National PHL TB DST Reference Center PSQ Reporting Language Table of Contents

Transcription

1 PSQ Reporting Language Table of Contents Document Page Number PSQ for Rifampin 2-6 Comparison table for rpob Codon Numbering 2 rpob mutation list (new numbering system) 3-5 rpob interpretations 6 PSQ for Isoniazid 7-12 mutation list (katg, inha, ahpc and ) 7-8 interpretations 9-12 PSQ for Detection of MTBC 13 PSQ Additional Comments 14 Page 1 of 14

2 Comparison Table for rpob mutations The rpob mutation is now named using the Mycobacterium tuberculosis codon system. By subtracting 81 from the old codon number, it will be converted to the new codon number for M. tuberculosis or adding 81 to the new codon number, it will be converted to the old E. coli numbering. Most Common Mutations rpob Codons Old (E. coli numbering) New (MTB Numbering) 176 (GTC > TTC, Val > Phe) 170 (GTC > TTC, Val > Phe) 514 (TTC > TTT, Phe > Phe) 433 (TTC > TTT, Phe > Phe) 516 (GAC > GTC, Asp > Val) 435 (GAC > GTC, Asp > Val) 526 (CAC > GAC, His > Asp) 445 (CAC > GAC, His > Asp) 526 (CAC > TAC, His > Tyr) 445 (CAC > TAC, His > Tyr) 531 (TCG > TTG, Ser > Leu) 450 (TCG > TTG, Ser > Leu) Page 2 of 14

3 PSQ Reporting Language: rpob for Rifampin Drug Loci Results RIF rpob (170) 170 (GTC > TTC, Val > Phe) RIF rpob (170) No mutation RIF rpob (170) No sequence RIF rpob (170) Pending RIF rpob (170) See comments RIF rpob (170) Not reproducible RIF rpob (170) Not tested RIF rpob ( ) 426 (GGC > GGA, Gly > Gly) RIF rpob ( ) 426 (GGC > GGT, Gly > Gly) RIF rpob ( ) 427 (ACC > GCC, Thr > Ala) RIF rpob ( ) deletion (ACCAGC deletion) RIF rpob ( ) deletion (ACCAGCCAGCTG deletion) RIF rpob ( ) 428 (AGC > CGC, Ser > Arg) RIF rpob ( ) 429 (AGC > AGG, Ser > Arg) RIF rpob ( ) 429 (CAG > CTG, Gln > Leu) RIF rpob ( ) 429 (CAG > CAT, Gln > His) RIF rpob ( ) 429 (CAG > CTG, Gln > Leu) and 435 (GAC > GTC, Asp > Val) RIF rpob ( ) 430 (CTG > CCG, Leu > Pro) RIF rpob ( ) 430 (CTG > CGG, Leu > Arg) RIF rpob ( ) 430 (CTG > CGG, Leu > Arg) and 435 (GAC > TAC, Asp > Tyr) RIF rpob ( ) 430 (CTG > CCG, Leu > Pro) and 435 (GAC > TAC, Asp > Tyr) 430 (CTG > CCG, Leu > Pro), 431 (AGC > ACC, Ser >Thr) and 435 (GAC >TAC, Asp > Tyr) RIF rpob ( ) RIF rpob ( ) 431 (AGC > ACC, Ser > Thr) RIF rpob ( ) 432 (CAA > CTA, Gln > Leu) RIF rpob ( ) 432 (CAA > AAA, Gln > Lys) RIF rpob ( ) 432 (CAA > GAA, Gln > Glu) RIF rpob ( ) 432 (CAA > CCA, Gln > Pro) RIF rpob ( ) 432 (CAA > CAC, Gln > His) RIF rpob ( ) 432 (CAA > CAG, Gln > Gln) RIF rpob ( ) deletion (CAATTCATG deletion) deletion (CAATTCATG deletion) and 435 (GAC > TAC, Asp > Tyr) RIF rpob ( ) RIF rpob ( ) 433 (TTC > TTT, Phe > Phe) RIF rpob ( ) TTC insertion after 433 RIF rpob ( ) 434 (ATG > ATA, Met > Ile) RIF rpob ( ) 434 (ATG > GTG, Met > Val) RIF rpob ( ) deletion (ATGGACCAGAACAACCCGCTG deletion) RIF rpob ( ) 435 (GAC > GCC, Asp > Ala) RIF rpob ( ) 435 (GAC > TAC, Asp > Tyr) Page 3 of 14

4 PSQ Reporting Language: rpob for Rifampin Drug Loci Results RIF rpob ( ) 435 (GAC > GGC, Asp > Gly) RIF rpob ( ) 435 (GAC > GTC, Asp > Val) RIF rpob ( ) 435 (GAC > GAG, Asp > Glu) RIF rpob ( ) 435 (GAC > TTC, Asp > Phe) RIF rpob ( ) deletion (GACCAGAACAACCCG deletion) RIF rpob ( ) 436 (CAG > CAA, Gln > Gln) RIF rpob ( ) 436 deletion (CAG deletion) RIF rpob ( ) 437 deletion (AAC deletion) RIF rpob ( ) deletion (CAGAAC deletion) RIF rpob ( ) 438 (AAC > AAA, Asn > Lys) RIF rpob ( ) 438 (AAC > AAG, Asn > Lys) RIF rpob ( ) 438 (AAC > AGG, Asn > Arg) RIF rpob ( ) 440 (CTG > TTG, Leu > Leu) RIF rpob ( ) No mutation RIF rpob ( ) No sequence RIF rpob ( ) Pending RIF rpob ( ) See comments RIF rpob ( ) Not reproducible RIF rpob ( ) Not tested RIF rpob ( ) 441 (TCG > TTG, Ser > Leu) RIF rpob ( ) 441 (TCG > ACC, Ser > Thr) RIF rpob ( ) 441 (TCG > ACG, Ser > Thr) RIF rpob ( ) 441 (TCG > TTG, Ser > Leu) and 446 (AAG > AGG, Lys > Arg) RIF rpob ( ) 444(ACC > ACG, Thr > Thr) 444 (ACC > ACG, Thr > Thr), 445 (CAC > ACC, His > Thr) and 446 (AAG > CAG, Lys > Gln) RIF rpob ( ) RIF rpob ( ) 445 (CAC > TAC, His > Tyr) RIF rpob ( ) 445 (CAC > GCC, His > Ala) RIF rpob ( ) 445 (CAC > CTC, His > Leu) RIF rpob ( ) 445 (CAC > GAC, His > Asp) RIF rpob ( ) 445 (CAC > CAA, His > Gln) RIF rpob ( ) 445 (CAC > CAG, His > Gln) RIF rpob ( ) 445 (CAC > TGC, His > Cys) RIF rpob ( ) 445 (CAC > AAC, His > Asn) RIF rpob ( ) 445 (CAC > AGC, His > Ser) RIF rpob ( ) 445 (CAC > CGC, His > Arg) RIF rpob ( ) 445 (CAC > CCC, His > Pro) RIF rpob ( ) 445 (CAC > GGC, His > Gly) RIF rpob ( ) 445 (CAC > TCC, His > Ser) RIF rpob ( ) 445 (CAC > TCC, His > Ser) and 446 (AAG > CGG, (Lys > Arg) Page 4 of 14

5 PSQ Reporting Language: rpob for Rifampin Drug Loci Results RIF rpob ( ) 445 (CAC > TCC, His > Ser) and 446 (AAG > CAG, (Lys > Gln) RIF rpob ( ) 445 (CAC > CAG, His > Gln) and 452 (CTG > CCG, (Leu > Pro) RIF rpob ( ) 446 (AAG > AAA, Lys > Lys) RIF rpob ( ) 446 (AAG > AGG, Lys > Arg) RIF rpob ( ) 447 (CGC > CGT, Arg > Arg) RIF rpob ( ) 447 (CGC > CGA, Arg > Arg) RIF rpob ( ) 447 (CGC > CGG, Arg > Arg) RIF rpob ( ) 448 (CGA > CCA, Arg > Pro) RIF rpob ( ) 450 (TCG > TTG, Ser > Leu) RIF rpob ( ) 450 (TCG > TTC, Ser > Phe) RIF rpob ( ) 450 (TCG > TGG, Ser > Trp) RIF rpob ( ) 450 (TCG > TGT, Ser > Cys) RIF rpob ( ) 450 (TCG > CAG, Ser > Gln) RIF rpob ( ) 452 (CTG > CCG, Leu > Pro) RIF rpob ( ) 452 (CTG > GAG, Leu > Glu) RIF rpob ( ) No mutation RIF rpob ( ) No sequence RIF rpob ( ) Pending RIF rpob ( ) See comments RIF rpob ( ) Not reproducible RIF rpob ( ) Not tested Page 5 of 14

6 PSQ Reporting Language: rpob for Rifampin Scenario Interpretation No mutations Probably susceptible to RIF. Ser450Leu (TCG > TTG), and others including Val170Phe (GTC>TTC) RIF resistant. Prelim Report: If all 3 of the loci don't have results or any combination of rpob ( ) & rpob ( ) are missing results Will re-test. If Requires Re-Testing and Comments Will re-test and see comments. Final Report Requires Comments See comments. Prelim report: rpob ( ) & rpob ( ) have results but no results for rpob (170) mutations in codon 170 are detected. Final Report: rpob ( ) & rpob( ) have results but no results for rpob (170) Final Report: Both rpob ( ) & rpob ( ) or either one has no results, but rpob (170) has results Final Report: No results for rpob ( ), rpob ( ) or rpob (170). Final Report: Phe433Phe (TTC >TTT) Final Report: Leu533Pro (CTG > CCG) New mutations, association with resistance unknown. New mutation to MDL, associated with resistance in the literature Suggest susceptibility to RIF. Will re-test codon 170 of rpob. Sensitivity for detecting RIF resistance increases 0.25% when Suggest susceptibility to RIF, despite no results for codon 170 of rpob. Sensitivity for detecting RIF resistance increases 0.25% when mutations in codon 170 are detected. Unable to predict RIF results due to unsuccessful sequencing. Unsuccessful rpob sequencing may be due to low DNA concentration of M. tuberculosis complex. Unable to predict RIF results. This is a silent mutation, not associated with RIF resistance. Low level, but probably clinically relevant RIF resistance has been associated with this rpob mutation in the literature. Isolates with this mutation may test RIF susceptible by culture-based techniques. Treatment consultation is available at TB Centers of Excellence This rpob mutation has not been detected previously in our laboratory. Unable to predict RIF results. This rpob mutation has not been detected previously in our laboratory. It has been associated with RIF resistance in the literature. Page 6 of 14

7 PSQ Reporting Language: katg, inha, ahpc, for Isoniazid Drug Loci Results INH katg No mutation INH katg No sequence INH katg Pending INH katg See comments INH katg Not reproducible INH katg Not tested INH katg 314 (ACC > GCC, Thr > Ala) INH katg 315 (AGC > ACC, Ser>Thr) INH katg 315 (AGC > ACA, Ser > Thr) INH katg 315 (AGC > ACG, Ser > Thr) INH katg 315 (AGC > ACT, Ser > Thr) INH katg 315 (AGC > AAC, Ser > Asn) INH katg 315 (AGC > AGG, Ser > Arg) INH katg 315 (AGC > GGC, Ser > Gly) INH katg 315 (AGC > ATC, Ser > Ile) INH katg 316 (GGC > AGC, Gly > Ser) INH inha No mutation INH inha No sequence INH inha Pending INH inha See comments INH inha Not reproducible INH inha Not tested INH inha -17 (G>T) INH inha -16 (A>G) INH inha -15 (C>T) Page 7 of 14

8 PSQ Reporting Language: katg, inha, ahpc, for Isoniazid Drug Loci Results INH inha -9 (G>T) INH inha -8 (T>C) INH inha -8 (T>G) INH inha -8 (T>A) INH ahpc No mutation INH ahpc No sequence INH ahpc Pending INH ahpc See comments INH ahpc Not reproducible INH ahpc Not tested INH ahpc -57 (G>A) INH ahpc -54 (G>A) INH ahpc -52 (G>A) INH ahpc -52 (G>C) INH ahpc -52 (G>T) INH ahpc -51 (C>T) INH ahpc -49 (A>G) INH ahpc -48 (C>T) INH No mutation INH No sequence INH Pending INH See comments INH Not reproducible INH Not tested INH 203 (CTG > Page CTA, 8 Leu of 14 > Leu) Updated July 24, 2018

9 Scenario No mutations detected in katg, inha, ahpc, or Mutation(s) detected in katg only Mutation(s) detected in ahpc only Mutation(s) detected in inha only Mutation(s) detected in only No sequence in any of the 4 INH locus, but at least one of the 8 PSQ loci tested has sequence from cultures or sediments with AFB smear 2+. PSQ Reporting Language: katg, inha, ahpc, for Isoniazid No Results Mutations Detected Interpretation None Suggests susceptibility to INH. katg INH Resistant ahpc Associated with INH resistance. katg, inha, ahpc, or inha INH resistant. May also be associated with ethionamide resistance. Isolates with this mutation may test INH susceptible by some culturebased techniques. INH resistant. May also be associated with ethionamide resistance. Isolates with this mutation may test INH susceptible by some culturebased techniques. Will re-test. No sequence in all 8 loci on sediments with AFB smear 3+ to 4+. katg, inha, ahpc, or Will re-test. No sequence in any of the 4 INH loci and conditions require freetext comments. katg, inha, ahpc, or Will re-test; see comments. Conditions require free-text comments. See comments. Page 9 of 14

10 Scenario Final Report: No sequence was obtained from all 4 INH loci (INH Components), but MTBC was detected and at least one other locus yielded valid results. PSQ Reporting Language: katg, inha, ahpc, for Isoniazid No Results katg, inha, ahpc, or Mutations Detected Interpretation Unable to predict INH result because of unsuccessful sequencing, possibly due to low M. tuberculosis complex DNA concentration. Final Report: No results for katg, no mutations in rpob and with or without any results for inha, ahpc or katg None Unable to predict INH results. Final Report: No results for inha and no mutations in ahpc,, katg or rpob. inha None Possibly INH susceptible because of no katg mutation, but the interpretation is less clear because there are no results for INH and 13% of INH resistance is due to inha mutations. Final Report: No results for ahpc and no mutations in inha, katg, and rpob. Final Report: No results for and no mutations in inha, ahpc, katg and rpob. ahpc None None Suggests susceptibility to INH, because only ahpc was not successfully sequenced. INH resistance due to mutations in ahpc is rare. Suggests susceptibility to INH, because only was not successfully sequenced. INH resistance due to mutations in is rare. Final Report: No results for inha and ahpc and no mutations in katg, or rpob inha, ahpc None Possibly INH susceptible because of no katg mutation, but the interpretation is less clear due to no results for inha and ahpc, and 15% of INH resistance is due to mutations in inha and ahpc. Page 10 of 14

11 Scenario Final Report: No results for inha or and no mutations in katg, ahpc or rpob. PSQ Reporting Language: katg, inha, ahpc, for Isoniazid No Results inha, Mutations Detected None Interpretation Possibly INH susceptible because of no katg mutation, but the interpretation is less clear due to no results for inha and, and 14% of INH resistance is due to mutations in inha and. Final Report: No results for inha, inha, ahpc, ahpc or and no mutations in katg or rpob. None Possibly INH susceptible because of no katg mutation, but the interpretation is less clear due to no results for inha, aphc and, and 16% of INH resistance is due to mutations in these three loci. Final Report: No results for ahpc or and no mutations in inha, katg or rpob. Final Report: INH Testing not requested Final Report: No Mutations detected in 4 INH loci but an rpob mutation (excluding silent mutations) is detected Final Report: Any of the 4 INH loci yielded no sequence, and a nonsynonymous mutation in rpob was detected. ahpc, None Suggests susceptibility to INH because of no katg or inha mutations, but sensitivity for INH resistance detection may be reduced by 2-3% because of no results for ahpc and. Test not requested At least 1 loci rpob (nonsynony mous) rpob (nonsynony mous) No mutations detected in the four INH loci suggest susceptibility to INH, but the possibility of INH-resistance is increased due to the presence of a nonsynonymous rpob mutation. Unable to predict INH results, but the possibility of INHresistance is increased due to the presence of a nonsynonymous rpob mutation. Page 11 of 14

12 Scenario Final Report: When a mutation new to MDL is detected Final Report: When a mutation new to the literature is detected PSQ Reporting Language: katg, inha, ahpc, for Isoniazid No Results Mutations Detected Any INH Loci Any INH Loci Interpretation This mutation has not been detected previously at MDL, but its association with INH resistance has been reported in the literature. This is a new mutation; its association with INH resistance is unknown. Page 12 of 14

13 PSQ Reporting Language: Detection of MTBC Loci Result Interpretation Comments pnca pnca MTBC sequence detected (not M. bovis) MTBC sequence detected (M. bovis) DNA of M. tuberculosis complex detected (not M. bovis ). DNA of M. bovis detected. M. bovis is resistant to PZA and is a species in the M. tuberculosis complex. pnca locus is the primary target to use; when pnca yields no sequence, IS6110 is used. IS6110 cannot distinguish M. bovis from other members in MTBC. IS6110 MTBC sequence detected DNA of M. tuberculosis complex detected. pnca No sequence DNA of M. tuberculosis complex not detected. May be due to lack of or insufficient DNA of M. tuberculosis complex or presence of inhibitory substances. When tested on sediments and DNA not purified. pnca No sequence DNA of M. tuberculosis complex not detected. May be due to lack of or insufficient DNA of M. tuberculosis complex. When tested on cultures, or purified DNA. (DNA purification is performed on sediments with smear results >2+.) pnca No sequence Will re-test. pnca No sequence Will re-test. See comments. pnca See comments See comments. pnca and IS6110 pnca No sequence Not reproducible Some strains of M. tuberculosis complex do not When smear is of low-positive. Both pnca and IS6110 yielded no contain IS6110. Failure to detect IS6110 does not sequences, but two or more drug loci have valid results. pnca is less rule out presence of M. tuberculosis complex. sensitive than IS6110. Detection of M. tuberculosis complex is inclusive. pnca Pending pnca Not tested Page 13 of 14

14 PSQ Reporting Language: Additional Comments Canned comments Application Please submit a sediment of higher smear positivity with a volume of 0.5 ml or greater or a positive culture for PSQ. when PSQ yielded no results Less than 0.5 ml sediment received. Test results may be compromised due to insufficient When PSQ yielded no results, and report says volume. "see comments" PSQ was not requested but performed due to mixed culture with Non-TB mycobacteria. PSQ was not requested but performed due to culture contaminated with non-afb bacteria. PSQ was not requested but performed to confirm INH resistance detected by MGIT 960 PSQ was not requested but performed to confirm RIF resistance detected by MGIT 960. PSQ was not requested but performed to confirm INH and RIF resistance detected by MGIT 960. The submitting laboratory informed MDL that no mutations in rpob were detected by GeneXpert. This may be useful when rpob sequencing by PSQ is not successful. The rpob mutation, 450 (TCG > TTG, Ser > Leu), now named using the MTBC codon system, is the same as 531 (TCG > TTG, Ser > Leu), named previously using the E. coli codon system. The rpob mutation, 445 (CAC > TAC, His > Tyr), now named using the MTBC codon system, is the same as 526 (CAC > TAC, His > Tyr), named previously using the E. coli codon system. The rpob mutation, 445 (CAC > GAC, His > Asp), now named using the MTBC codon system, is the same as 526 (CAC > GAC, His > Asp), named previously using the E. coli codon system. The rpob mutation, 435 (GAC > GTC, Asp > Val), now named using the MTBC codon system, is the same as 516 (GAC > GTC, Asp > Val), named previously using the E. coli codon system. The rpob mutation, 433 (TTC > TTT, Phe > Phe), now named using the MTBC codon system, is the same as 514 (TTC > TTT, Phe > Phe), named previously using the E. coli codon system. The rpob mutation is now named using the MTBC codon system. By adding 81 to the new codon number, it will be converted to the codon number previously named using the E. coli codon system. The rpob mutation, 170 (GTC > TTC, Val > Phe), now named using the MTBC codon system, is the same as 176 (GTC > TTC, Val > Phe), named previously using the E. coli codon system. Page 14 of 14