Chapter 11. Transcription. The biochemistry and molecular biology department of CMU

Transcription

1 Chapter 11 Transcription The biochemistry and molecular biology department of CMU

2 Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA.

3 Similarity between replication and transcription Both processes use DNA as the template. Phosphodiester bonds are formed in both cases. Both synthesis directions are from 5 to 3.

4 Differences between replication and transcription replication transcription template double strands single strand substrate dntp NTP primer yes no Enzyme DNA polymerase RNA polymerase product dsdna ssrna base pair A-T, G-C A-U, T-A, G-C

5 Section 1 Template and Enzymes

6 The whole genome of DNA needs to be replicated, but only small portion of genome is transcribed in response to the development requirement, physiological need and environmental changes. DNA regions that can be transcribed into RNA are called structural genes.

7 1.1 Template The template strand is the strand from which the RNA is actually transcribed. It is also termed as antisense strand. The coding strand is the strand whose base sequence specifies the amino acid sequence of the encoded protein. Therefore, it is also called as sense strand.

8 5' G C A G T A C A T G T C 3' coding strand 3' C G T C A T G T A C A G 5' template strand transcription 5' G C A G U A C A U G U C 3' RNA

9 Asymmetric transcription Only the template strand is used for the transcription, but the coding strand is not. Both strands can be used as the templates. The transcription direction on different strands is opposite. This feature is referred to as the asymmetric transcription.

10 5' 3' 3' 5'

11 Organization of coding information in the adenovirus genome

12 1.2 RNA Polymerase The enzyme responsible for the RNA synthesis is DNA-dependent RNA polymerase. The prokaryotic RNA polymerase is a multiple-subunit protein of ~480kD. Eukaryotic systems have three kinds of RNA polymerases, each of which is a multiple-subunit protein and responsible for transcription of different RNAs.

13 Holoenzyme The holoenzyme of RNA-pol in E.coli consists of 5 different subunits: α 2 β β ωσ. holoenzyme core β σ β ω α α

14 RNA-pol of E. Coli subunit MW function α Determine the DNA to be transcribed β Catalyze polymerization β β Bind & open DNA template σ Recognize the promoter for synthesis initiation

15 Rifampicin, a therapeutic drug for tuberculosis treatment, can bind specifically to the β subunit of RNApol, and inhibit the RNA synthesis. RNA-pol of other prokaryotic systems is similar to that of E. coli in structure and functions.

16 RNA-pol of eukaryotes RNA-pol I II III products 45S rrna hnrna 5S rrna trna snrna Sensitivity to Amanitin No high moderate Amanitin is a specific inhibitor of RNA-pol.

17 1.3 Recognition of Origins Each transcriptable region is called operon. One operon includes several structural genes and upstream regulatory sequences (or regulatory regions). The promoter is the DNA sequence that RNA-pol can bind. It is the key point for the transcription control.

18 Promoter 5' 3' regulatory sequences promotor RNA-pol structural gene 3' 5'

19 Prokaryotic promoter 5' 3' region T T G A C A A A C T G T -10 region T A T A A T A T A T T A (Pribnow box) Consensus sequence start 3' 5'

20 Consensus Sequence Frequency in 45 samples

21 The -35 region of TTGACA sequence is the recognition site and the binding site of RNA-pol. The -10 region of TATAAT is the region at which a stable complex of DNA and RNA-pol is formed.

22 Section 2 Transcription Process

23 General concepts Three phases: initiation, elongation, and termination. The prokaryotic RNA-pol can bind to the DNA template directly in the transcription process. The eukaryotic RNA-pol requires cofactors to bind to the DNA template together in the transcription process.

24 2.1 Transcription of Prokaryotes Initiation phase: RNA-pol recognizes the promoter and starts the transcription. Elongation phase: the RNA strand is continuously growing. Termination phase: the RNA-pol stops synthesis and the nascent RNA is separated from the DNA template.

25 a. Initiation RNA-pol recognizes the TTGACA region, and slides to the TATAAT region, then opens the DNA duplex. The unwound region is about 17±1 bp.

26 The first nucleotide on RNA transcript is always purine triphosphate. GTP is more often than ATP. The pppgpn-oh structure remains on the RNA transcript until the RNA synthesis is completed. The three molecules form a transcription initiation complex. RNA-pol (α 2 ββ σ) - DNA - pppgpn- OH 3

27 No primer is needed for RNA synthesis. The σ subunit falls off from the RNApol once the first 3,5 phosphodiester bond is formed. The core enzyme moves along the DNA template to enter the elongation phase.

28 b. Elongation The release of the σ subunit causes the conformational change of the core enzyme. The core enzyme slides on the DNA template toward the 3 end. Free NTPs are added sequentially to the 3 -OH of the nascent RNA strand.

29 RNA-pol, DNA segment of ~40nt and the nascent RNA form a complex called the transcription bubble. The 3 segment of the nascent RNA hybridizes with the DNA template, and its 5 end extends out the transcription bubble as the synthesis is processing.

30 Transcription bubble

31 RNA-pol of E. Coli

32 RNA-pol of E. Coli

33

34

35 Simultaneous transcriptions and translation

36 c. Termination The RNA-pol stops moving on the DNA template. The RNA transcript falls off from the transcription complex. The termination occurs in either ρ - dependent or ρ -independent manner.

37 The termination function of ρ factor The ρ factor, a hexamer, is a ATPase and a helicase.

38 ρ-independent termination The termination signal is a stretch of nucleotides on the RNA transcript, consisting of many GC followed by a series of U. The sequence specificity of this nascent RNA transcript will form particular stem-loop structures to terminate the transcription.

39 DNA rpll protein 5 TTGCAGCCTGACAAATCAGGCTGATGGCTGGTGACTTTTTAGGCACCAGCCTTTTT TTGCAGCCTGACAAATCAGGCTGATGGCTGGTGACTTTTTAGTCACCAGCCTTTTT... 3 RNA UUUU... UUUU...

40

41 Stem-loop disruption The stem-loop structure alters the conformation of RNA-pol, leading to the pause of the RNA-pol moving. Then the competition of the RNA- RNA hybrid and the DNA-DNA hybrid reduces the DNA-RNA hybrid stability, and causes the transcription complex dissociated. Among all the base pairings, the most unstable one is ru:da.

42 2.2 Transcription of Eukaryotes a. Initiation Transcription initiation needs promoter and upstream regulatory regions. The cis-acting elements are the specific sequences on the DNA template that regulate the transcription of one or more genes.

43 Cis-acting element cis-acting element GCGC CAAT TATA exon structural gene intron exon start TATA box (Hogness box) enhancer CAAT box GC box

44 TATA box

45 Transcription factors RNA-pol does not bind the promoter directly. RNA-pol II associates with six transcription factors, TFII A - TFII H. The trans-acting factors are the proteins that recognize and bind directly or indirectly cis-acting elements and regulate its activity.

46 TF for eukaryotic transcription

47 Pre-initiation complex (PIC) TBP of TFII D binds TATA TFII A and TFII B bind TFII D TFII F-RNA-pol complex binds TFII B TFII F and TFII E open the dsdna (helicase and ATPase) TFII H: completion of PIC

48 Pre-initiation complex (PIC) RNA pol II TF II A TBP TAF TATA TF II F TF II B TF II E TF II H DNA

49 Phosphorylation of RNA-pol TF II H is of protein kinase activity to phosphorylate CTD of RNA-pol. (CTD is the C-terminal domain of RNA-pol) Only the p-rna-pol can move toward the downstream, starting the elongation phase. Most of the TFs fall off from PIC during the elongation phase.

50 b. Elongation The elongation is similar to that of prokaryotes. The transcription and translation do not take place simultaneously since they are separated by nuclear membrane.

51 nucleosome RNA-Pol moving direction RNA-Pol RNA-Pol

52 c. Termination The termination sequence is AATAAA followed by GT repeats. The termination is closely related to the post-transcriptional modification.

53

54 Section 3 Post-Transcriptional Modification

55 The nascent RNA, also known as primary transcript, needs to be modified to become functional trnas, rrnas, and mrnas. The modification is critical to eukaryotic systems.

56

57 3.1 Modification of hnrna Primary transcripts of mrna are called as heteronuclear RNA (hnrna). hnrna are larger than matured mrna by many folds. Modification includes Capping at the 5 - end Tailing at the 3 - end mrna splicing RNA edition

58 a. Capping at the 5 - end OH OH O O O H N 2 N N H 2 C O P HN N 5' O O O P O O O P O O 5' CH 2 O N N N NH NH 2 O CH 3 Pi O O P O OH AAAAA-OH 3' O m 7 GpppGp----

59

60 The 5 - cap structure is found on hnrna too. The capping process occurs in nuclei. The cap structure of mrna will be recognized by the cap-binding protein required for translation. The capping occurs prior to the splicing.

61 b. Poly-A tailing at 3 - end There is no poly(dt) sequence on the DNA template. The tailing process dose not depend on the template. The tailing process occurs prior to the splicing. The tailing process takes place in the nuclei.

62 c. mrna splicing mrna DNA The matured mrnas are much shorter than the DNA templates.

63 Split gene The structural genes are composed of coding and non-coding regions that are alternatively separated bp L A B C D E F G A~G no-coding region 1~7 coding region

64 Exon and intron Exons are the coding sequences that appear on split genes and primary transcripts, and will be expressed to matured mrna. Introns are the non-coding sequences that are transcripted into primary mrnas, and will be cleaved out in the later splicing process.

65 mrna splicing

66 Splicing mechanism

67 lariat

68 Twice transesterification intron 5'exon 3'exon 5' U pa G pu 3' pg-oh pgpa 5' UOH first transesterification G pu 3' 5' U pu 3' second transesterification 5' pgpa GOH 3'

69 d. mrna editing Taking place at the transcription level One gene responsible for more than one proteins Significance: gene sequences, after post-transcriptional modification, can be multiple purpose differentiation.

70 Different pathway of apo B Human apo B gene hnrna ( base) CAA to UAA At 6666 liver apo B100 (500 kd) intestine apo B48 (240 kd)

71 3.2 Modification of trna

72 Precursor transcription DNA TGGCNNAGTGC GGTTCGANNCC RNA-pol III trna precursor

73 Cleavage RNAase P endonuclease ligase

74 Addition of CCA-OH trna nucleotidyl transferase ATP ADP

75 Base modification (2) (1) (1) 1. Methylation A ma, G mg 2. Reduction U DHU 3. Transversion U ψ (3) (4) 4. Deamination A I

76 3.3 Modification of rrna 45S transcript in nucleus is the precursor of 3 kinds of rrnas. The matured rrna will be assembled with ribosomal proteins to form ribosomes that are exported to cytosolic space.

77 rrna 18S 5.8S 28S 45S-rRNA transcription 18S-rRNA splicing 5.8S and 28S-rRNA

78 3.4 Ribozyme The rrna precursor of tetrahymena has the activity of self-splicing (1982). The catalytic RNA is called ribozyme. Self-splicing happened often for intron I and intron II.

79 Both the catalytic domain and the substrate locate on the same molecule, and form a hammer-head structure. At least 13 nucleotides are conserved.

80 Hammer-head

81 Significance of ribozyme Be a supplement to the central dogma Redefine the enzymology Provide a new insights for the origin of life Be useful in designing the artificial ribozymes as the therapeutical agents

82 Artificial ribozyme Thick lines: artificial ribozyme Thin lines: natural ribozyme X: consensus sequence Arrow: cleavage point