From DNA to Protein. Chapter 14

Transcription

1 From DNA to Protein Chapter 14

2 What do genes code for? How does DNA code for cells & bodies? How are cells and bodies made from the instructions in DNA? DNA proteins cells bodies

3 The Central Dogma Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein trait replication DNA gets all the glory, but proteins do all the work!

4 Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by nonfunctional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism metabolic pathway Am I just the sum of my proteins? disease disease disease disease A B C D E enzyme 1 enzyme 2 enzyme 3 enzyme 4

5 From Gene to Protein a a a nucleus DNA transcription cytoplasm mrna translation ribosome a a a a a a a a a a a a a protein trait

6 Transcription From DNA nucleic acid language to RNA nucleic acid language Produces mrna

7 RNA Contains ribose sugar N-bases Uracil instead of thymine U : A C : G Single stranded Different types DNA transcription RNA

8 3 Types of RNA Messenger RNA (mrna) Carries DNA sequence to the ribosome Ribosomal RNA (rrna) Component of a ribosome Transfer RNA (trna) Carries amino acid (anticodon) to the codon on mrna

9 Synthesis of an RNA Transcript The stages of translation: Initiation Elongation Termination

10

11 RNA Polymerase Binding and Initiation of Transcription Promoters signal the initiation of RNA synthesis Transcription factors Help eukaryotic RNA polymerase recognize promoter sequences

12 Transcription Making a copy of the DNA RNA polymerase separates the DNA strands at a promoter region on the DNA (TATA box) RNA polymerase adds nucleotides in sequence to mrna RNA polymerase falls off the DNA at a terminator sequence on the DNA

13 Matching Bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U G U C C G A A U A G A C U 5' A A C C RNA 3' G polymerase G C A G U A U C T G G T A C A G C T A G T C A T C G T A C C G T

14 Transcription Step 1 DNA is unwound by RNA polymerase

15 Transcription Step 2 Transcription of mrna complementary to DNA

16 Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence Introns come out! eukaryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence

17 mrna Splicing Post-transcriptional processing eukaryotic DNA primary mrna transcript eukaryotic mrna needs work after transcription primary transcript = pre-mrna mrna splicing edit out introns make mature mrna transcript mature mrna transcript intron = noncoding (inbetween) sequence exon = coding (expressed) sequence ~10,000 bases pre-mrna ~1,000 bases spliced mrna

18 Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG CGG UCC GAU AAG GGC CAU Met Arg Ser Asp Lys Gly His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG CGG GUC CGA UAA GGG CCA U Met Arg Val Arg STOP

19 RNA Splicing Enzymes snrnps small nuclear RNA proteins Spliceosome several snrnps recognize splice site sequence cut & paste gene exon No, 5' not smurfs! snurps exon mature mrna 5' snrna intron snrnps exon 5' 3' 5' exon 3' spliceosome 3' lariat 3' excised intron

20 More post-transcriptional processing Need to protect mrna on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mrna protect the ends of the molecule add 5 GTP cap add poly-a tail longer tail, mrna lasts longer: produces more protein 3' mrna A 5' G P P P

21 Translation From nucleic acid language to amino acid language Occurs in ribosomes

22 How does mrna code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 DNA ATCG TACGCACATTTACGTACGCGG 4 mrna protein 20 AUCG AUGCGUGUAAAUGCAUGCGC? Met Arg Val Asn Ala Cys Ala

23 mrna codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mrna AUGCGUGUAAAUGCAUGCGC? protein Met Arg Val Asn Ala Cys Ala

24 Cracking the code Crick Nirenberg & Khorana determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mrna amino acid match added fabricated mrna to test tube of ribosomes, trna & amino acids created artificial UUUUU mrna found that UUU coded for phenylalanine

25 Marshall Nirenberg Har Khorana

26 The Code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid Start codon AUG methionine Stop codons UGA, UAA, UAG

27 How are the codons matched to amino acids? DNA mrna trna amino acid 3 5 TACGCACATTTACGTACGCGG 5 3 AUGCGUGUAAAUGCAUGCGCC 3 5 UAC Met GCA CAU Arg Val codon anti-codon

28 Transfer RNA structure Clover leaf structure anticodon on clover leaf end amino acid attached on 3 end

29 Building a Polypeptide Initiation mrna, ribosome subunits, initiator trna come together Elongation adding amino acids based on codons Termination STOP codon = Release factor Met Leu Met Met Met Leu Leu Leu Val Ser Ala Trp release factor trna U A C G A C 5' U A C 5' U A C G A C A A C A A U 5' A U G C U G A A U 5' mrna A U G C U G U A U G U G 3' 3' 3' E P A U A C G A C C A A U A U G U G 3' A C C U G G U A A 3'

30 DNA RNA polymerase Can you tell the story? pre-mrna exon intron 5' GTP cap amino acids trna large ribosomal subunit mature mrna poly-a tail aminoacyl trna synthetase 3' polypeptide 5' small ribosomal subunit E P A trna ribosome

31 In Laboratory Experiments Genes can be transcribed and translated after being transplanted from one species to another

32

33 Gene Mutations Substitution Insertion Deletion Point Mutation Frameshift Mutation

34 Protein Bacterial chromosome Synthesis in Prokaryotes Transcription mrna Psssst no nucleus! Cell membrane Cell wall

35 Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons eukaryotic DNA intron = noncoding (inbetween) sequence introns come out! exon = coding (expressed) sequence

36 Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mrna editing ribosomes read mrna as it is being transcribed

37 Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing

38 Mutations

39 Mutations Point mutations single base change silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon When do mutations affect the next generation?

40 Point mutation lead to Sickle cell anemia What kind of mutation? Missense!

41 Mutations Frameshift shift in the reading frame changes everything downstream insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene?