coexpressed pair of BRET fusions. (A) BRET assays were performed by using the indicated BRET fusion constructs to ER and ER to monitor ligand-induced heterodimerization. Efficiency of resonance energy transfer and variability of the assay vary among the combinations of cotransfected fusion proteins. (B) BRET assays were performed on the indicated BRET fusions to ER to monitor ligand-induced ER homodimerization. Efficiency of resonance energy transfer depends on the conformation of the dimerized unit and thus on the cotransfected pair of N- and/or C-terminal fusions to RLuc and YFP. Error bars represent SEM. 4of7

5 Fig. S3. Neither the mutant ER LBD (A) nor the ER LBD (B) can bind to any of the ligands tested. BRET assays were performed on the indicated BRET fusions to wild-type or mutant ER or ER to monitor ligand-induced homodimerization. A 10 nm concentration of each ligand was used except for liquiritigenin (1 M). Error bars represent SEM. 5of7

6 Fig. S4. Mutant ER and ER LBDs reveal that ER is the dominant heterodimeric partner in the presence of a variety of ligands. (A) Wild-type ER LBD is insufficient for inducing heterodimerization. When the ER LBD binds ligand, heterodimerization occurs, albeit at a lower level than when both constructs are wild type. (B) Quantification of YFP emission indicative of YFP-ER protein expression reveals that YFP-ER G491R expresses at a lower level than wild-type fusion protein. (C) LBD mutants reveal that heterodimerization in the presence of 100 nm DPN is the result of DPN binding to ER. Error bars represent SEM. 6of7

7 Fig. S5. Transcriptional responses of ERE reporter to increasing concentrations of different commercially available estrogens. Shown is transfection of DNA encoding unfused ER (A), ER (B), or ER ER cotransfected (C) along with an ERE-luciferase reporter and internal control -gal plasmid into 293 cells. Luciferase value is normalized by the -galactosidase activity. The response values are presented as the fold induction by each concentration of ligand over the basal activity and represent mean values from triplicate samples. 7of7