Enhancing the Specificity of Polymerase Chain Reaction by. Graphene Oxide through Surface Modification: Zwitterionic

Transcription

1 Supporting Information Enhancing the Specificity of Polymerase Chain Reaction by Graphene Oxide through Surface Modification: Zwitterionic Polymer is Superior to Other Polymers with Different Charges Yong Zhong 1, Lihong Huang 2, Zhisen Zhang 3, Yunjing Xiong 1, Liping Sun 1 *, Jian Weng 1 * 1 Department of Biomaterials, College of Materials, Xiamen University, Xiamen , P.R. China; 2 State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Xiamen University, Xiamen , P.R. China; 3 Department of Physics, Research Institute for Biomimetics and Soft Matter, Xiamen University, Xiamen , P.R. China Correspondence: Liping Sun, Jian Weng Department of Biomaterials, College of Materials, Xiamen University, Xiamen , P.R. China Tel/Fax sunliping@xmu.edu.cn, jweng@xmu.edu.cn 1

2 Table S1 Primer sequences Primer Sequence (5-3 ) F1 AGTGCCAGGGTTTTGATCGATG R1 CTGGTTTCACATTCACCACCCT F2 CAACCAAACCCCAAAGACAC R2 CTGGGGTTAGTATAGCTTAG Table S2 PCR conditions for different templates Template pet-32a plasmid Human genomic DNA 94 C,5 min 94 C,5 min 94 C,30 s 94 C,45 s Program 65 C,30 s 52 C,45 s 72 C,1 min 72 C,90 s 72 C,10 min 72 C,5 min 4 C,24 h 4 C,24 h 31 cycles from step cycles from step 2-4 2

3 Figure S1 Ionized forms of PAA, PAM and psb Figure S2 AFM images and the corresponding height profiles of GO and its derivatives. 3

4 UV vis spectra of S-GO, L-GO, S-RGO and L-RGO were showed in Figure S3a. The absorption peak of GO at around 230 nm is attributed to π-π* transitions of C=O bond. 1 After reduction, the absorption peaks of RGO is red-shifted to 260 nm, indicating that electronic conjugation within the graphene sheets is restored after hydrazine reduction. Meanwhile, the shoulder absorption at nm corresponding to the n-π* transition of the C=O bond of GO disappeared in comparison with RGO. 2 The absorption peaks of GO-PAM and GO-pSB are blue-shifted to 211 nm, while the peak of GO-PEG is blue-shifted to 260 nm. There is no obvious absorption peak for GO-PAA (Figure S3b). Figure S3 (a) UV-vis spectra of S-GO, L-GO, S-RGO and L-RGO. S-RGO and L-RGO were reduced from S-GO and L-GO, respectively. (b) UV-vis spectra of GO and its derivatives. To confirm the successful graft of polymers on the surface of GO, FTIR of GO, GO-PAA, GO-PEG, GO-PAM, GO-pSB and the corresponding monomers or bare polymers are shown in Figure S4. The characteristic absorption bands of GO, such as the C=O stretching vibration at 1714 cm -1, the graphitic skeletal stretching vibration at 1625 cm -1, the C OH stretching vibration at 1358 cm -1, the C O stretching vibration at 1060 cm-1and the broad and intense band of the OH group at 3440 cm -1, are 4

5 observed for all GO derivatives. The FTIR spectrum of PAA shows a band at 3440 cm -1 attributed to OH groups and water. The FTIR spectrum of GO-PAA shows the characteristic groups of both PAA and GO. PAA has two bands at 2940 cm -1 (C-H bond) and 1705 cm -1 (C=O bond), which are also observed in GO-PAA (Figure S4a). Both PAM and GO-PAM have a characteristic N H band at 3200 cm -1, a C-H symmetric stretching vibration at 2937 cm -1 and an anti-symmetric stretching vibration at 2870 cm -1, a C=O absorption band at 1680 cm -1, and an N-H bending vibration at 1605 cm -1 (Figure S4b). 3 The FTIR spectra of both PEG and GO show a band at 1600 cm -1 (C=O bond) and a band at 1100 cm -1 (C-O bond). Both PEG and GO-PEG have a band at 2880 cm -1 corresponding to C-H vibration of PEG (Figure S4c). For psb, the band of O-C=O stretching vibration at 1717 cm 1 corresponds to the ester carbonyl groups. And the stretching vibrations at 1169 cm 1 and 1039 cm 1 represent the sulfonate groups ( SO3) (Figure S4d). 4 These FTIR results indicate that PAA, PAM, PEG and psb were successfully grafted on GO sheets. 5

6 Figure S4 FTIR spectra of GO and its derivatives. The interlayer distances of GO and its derivatives were investigated by XRD. Graphite has a strong and sharp peak near 26 corresponding to an interlayer distance of nm (Inset in Figure S5). After exfoliation by sonication, the diffraction peak disappears and GO shows a wide amorphous peak between 15 and 30, implying that the ordered lattice structure of graphite was destroyed to irregular structure. Even when GO was reduced to RGO, the ordered lattice structure could not be recovered again. All GO derivatives modified with polymer also displayed non-crystalline structure. 6

7 Figure S5 XRD patterns of GO, RGO, GO-PAA, GO-PAM, PO-PEG and GO-pSB. Inset: XRD pattern of graphite. XPS was further used to analyze the surface composition and structure of GO derivatives. The XPS spectrum of GO has been reported in our previous work. 5 GO-PAM, GO-PEG and GO-pSB exhibit a new peak at 400 ev attributed to the N1s species of C N bonds (Figure S6b-d), indicating that PAM, PEG and psb were successfully linked to GO. GO-PAM contains a lot of amino groups, resulting in a strong N1s peak (Figure S6b). PEG has only one amino group at its end, thus GO-PEG shows a weak N1s peak (Figure S6c). GO-pSB shows strong O1s, C1s peaks and weak N1s, S2s, S2p peaks (Figure S6d), which is in consistent with the structure of GO and psb. The C1s spectra were also shown in Figure S6h. The dominant peak at ev is attributed to the C=C species, other peaks are attributed to C O, C N, C=O, and O C=O species, respectively. 6, 7 7

8 Figure S6 XPS sum spectra and C1s spectra of all GO derivatives. (a) and (e) GO-PAA; (b) and (f) GO-PAM; (c) and (g) GO-PEG; (d) and (h) GO-pSB. Inset: N1s spectra. Figure S7 (a) TGA curves of GO with different reduction degrees. The number on the curve indicates the content of carboxyl. (b) TGA curves of GO, GO-PAA, GO-PEG, GO-PAM and GO-pSB. 8

9 Table S3 The average size, thickness and polymer content of GO and GO derivatives Materials Average Size (nm) Thickness (nm) Content of Polymer S-GO L-GO GO-PAA % GO-PAM % GO-PEG % GO-pSB % 9

10 Table S4 Zeta potentials of GO and GO derivatives before and after mixing with Pfu polymerase in water Zeta potential (mv) Materials water 2 % pfu polymerase GO (8.39%) -39.1± ±1.1 S-GO -45.1± ±0.9 L-GO -35.6± ±1.1 GO-PAA -46.9± ±0.7 GO-PAM -24.1± ±0.9 GO-PEG -35.7± ±1.1 GO-pSB -20.4± ±0.6 RGO (7.28%) -22.7± ±1.3 RGO (5.43%) -15.6± ±0.7 Note: 0.1 mg ml 1 GO or its derivatives were mixed with 0.08 U/μL pfu polymerase and incubated for 2 h. Data are the mean ± standard deviation of three different experiments with 10% relative standard deviation. The percentage in the bracket indicates the content of carboxyl. 10

11 Table S5 Zeta potentials of GO and GO derivatives before and after mixing with Pfu polymerase in 1 PCR buffer Zeta potential (mv) Materials 1 PCR buffer 2 % pfu polymerase GO (8.39%) -23.6± ±0.4 S-GO -31.3± ±1.0 L-GO -20.8± ±0.8 GO-PAA -34.3± ±0.6 GO-PAM -19.4± ±0.9 GO-PEG -20.1± ±0.7 GO-pSB -12.1± ±0.4 RGO (7.28%) -15.4± ±1.1 RGO (5.43%) -9.9± ±0.8 Note: 0.1 mg ml 1 GO or its derivative was mixed with 0.08 U/μLpfu polymerase and incubated for 2 h. 1 PCR buffer is the buffer used in PCR system to maintain its ph and Mg 2+ concentration. Data are the mean ± standard deviation of three different experiments with 10% relative standard deviation. The percentage in the bracket indicates the content of carboxyl. 11

12 Figure S8 Optimization of template concentration. (a) The 1 st round PCR. The plasmid template concentration of the last lane (1) is 0.5 ng μl 1. Then the plasmid template was diluted 10 5, 10 4, 10 3, 10 2, and 10 1 times, respectively. (b) In the 2 nd round PCR, the 1 st round PCR product was used as template. 0.5 μl of the 1 st round PCR product was used in the last lane (1). Then it was diluted 10 4, 10 3, 10 2, and 10 1 times, respectively. 12

13 Table S6 Efficient concentration ranges for optimal PCR specificity Additive Efficient concentration range S-GO µg ml 1 L-GO µg ml 1 GO (8.39% carboxyl content) µg ml 1 RGO (7.28% carboxyl content) µg ml 1 RGO (5.43% carboxyl content) µg ml 1 GO-PAA µg ml 1 GO-PAM µg ml 1 GO-pEG µg ml 1 GO-pSB µg ml 1 PAA 2.4 mg ml 1 PAM mg ml 1 PEG mg ml 1 psb mg ml 1 The results are obtained according to the 2 ed round PCR in Figure 1, 2, 3 and Figure S11. 13

14 Table S7 Thermodynamic binding parameters for Pfu polymerase with GO and RGO Materials Kd (mol 5 ) ΔG (kj mol 1 ) GO (8.39%) RGO (7.28%) RGO (5.43%) Figure S9 ITC data for the interaction of Pfu polymerase with graphene. The raw ITC data and fitting for the titration of GO (8.39 % carboxyl) (a, d), RGO (7.28 % carboxyl) ( b, e) and RGO (5.43 % carboxyl) (c, f) with 40 µg ml -1 graphene. 14

15 Figure S10 The effect of polymer with a low concentration on PCR. The calculated amounts of polymers according to the TGA data of GO derivatives were added into PCR systems, respectively. In lane 1-6, (a) PAA concentration is 0, 0.6, 1.2, 1.8, 2.4 and 3.0 µg ml 1, respectively. (b) PAM concentration is 0, 0.5, 1.0, 1.5, 2.0, 2.5 µg ml 1, respectively. (c) PEG concentration is 0, 3.6, 7.2, 10.8, 14.4, 18.0 µg ml 1, respectively. (d) psb concentration is 0, 3.0, 6.0, 9.0, 12.0, 15.0 µg ml 1, respectively. 15

16 Figure S11 The effect of polymer with a high concentration on 1 st round (a-d) and 2 nd round (e-h) PCRs. (a, e) The concentration of PAA in lane 1-6 is 0, 1.2, 2.4, 3.6, 4.8 and 6.0 mg ml 1, respectively. (b, f) The concentrationof PAM in lane 1-6 is 0, 2.4, 4.8, 7.2, 9.6 and 12.0 mg ml 1, respectively. (c, g) The concentrationof PEG in lane 1-7 is 0, 10.0, 20.0, 30.0 and 40.0 mg ml 1, respectively. (d, h) The concentration of psb in lane 1-7 is 0, 5.0, 10.0, 15.0, 20.0 and 25.0 mg ml 1, respectively. 16

17 Figure S12 PCR reactions following adsorption of Pfu polymerase on GO or its derivatives. Lane 1 to 5 are GO, GO-PAA, GO-PAM, GO-PEG and GO-pSB incubated with Pfu polymerase for 1 hour in ice, respectively. Then other PCR components were added. The final concentrations of GO, GO-PAA and GO-PAM in lane 1-3 are 1.6 µg ml 1, while the concentrations of GO-PEG and GO-pSB in lane 4-5 are 4.8 µg ml 1. 17

18 Figure S13 Sequence alignment of control PCR sample without additive and samples with GO derivatives. 18

19 Figure S14 Molecular docking of the binding sites of polymers on Pfu polymerase. The figure is made by MOE using PDB 2JGU_A. The binding sites are labeled green. Table S8 Binding affinities of polymers with Pfu polymerase Polymer Binding affinity (KJ/mol) PAA -17 PAM -16 PEG -7 psb 0 19

20 Figure S15 Coulombic interaction energies of Pfu polymerase and PAA (a) and PAM (b). (c) Solvent accessible surface of PEG and psb. (d) Minimum distance between PEG, psb and Pfu polymerase. Cumulative solvent distributions of PEG (e) and psb (f) in water. 20

21 Table S9 Coul Short Range energy of Pfu-polymer Pfu-Polymer Coul Short Range energy (KJ/mol) Pfu-PAA ± 203 Pfu-PAM -959 ± 107 Pfu-PEG 0 Pfu-pSB 0 21

22 References 1. Dreyer DR, Park S, Bielawski CW, Ruoff RS. The chemistry of graphene oxide. ChemSocRev. 2010;39: Wang Z, Lv X, Weng J. High peroxidase catalytic activity of exfoliated few-layer graphene. Carbon. 2013; 62: Liu Z, Robinson JT, Sun X, Dai H. PEGylated Nanographene Oxide for Delivery of Water-Insoluble Cancer Drugs. J. Am. Chem. Soc. 2008; 130(33): Chiang YC, Chang Y, Akon H, Chena W, Ruaan R. Sulfobetaine-grafted poly(vinylidene fluoride) ultrafiltration membranes exhibit excellent antifouling property. J. Membrane Sci. 2009; 339(1-2): Jia J, Sun LP, Hu N, Huang GM, Weng J. Graphene Enhances the Specificity of the Polymerase Chain Reaction. Small. 2012; 8(13): Dong J, Yang Q, Weng J. Coloring of Polystyrene Nanoparticles Assembling on Graphene in Aqueous Solution.Par Part Syst Char. 2014; 31(10): Dong J, Ding JB, Weng J, Dai LZ. Graphene Enhances the Shape Memory of Poly (acrylamide-co-acrylic acid) Grafted on Graphene Macromol. Rapid Comm. 2013; 34(8):