B lymphocytes in humans express ZAP-70 when activated in vivo

Transcription

1 558 Giovanna Cutrona et al. Eur. J. Immunol : Cellular immune response B lymphocytes in humans express ZAP-70 when activated in vivo Giovanna Cutrona 1, Monica Colombo 1, Serena Matis 2, Daniele Reverberi 1, Mariella Dono* 1, Vincenzo Tarantino 3, Nicholas Chiorazzi 4,5,6 and Manlio Ferrarini 1,2 1 Division of Medical Oncology C, Istituto Nazionale per la Ricerca sul Cancro, IST, Genova, Italy 2 Department of Oncology, Biology and Genetics, University of Genova, Genova, Italy 3 Department of Otolaryngology, Scientific Direction, Istituto G. Gaslini, Genova, Italy 4 Institute for Medical Research, North Shore LIJ Health System, Manhasset, NY, USA 5 Department of Medicine, North Shore University Hospital, Manhasset, NY, USA 6 Departments of Medicine and Cell Biology, Albert Einstein College of Medicine, Bronx, NY, USA ZAP-70 is a protein tyrosine kinase initially found in T and NK cells. Recently, this important signaling element was detected in leukemic B cells from a subgroup of patients with B cell chronic lymphocytic leukemia (B-CLL). In this study, ZAP-70 was detected in normal B cells from human tonsils, but not from peripheral blood. The cdna sequence of B cell ZAP-70 was the same as that in T cells. Germinal center B cells and plasma cells had a substantial proportion of ZAP-70 + cells, while memory and follicular mantle B cells, which contain low numbers of activated B cells, expressed relatively little ZAP-70. A cell fraction of IgD +, CD38 + B cells, which are comprised of many in vivo activated B cells, exhibited the highest levels of ZAP-70. Density gradient fractionation of tonsil B cells confirmed that ZAP-70 was not expressed by resting B cells, but was expressed by buoyant, in vivo activated B cells. In these B cells, the expression of ZAP-70 correlated with that of CD38 and not with that of CD5, a hallmark of B-CLL cells. B-CLL cells are activated cells and their ZAP-70 expression reflects a normal property of activated B cells populations rather than a neoplastic aberration. Received 6/5/05 Revised 7/12/05 Accepted 5/1/06 [DOI /eji ] Key words: Activated B cells B cells subsets B-CLL Human B lymphocytes ZAP-70 Introduction Correspondence: Giovanna Cutrona, Division of Medical Oncology C, Istituto Nazionale per la Ricerca sul Cancro, IST, Genova, Italy Fax: giovanna.cutrona@istge.it Abbreviations: ACT: activated B-CLL: chronic lymphocytic leukemia cdna: complementary DNA FM: follicular mantle FSC: forward scatter HRP: horseradish peroxidase IgV H : immunoglobulin heavy chain variable region MEM: memory cells MFI: mean fluorescence intensity MNC: mononuclear cells PB: peripheral blood PC: plasma cells PE-CY7: phycoerythrin cyanin7 RPII: RNA polymerase II SSC: side scatter WB: Western blotting ZAP-70 is a protein tyrosine kinase that plays a key role in transducing signals received by the receptors for antigen of Tcells (TCR) or the regulatory receptors of NK cells [1]. Initially, ZAP-70 was detected in B lymphocytes at early maturation stages only, when, in the pro-b to pre-b cell transition, ZAP-70 participates in the transduction of signals delivered by the microenvironment through the B cell antigen receptor (BCR) [2, 3]. * Present address: Division of Clinical Pathology, Ospedale Sant'Andrea, La Spezia, Italy

2 Eur. J. Immunol : Cellular immune response 559 Because of its absence from normal, mature B lymphocytes, it was surprising that ZAP-70 mrna and protein exist in the cells of patients with B-CLL [4, 5], a lymphoproliferative disorder of mature B lymphocytes. B-CLL can be subdivided into two subgroups based on the presence (mutated B-CLL) or the absence (unmutated B-CLL) of somatic point mutations in the IgV region genes utilized by the neoplastic cells [6, 7]. Patients with unmutated B-CLL have a worse clinical course and outcome [8, 9]. ZAP-70 mrna was initially found elevated by gene expression profiling in the cells from the majority of unmutated cases and from the minority of mutated B-CLL [4, 10]. The predominant presence of ZAP-70 protein in the unmutated B-CLL was subsequently demonstrated by Western blotting (WB) and flow cytometry [4, 10 12]. ZAP-70 protein measurements are currently used in a clinical setting for prognostic assessment, since ZAP-70 determination may represent a valid and practical surrogate to IgV H gene sequencing for B-CLL subgrouping [12, 13]. Moreover, ZAP-70 is involved in the BCR-initiated signal transducing pathway of B-CLL cells [14], which may be relevant for pathogenesis of the disease, because repetitive signaling through the BCR may constitute a promoting factor for B-CLL cell expansion [15 17]. In principle, the expression of ZAP-70 could represent a unique feature of B-CLL cells acquired as a consequence of malignant transformation, especially since the malignant cells from other lymphoproliferative disorders also express ZAP-70 [18, 19]. Alternatively, ZAP-70 expression could be a typical characteristic of a fraction of normal B cells that share some properties with B-CLL cells. Because B-CLL cells resemble activated B cells [20], in vivo activated B lymphocytes appeared the most plausible B cell subset capable of expressing ZAP-70. We demonstrate here that tonsils contain populations of relatively large B lymphocytes that express cell surface activation markers and contain ZAP-70 within their cytoplasm. Results ZAP-70 expression by tonsil B cells B cell suspensions from mononuclear cells (MNC) of peripheral blood (PB) and tonsils were analyzed for ZAP- 70 expression by WB together with purified T cells (Fig. 1A). A band of the same mobility (70 kda) as the ZAP-70 band observed in Tcells (lane N) was detected in tonsil B cells (lanes E H), but was absent (lanes A, B) or only barely discernible (lanes C, D) in PB B cells. The intensity of this 70-kDa band in tonsil B cells was comparable to that detected with equal numbers of cells from a B-CLL case classified as weakly ZAP-70 positive (case GE115, lane L) and less than that of B-CLL cells classified as strongly ZAP-70 positive(case GE 145, lane I). Next, cytospin preparations of B cells purified from PB or tonsils were fixed and stained for ZAP-70 expression by immunocytochemistry (Fig. 1B). While PB B cells were virtually negative, variable proportions of ZAP-70 + B cells (from 20% to 40% depending upon the case) were observed in tonsils. ZAP-70 intensity of single B cells was always lower than that of T cells. ZAP-70 + B cells also were detected by flow cytometry. Tonsil B cell suspensions, partially depleted of T cells by rosette techniques (from now onwards referred to as partially purified B cells), were examined for the concomitant expression of surface membrane CD19 and CD3 and of intracellular ZAP-70 using specific mab. Because some T cells remained in the partially purified B cell suspensions, it was possible to assess the relative intensity of ZAP-70 expression in B cells by gating on CD3 + cells. In control preparations, the cells were exposed to CD19 and CD3 mab, permeabilized and reacted with a control mab of the same IgG2a subclass as the ZAP-70 mab, but that specifically bound CD33, a molecule not expressed on the membrane or in the cytoplasm of mature T and B cells. As shown in Fig. 1C, virtually all of the CD3 + cells were ZAP-70 positive and CD33 negative. Consistently lower values for ZAP-70 expression were observed in B cells [20 40% positive cells, mean fluorescence intensity (MFI) calculated on the gated CD19 + populations, range of 20 tests on different tonsils], and these cells remained CD33 negative. When the same procedures were applied to PB B cells, virtually no cells were ZAP-70 + B cells. However, it should be noted that a minor shift of the ZAP-70 staining of the whole B cell population was observed both in the tonsil and the PB, possibly suggesting that very low levels of ZAP-70 might be expressed in the B cell compartment. The type of ZAP-70 fluorescence observed in tonsil B cells was similar to that of weakly staining B-CLL cells shown in Fig. 2A, which reports the ZAP-70 flow cytometry profiles of the same three B-CLL cases studied in Fig. 1A. Again, the minor fluorescence shift following ZAP-70 staining was also seen in the B- CLL cells as reported previously [11, 13, 21]. To exclude that large neoplastic cells were registered as ZAP-70 positive because of nonspecific mab binding, we reacted the malignant cells of HeLa cell line with CD13 mab. These cells were permeabilized and treated with ZAP-70 mab or CD19 (control) mab. HeLa cells were found to be ZAP-70 negative by WB (not shown) and CD19 negative by flow cytometry in preliminary tests. As shown in Fig. 2B, HeLa cells were negative for ZAP-70 by flow cytometry, although a minor fluorescent shift was also observed in this case. This shift was consistently lower than that observed in the weakly positive B-CLL cells.

3 560 Giovanna Cutrona et al. Eur. J. Immunol : Figure 1. Expression of ZAP-70 by B cells. (A) Highly purified B cells from four different PBMC preparations (lanes A D), from four tonsils (E H), from three different B-CLL patients (I, L, M), and from purified T cells (N) were analyzed for ZAP-70 expression by WB. The B-CLL cells were strongly ZAP-70 positive (I), weakly ZAP-70 positive (L) and ZAP-70 negative (M), respectively. The ZAP-70 mab was clone 2F3.2 (Upstate), although comparable results were obtained using other two ZAP-70 mab. (B) Immunocytochemical demonstration of ZAP-70 in different lymphocyte populations. Staining was carried out with clone 2F3.2 mab (Upstate). (C, D) Flow cytometry demonstration of ZAP-70 expression by tonsil (C) and peripheral blood (D) T and B cells. Tonsil cells and PBMC suspensions were partially depleted of T cells. PBMC also were depleted of monocytes. The cells were stained for CD19 and CD3, permeabilized and exposed to ZAP-70 or CD33 (control) mab. Both B (CD19 + ) and T (CD3 + ) cells were gated and analyzed. The MFI of ZAP-70 as shown was calculated on the whole B or T cell population, following subtraction of the control values observed in the CD33 mab-stained preparations Expression of ZAP-70 by B cell subpopulations Tonsil B cells are a heterogeneous population comprised of different subsets [22, 23]. Therefore, we investigated whether expression of ZAP-70 was a feature of one of the several known subpopulations. Tonsil B cell suspensions extensively depleted of T cells (highly purified B cells) were exposed to mab specific for CD19, CD38, IgD and CD3. The CD19 + B cells were gated according to the expression of CD38 and IgD (Fig. 3), and subsequently FACS-sorted. This method leads to the isolation of follicular mantle (FM; IgD positive, CD38 negative), memory (MEM; IgD negative and CD38 negative), and germinal center (GC) B cells and plasma cells (PC) [22, 23]. GC B cells and PC are both CD38 positive, albeit at varying intensities (see Fig. 3A), and IgD negative [22].

4 Eur. J. Immunol : Cellular immune response 561 Figure 2. Expression of ZAP-70 by neoplastic cells. (A) Flow cytometry profiles of cells from the three different B-CLL cases shown in Fig. 1A exposed to ZAP-70 mab. Staining was performed as described in Fig. 1D. T and NK cells were not removed from the suspensions and are seen as CD19, ZAP-70 + cells. (B) Flow cytometry profiles of the cells from HeLa cell line exposed to ZAP-70 mab. A CD19 mab was used for the control preparations as indicated. With this approach, a heterogeneous B cell subset is also isolated, which we have operationally called "activated (ACT) B cells". This subset is comprised of CD5 + and CD5 cells (see below) at various stages of activation and of some GC B cell progenitors [23, 24]. The sorted cell populations were analyzed by both WB and real-time quantitative PCR. As shown in Fig. 3B, which reports one typical experiment out of three performed, ACT B cells had the highest ZAP-70 protein levels. However, substantial ZAP-70 levels were detected consistently in PC and GC B cells, whereas FM and MEM B cells had low or negative ZAP-70 levels. Similar data were obtained using real-time PCR (Fig. 3C). This technique also provided unequivocal demonstration that the B cells populations used were depleted of CD3 + cells, since CD3 mrna could not be detected in B cells. In another set of experiments, highly purified B cells were analyzed for surface expression of CD19, CD38,

5 562 Giovanna Cutrona et al. Eur. J. Immunol : Figure 3. Expression of ZAP-70 by B cell subsets in human tonsils. Purified tonsil B cells were stained for CD19, IgD, CD38, and CD3. (A) CD19 + B cells were gated to avoid any contamination of Tor NK cells, and sorted based on IgD and CD38 expression. Five B cells subpopulations were obtained as indicated. (B) WB analysis for ZAP-70 expression of the sorted B cell subpopulations. (C) Realtime PCR analyses of ZAP-70 and CD3 mrna expression the different tonsil B cell subsets and purified T cells. The percentage of the relative mrna concentration were calculated on the basis on GAPDH and RPII house keeping gene mrna expressed by each cell population tested. The mean values SD of three different tests are shown. (D) Flow cytometry analysis of ZAP-70 in the five B cell subsets. Purified B cells were stained for CD19, IgD, CD38 and ZAP-70 and separated according to CD38 and IgD expression as in (A). Each fraction was analyzed for CD19 and Zap-70 expression as indicated. Control preparations were stained with CD33 mab. ACT, GC and FM B cells were electronically gated into small (GATE 1) or large (GATE 2) cells and analyzed separately. The MFI of ZAP- 70 as shown was calculated on the whole gated population, following subtraction of the control values observed in the CD33 mabstained preparations

6 Eur. J. Immunol : Cellular immune response 563 and IgD, and intracellular expression of ZAP-70. Control tests were carried out on the same suspensions using the same approach, except that a CD33 mab was used in place of ZAP-70 mab. The cells were electronically gated into the cell subsets indicated in Fig. 3A and analyzed for ZAP-70 expression by flow cytometry. ACT, GC and PC cell fractions were comprised of ZAP-70 + cells, while only a minor florescence shift was recorded in FM and MEM B cells (Fig. 3D). While MEM B cells and PC had a rather uniform forward scatter (FSC) profile, ACT, FM and GC were comprised of different size cells which were electronically gated and analyzed separately. The larger cells in ACT, and FM B cells (GATE 2) stained brighter for ZAP-70 than the smaller cells (GATE 1), whereas minor differences in fluorescence intensity were observed in the two GC cell fractions (Fig. 3D). Notably in all these populations CD19 expression was brighter in the large than in the small cells. Demonstration of ZAP-70 expression by B cells activated naturally in vivo The low expression of ZAP-70 by FM and MEM B cells, which contain few in vivo activated B cells [23] and the much higher expression of ZAP-70 by the cells from the other fractions which contain numerous in vivo activated B cells, suggested a correlation between B cell activation and ZAP-70 expression. This issue was investigated as follows. Partially purified tonsil B cells were incubated with mab reactive with CD3, CD19 and ZAP-70 or CD3, CD19 and CD33, electronically gated into large or small cell fractions and analyzed for ZAP-70 expression. ZAP B cells were more abundant in the large than in the small B cells as indicated in Fig. 4A. In a subsequent series of experiments, highly purified tonsil B cells were fractionated on discontinuous Percoll-density gradients and analyzed for ZAP-70 expression by flow cytometry. ZAP-70 was abundant in 50% Percoll fractions that contain mainly activated B cells and in 30 40% Percoll fractions that contain mainly GC cells and some PC [23]. ZAP-70 staining resulted only in a minor fluorescence shift in the denser (60% Percoll) cell fractions (Fig. 4B), which comprise resting B cells. The finding that CD71, an activation marker [20], and CD27 [25], both an activation and a memory cell marker (Fig. 4B), were expressed by the cells sedimenting in lighter Percoll fractions at much higher levels than by resting cells stresses further the correlation between B cell activation and ZAP-70 expression. The ZAP-70 +, activated B cells were CD3 and CD56 negative, excluding the possibility that the observed data were due to the presence of contaminant T or NK cells (Fig. 4B). The cells sedimenting at the same three fractions in the Percoll-density gradients were analyzed individually by WB and by RT-PCR. ZAP-70 protein was observed by WB in the 50% and 30 40% Percoll cell fraction, but was barely discernible in the 60% Percoll cell fraction (Fig. 4C). ZAP-70 mrna, amplified with primers specific for the catalytic region of ZAP-70, was detected in the cells from the 50% and 30 40% Percoll fractions. In these conditions, the dense cells from the 60% Percoll fractions exhibited a faint band (Fig. 4D). The presence of this faint band in RT-PCR and in WB studies together with the minor fluorescence shift observed by flow cytometry suggests that resting B cells might synthesize minute quantities of ZAP-70, which are, however, much below the levels of ZAP-70 observed in activated B cells. The ZAP-70 mrna band was isolated and sequenced. The sequence was identical to that of ZAP-70 mrna amplified from T cells and, when this sequence was compared using the BLAST algorithm, it matched ZAP- 70 (accession number NM ). Correlation between ZAP-70 and CD 38 expression among in vivo activated tonsil B cells B-CLL cells always express CD5 (as reviewed in [15, 16]). Moreover, in those B-CLL cases in which the leukemic cells express ZAP-70, they often also express CD38 [5]. Based upon these considerations, we investigated the potential correlations existing between CD38, CD5 and ZAP-70 expression in in vivo activated B cells from the 50% Percoll gradient. Highly purified tonsil B cells from the 50% Percoll-density gradient were first fractionated into CD5 + and CD5 cells. Each of these cell fractions was separated further into CD38- strongly positive, CD38-weakly positive and CD38 cells and analyzed for ZAP-70 expression by WB. As shown in Fig. 5A, ZAP-70 was found to a similar degree in both CD5 + and in CD5 cells; in contrast, expression of ZAP- 70 was higher in CD38 + than in CD38 cells. The correlation existing between CD38 and ZAP-70 expression was confirmed by incubating B cells from the 50% Percoll fractions with mab reactive with ZAP-70, CD38 and CD5 and analyzing by flow cytometry. As shown in Fig. 5B, the highest levels of ZAP-70 were found in cells with the highest density of surface CD38. In contrast, both CD5 + and CD5 B cells were found to express ZAP- 70 (not shown). Notably, the larger cells also had the highest levels of both CD38 and ZAP-70. This is apparent from both Fig. 5B, where the CD38 + cells were differently gated and analyzed for ZAP-70 expression and from Fig. 5C. In this last experiment, the cells from the whole 50% cell fraction were electronically separated according to size and analyzed for CD38 and ZAP-70 expression.

7 564 Giovanna Cutrona et al. Eur. J. Immunol : Figure 4. Expression of ZAP-70 by in vivo activated B cells. (A) Detection of ZAP-70 on the surface of large B cells. Partially purified tonsil B cells were triple stained for CD19, CD3 and ZAP-70 or CD33 (control). The large (Gate 2) and small cells (Gate 1) were electronically gated and the ZAP-70 expression recorded separately for CD19 + and CD3 + cells. The MFI of ZAP-70 as shown was calculated on the whole gated population, following subtraction of the control values observed in the CD33-mab stained preparations. (B D) Highly purified tonsil B cells or their fractions migrating in different fractions of the Percoll-density gradient were analyzed for ZAP-70 expression by flow cytometry (B),WB (C) or RT-PCR (D). In the flow cytometry tests, the cells suspensions from the indicated fractions were stained for the indicated markers. For the ZAP-70 staining the control was a CD33 mab, whereas another unrelated, isotype-matched mab was used for the other preparations. For the WB and RT-PCR analyses, the order of the lanes is unfractioned B cells (A), B cells from 60% (B), 50% (C), and 30 40% (D) fractions of Percoll gradients.

8 Eur. J. Immunol : Cellular immune response 565 Figure 5. Correlation between ZAP-70 and CD38 expression in tonsil B cells. (A) Highly purified tonsil B cells from the 50% Percoll fraction were separated into CD5 + (lanes A C) and CD5 cells (lanes D F). Each of these fractions was subsequently separated into CD38-strongly positive (lanes A, D), CD38-weakly positive (lanes B, E) and CD38 cells (lanes C, F). All these cell fractions were subsequently analyzed for ZAP-70 expression by WB. This experiment also shows that the anti-zap-70 mab clone 29 detects consistently an additional band of approximately 68 kda. (B) Highly purified tonsil B cells from the 50% Percoll gradients were triple stained for CD5, CD38 and ZAP-70, or CD33 (control). As shown on left panel, gating was done on four different cell fractions characterized by different CD38 levels and size. The tests for CD5 are not shown since no difference in ZAP-70 expression was seen for CD5 + or CD5 cells. (C) Cells from the 50% Percoll fractions, stained as in B, were electronically separated according to size. Small (GATE 1) and large (GATE 2) cells were analyzed of ZAP-70 or CD38 expressions. Controls were exposed to CD33 mab. The MFI of ZAP-70 as shown was calculated on the whole gated population, following subtraction of the control values observed in the CD33 mab-stained preparations. Discussion In this study, the presence of ZAP-70 in B cells was demonstrated by four different methodologies: WB, immunocytochemistry, flow cytometry, and real-time quantitative PCR. Moreover, WB analyses carried out with three different mabs, each reacting with a different ZAP-70 epitope, provided identical results. cdna sequencing demonstrated that B and T cells utilize a ZAP-70 gene, which is identical to that deposited in the available database at least for the sequences that were compared. Finally, the purification method and the controls used rule out the possibility that the demonstration of ZAP-70 in B cells was due T or NK cell contamination. Cell fractionation studies revealed that only larger, buoyant B cells expressed ZAP-70, both as mrna and protein. Flow cytometry demonstrated more numerous ZAP-70 + cells in large than in small B cells (Fig. 4A) and in the cells expressing surface activation markers

9 566 Giovanna Cutrona et al. Eur. J. Immunol : (Fig. 4B). Thus, a clear correlation exists between ZAP- 70 expression and cellular activation, although we cannot completely exclude the possibility that resting B cells might produce minute quantities of ZAP-70. The correlation with cell activation would explain the virtual absence of ZAP-70 in PB B cells, which comprise very few activated B cells, and also perhaps the differences of ZAP-70 expression between the two major B-CLL subgroups. Previous studies demonstrated that, although all B-CLL cells expressed an activated phenotype, those from the unmutated subgroup exhibit signs of an earlier and more robust activation than those from the mutated B-CLL cases [20]. This suggests that mutated B-CLL cells have not reached or have passed an activation status in vivo sufficient to induce ZAP-70 expression. Because of the heterogeneity inherent in the activation process, it is difficult to provide quantitative assessments of ZAP-70 expression by individual B cells. However, the existing data suggest that the level of ZAP- 70 in B cells is consistently lower than that of T lymphocytes, (Fig. 1B, C), which may explain why ZAP- 70 was considered a molecule restricted in its expression to T or NK cells. Studies of isolated CD5 + and CD5 B cells did not reveal a correlation between either of these cell subsets and ZAP-70 expression since both fractions displayed comparable ZAP-70 levels. This suggests that the ability to produce ZAP-70 is not confined to a particular B cell subset, but may be shared by all B cells when appropriately activated, and is consistent with observations on human B cell subset populations separated by cell sorting (Fig. 3). Indeed, ZAP-70 was detected in virtually all cell fractions, although it was less abundant in FM and MEM B cells that contain a few activated B cells. A clear correlation was found in activated B cells between expression of ZAP-70 and CD38 (Fig. 5). Because CD38 can be up-regulated upon cellular activation [26], these findings suggest that only B cells that have reached a substantial degree of activation express both ZAP-70 and CD38. This would help explain why ZAP-70 + B-CLL cells are more often CD38 positive than CD38 negative. CD38 signals B cells with biological consequences that differ depending upon the maturation status of the B cell themselves, i.e., CD38 induces apoptosis in immature B cells [27], while it prevents apoptosis of GC B cells [28]. Therefore, it is possible that both ZAP-70 and CD38 belong to the same chain of signal transduction events, at least in the fraction of cells we have operationally named ACT B cells. The hypothesis is now amenable to investigation on normal activated B cells, which express ZAP-70 and are not as prone to spontaneous apoptosis in vitro as B-CLL cells [29]. The availability of normal ZAP-70 + B cells also will help to shed light on the function of ZAP-70 in transducing the signals delivered by the BCR. The issue, however, may be more complicated than outlined here, because in cell subsets distinct from ACT B cells, such as PC or GC B cells, the correlation between CD38 and ZAP- 70 was less clear. Indeed, in these two subsets CD38 was expressed by a larger number of cells than ZAP-70 (data not detailed), indicating the possibility that CD38 might have additional functions such as interaction with adhesion molecules of the endothelia and of other stromal elements [26]. While this manuscript was in preparation, Nolz et al. [30] reported that human activated B cells express ZAP- 70, although they did not address the B cell subset subpopulation issue. Interestingly, however, some of their data indicate a potential involvement of ZAP-70 in the BCR-initiated signal transduction pathway of normal B cells. In conclusion, the above findings demonstrate that ZAP-70 expression by B-CLL cells is not ectopic, but is a characteristic of a normal cellular subset that may contain the counterpart of the leukemic cells. Thus, as often has occurred in the past, studies of neoplastic cells provide information on both cancer as well as normal cell physiology. Materials and methods Cell isolation MNC from PB, tonsil and three B-CLL cases (GE 115, GE 145 and GE 182) were isolated by Ficoll-Hypaque (Seromed, Biochrom KG, Berlin, Germany) density gradient centrifugation [31]. To purify B cells, T lymphocytes were removed from the cell suspensions as rosettes with sheep red blood cells by density gradient centrifugation. When used as such, these preparations are referred to as partially purified B cells [31]. Residual contaminating T, NK cells, and monocytes were removed from these cells by anti-cd3, -CD56, -CD16, and - CD14 (Becton Dickinson, San Diego, CA) mab treatment followed by magnetic beads (Goat anti-mouse IgG, Dynabeads, Dynal Biotech ASA, Oslo, Norway).The preparations so obtained are referred to as highly purified B cells [23]. These comprised greater than 95 97% B cells as assessed by staining with anti-cd19, -CD3, and -CD56 mab and flow cytometry (see below). Normal T cells were purified from PBMC by enrichment of cells forming rosettes with sheep red blood cells [23, 31]. Monocytes were obtained from PBMC by adhesion to plastic dishes [23, 31]. B-CLL cells were prepared from the PB from three patients as reported [32]. For the WB (but not for the flow cytometry) studies the B-CLL cells were further depleted of T cells and NK cells. Fractionation of tonsil B cells PC and GC, ACT, MEM and FM B cell subpopulations were isolated by FACS cell sorting according to a method first described by Pascual et al. [22]. In brief, highly purified B cells

10 Eur. J. Immunol : Cellular immune response 567 were incubated with allophycocyanin-conjugated anti-cd19 (Becton Dickinson), PE-conjugated anti-cd38, FITC-conjugated anti-igd (DakoCytomation, Glostrup, Denmark) and PE- CY7-conjugated anti-cd3 (Becton Dickinson). The CD19 + B cells were gated and subsequently FACS sorted (FacsARIA, Becton Dickinson) according to the expression of CD38 and IgD. In another set of experiments, purified tonsil B cells were density fractionated on discontinuous Percoll gradients [23, 31]. The 60% Percoll fraction contained small resting B cells, the 50% Percoll fraction contained large activated B cells, and the 30 40% Percoll fraction contained GC B cells and PC [31]. CD5 + and CD5 tonsil B cell subsets were physically separated using the MiniMACS System (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany). Cells were reacted with FITC-conjugated anti-cd5 mab (Becton Dickinson) followed by anti-fitc antibody-coated magnetic microbeads. The coated cells were filtered on an LS separation column, specifically designed for positive selection. The CD5 + cell fraction was treated with the anti-fitc multisort kit (Miltenyi Biotec) to release the magnetic beads. The CD5 cell fractions were depleted of the remaining CD5 + cells by passage through an LD column, specifically designed for cell depletion. The contamination with remaining CD5 + B cells was consistently below 2% as assessed by flow cytometry. CD5 + and CD5 cell fractions were further fractionated into CD38-strongly positive, CD38-weakly positive and CD38 B cells. This procedure was carried out by exposing the cells to PE-conjugated anti-cd38 mab followed by anti-pe antibody-coated magnetic microbeads. The coated cells were first filtered on an LS column, which retained the high CD38-expressing cells. The cells not retained in the column were subsequently filtered through a LD column to separate CD38-weakly positive cells from the CD38 cells. The low CD38-expressing cells that remained on the column were eluted as above. Determination of ZAP-70 protein by WB ZAP-70 protein levels were measured semi-quantitatively by WB [32]. Cell lysates of the different cell suspensions were obtained after exposure to lysis buffer (9 M urea ph 7, 50 mm Tris). Protein concentrations were determined using the Bio- Rad protein assay (Bio-rad Laboratories, Hercules, CA). A constant amount of protein was separated by SDS-PAGE on 10% acrylamide gels and transferred to polyvinylidene fluoride (PVDF) Hybond P membranes (Amersham Pharmacia Biotech, Buckinghamshire, UK). The membranes were then blocked and exposed to one of the following primary antibodies specific for ZAP-70: clone 2F3.2 (Upstate, Lake Placid, NY), clone 29 (Becton Dickinson), clone 6F7 (Zymed, San Francisco, CA) or to a control mab to b-actin (Sigma- Aldrich, St. Louis, MO) and subsequently to a secondary antimouse Ig antibody conjugated with peroxidase (HRP, Santa Cruz Biotechnology Inc., Santa Cruz, CA). Peroxidase activity was revealed by chemiluminescence (Amersham). The intensity of the ZAP-70 bands in the normal or B-CLL B cell suspensions were compared to that observed in T cells diluted with different proportion of ZAP-70 cells (monocytes). The B- CLL samples were divided into three groups based on the levels of ZAP-70 expression: strong (corresponding to the amount of specific protein contained in a suspension of more than 40% T cells), weak (20 40% T cells) and negative (<20% T cells) [32]. Detection of ZAP-70 + cells by flow cytometry ZAP-70 was detected by using the following protocol: 50 ll B cells, at the concentration of cells/ml, were fixed and permeabilized with fix & perm reagents (Caltag Laboratories, Burlingame, CA) according to the manufacturing instructions.. The cells were subsequently exposed to a ZAP-70 mab conjugated with FITC (Upstate) and analyzed by flow cytometry. A CD33 FITC (Becton Dickinson) mab of the same IgG1 subclass was used as negative control of ZAP-70. To detect ZAP-70 expression in the different tonsil B cell subsets, highly purified B cells were stained with allophycocyanin-conjugated CD19 (BD Pharmingen), IgD-PE (DakoCytomation), CD38-PC5 (Beckman Coulter), fixed, permeabilized and stained with anti-zap-70-fitc mab (Upstate) or the control CD33 mab. CD19 + B cells were gated and ZAP-70 expression was determined on the B cell subsets defined by different IgD and CD38 expression. To detect possible correlations between CD5 or CD38 and ZAP-70 expression, highly purified tonsil B cells were triple stained for CD38, CD5 and ZAP-70 or CD38, CD5 and CD33 (control) as above and analyzed by flow cytometry. The CD38 + or CD5 + cells were electronically gated and the proportions of ZAP-70 + cells recorded. To detected ZAP-70 in B-CLL cells, B- CLL cells were stained with CD3 and CD19 mab, permeabilized and stained for ZAP-70 as above. Epithelial cells from HeLa cell line were stained with CD13 mab, permeabilized and stained for ZAP-70 as above. The cells were analyzed using a Becton Dickinson FacsARIA instrument. Immunocytochemistry Cells were cytocentrifuged using a Cytospin 3 Shandon centrifuge, (Thermo Electron Corporation, Pittsburgh, PA), fixed at 20 C with methanol for 20 min, and re-hydrated with washing buffer solution TBS-T (0.05 M Tris-buffered saline with 0.05% Tween 20). Endogenous peroxidase was blocked according to the EnVision+ System-HRP protocol (DakoCytomation, Glostrup, Denmark). Cells were permeabilized with 1% Triton X-100 in TBS for 90 s and incubated with a primary anti ZAP-70 mab (clone 2F3.2) for 18 h. Bound ZAP-70 mab was detected with the EnVision+ System-HRP according to the manufacturer's protocol. Harris' hematoxylin was used for counterstaining. Control cell preparations were incubated with bovine serum albumin without the primary antibody. PCR Total RNA, extracted from cells, was purified using RNeasy mini kit (Qiagen, Hilden, Germany). Of total RNA, 500 ng was used to generate oligo-dt primed cdna using Superscript II (Invitrogen, Carlsbad, CA). cdna (1 ll) was amplified using primer pairs specific for the catalytic ZAP-70 region [1] (forward primer: 5 0 -CACTCCCAGCCCACCCATCCA; reverse primer 5 0 -GCTGTCGTCGGCACCCA) and B actin as control gene (forward 5 0 -CTCACCCTGAAGTACCCCATCG,

11 568 Giovanna Cutrona et al. Eur. J. Immunol : reverse 5 0 -CTTGCTGATCCACATCTGCTGG). PCR was performed in 50-lL reactions with TaqGold polymerase (Applied Biosystems, Forster City, CA) and 20 pmol of each primer. Cycling conditions were 95 C for 7 min followed by 94 C for 40 s, 60 C for 50 s and 72 C for 1 min 30 s, for up to 30 cycles. Products obtained were purified (Qiaquick gel extraction kit, Qiagen, Hilden, Germany) and sequenced directly with the appropriate 5 0 and 3 0 oligonucleotides using Big Dye Terminator, and analyzed using an automated DNA sequencer (Applied Biosystems, Forster City, CA). Nucleotide sequences were aligned using BLAST ( For quantitative RT-PCR, 500 ng mrna from purified B cell subpopulations (see above) were used to generate cdna using oligo-dt and SuperScript III (Invitrogen). cdna was used for quantitative PCR using Platinum SYBR green qpcr SuperMix UDG (Invitrogen) and analyzed in real time on an Rotor Gene 3000 instrument. All samples were run in triplicate. The PCR was performed in 25 ll containing the 1 Platinum SYBR green qpcr SuperMix UDG (Invitrogen) and 10 pmol of each primer. After initial incubation of 50 C for 2 min and 95 C for 2 min to activate Platinum Taq polymerase, the samples were amplified for 45 cycles of 95 C for 15 s, followed by 60 C for 40 s. Amplification data for the sequences of interest (ZAP-70 and CD3) were normalized to GAPDH and to RPII (RNA polymerase II) housekeeping gene and analyzed using two standard curves software analysis against a standard curve of purified tonsil CD3 + T cells. Primers for ZAP-70 were the same as reported by Rosenwald et al. [4]. Primers for GAPDH were 5 0 -GAAGGTGAAGGTCG- GAGT and 5 0 -CATGGGTGGAATCATATTGGAA; primers for RPII were 5 0 -GACAATGCAGAGAAGCTGG and 5 0 -GCAGGAA- GACATCATCATCC. To exclude that ZAP-70 positivity was caused by contaminant CD3 + T cells, a quantitative PCR specific for CD3d chain was performed (forward primer TTCGGTGACCTGGCTTTATC and reverse primer 5 0 -CCATGT- GATGCTGGTATTGC). All primers were designed on exon sequences to eliminate artifacts related to possible DNA contamination. Acknowledgements: This work was supported in part by AIRC, FIRB (Grant no RBNE01A4Y9 004), MIUR, RO1 Grants (nos. CA and CA 87956) from the National Cancer Institute, and M01 General Clinical Research Center Grant (no. RP018535) from the National Center for Research Resources. References 1 Chan, A. C., Iwashima, M., Turck, C. W. and Weiss, A., ZAP-70: a 70 kd protein-tyrosine kinase that associates with the TCR zeta chain. Cell : Schweighoffer, E., Vanes, L., Mathiot, A., Nakamura, T. and Tybulewicz, V. L., Unexpected requirement for ZAP-70 in pre-b cell development and allelic exclusion. Immunity : Meade, J., Tybulewicz, V. L. and Turner, M., The tyrosine kinase Syk is required for light chain isotype exclusion but dispensable for the negative selection of B cells. Eur. J. Immunol : Rosenwald, A., Alizadeh, A. A., Widhopf, G., Simon, R., Davis, R. E., Yu, X., Yang, L. et al., Relation of gene expression phenotype to immunoglobulin mutation genotype in B cell chronic lymphocytic leukemia. J. Exp. Med : Chen, L., Widhopf, G., Huynh, L., Rassenti, L., Rai, K. R., Weiss, A. and Kipps, T. J., Expression of ZAP-70 is associated with increased B-cell receptor signaling in chronic lymphocytic leukemia. Blood : Schroeder, H. W., Jr. and Dighiero, G., The pathogenesis of chronic lymphocytic leukemia: analysis of the antibody repertoire. Immunol. Today : Fais, F., Ghiotto, F., Hashimoto, S., Sellars, B., Valetto, A., Allen, S. L., Schulman,P.et al., Chronic lymphocytic leukemia B cells express restricted sets of mutated and unmutated antigen receptors. J. Clin. Invest : Damle, R. N., Wasil, T., Fais, F., Ghiotto, F., Valetto, A., Allen, S. L., Buchbinder, A. et al., Ig V gene mutation status and CD38 expression as novel prognostic indicators in chronic lymphocytic leukemia. Blood : Hamblin, T. J., Davis, Z., Gardiner, A., Oscier, D. G. and Stevenson, F. K., Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood : Wiestner, A., Rosenwald, A., Barry, T. S., Wright, G., Davis, R. E., Henrickson, S. E., Zhao, H. et al., ZAP-70 expression identifies a chronic lymphocytic leukemia subtype with unmutated immunoglobulin genes, inferior clinical outcome, and distinct gene expression profile. Blood : Crespo, M., Bosch, F., Villamor, N., Bellosillo, B., Colomer, D., Rozman, M., Marce, S. et al., ZAP-70 expression as a surrogate for immunoglobulinvariable-region mutations in chronic lymphocytic leukemia. N. Engl. J. Med : Rassenti, L. Z., Huynh, L., Toy, T. L., Chen, L., Keating, M. J., Gribben, J. G., Neuberg, D. S. et al., ZAP-70 compared with immunoglobulin heavychain gene mutation status as a predictor of disease progression in chronic lymphocytic leukemia. N. Engl. J. Med : Orchard, J. A., Ibbotson, R. E., Davis, Z., Wiestner, A., Rosenwald, A., Thomas, P. W., Hamblin, T. J. et al., ZAP-70 expression and prognosis in chronic lymphocytic leukaemia. Lancet : Chen, L., Apgar, J., Huynh, L., Dicker, F., Giago-McGahan, T., Rassenti, L., Weiss, A. and Kipps, T. J., ZAP-70 directly enhances IgM signaling in chronic lymphocytic leukemia. Blood : Chiorazzi, N. and Ferrarini, M., B cell chronic lymphocytic leukemia: lessons learned from studies of the B cell antigen receptor. Annu. Rev. Immunol : Stevenson, F. K. and Caligaris-Cappio, F., Chronic lymphocytic leukemia: revelations from the B-cell receptor. Blood : Chiorazzi, N., Rai, K. R. and Ferrarini, M., Chronic lymphocytic leukemia. N. Engl. J. Med : Admirand, J. H., Rassidakis, G. Z., Abruzzo, L. V., Valbuena, J. R., Jones, D. and Medeiros, L. J., Immunohistochemical detection of ZAP-70 in 341 cases of non-hodgkin and Hodgkin lymphoma. Mod. Pathol : Sup, S. J., Domiati-Saad, R., Kelley, T. W., Steinle, R., Zhao, X. and Hsi, E. D., ZAP-70 expression in B-cell hematologic malignancy is not limited to CLL/SLL. Am. J. Clin. Pathol : Damle, R. N., Ghiotto, F., Valetto, A., Albesiano, E., Fais, F., Yan, X. J., Sison, C. P.et al., B-cell chronic lymphocytic leukemia cells express a surface membrane phenotype of activated, antigen-experienced B lymphocytes. Blood : Carreras, J., Villamor, N., Colomo, L., Moreno, C., Ramon y Cajal, S., Crespo, M., Tort, F. et al., Immunohistochemical analysis of ZAP-70 expression in B-cell lymphoid neoplasms. J. Pathol : Pascual, V., Liu, Y. J., Magalski, A., de Bouteiller, O., Banchereau, J. and Capra, J. D., Analysis of somatic mutation in five B cell subsets of human tonsil. J. Exp. Med : Dono, M., Zupo, S., Leanza, N., Melioli, G., Fogli, M., Melagrana, A., Chiorazzi, N. and Ferrarini, M., Heterogeneity of tonsillar subepithelial B lymphocytes, the splenic marginal zone equivalents. J. Immunol :

12 Eur. J. Immunol : Cellular immune response Lebecque, S., de Bouteiller, O., Arpin, C., Banchereau, J. and Liu, Y. J., Germinal center founder cells display propensity for apoptosis before onset of somatic mutation. J. Exp. Med : Agematsu, K., Nagumo, H., Yang, F. C., Nakazawa, T., Fukushima, K., Ito, S., Sugita, K. et al., B cell subpopulations separated by CD27 and crucial collaboration of CD27 + B cells and helper T cells in immunoglobulin production. Eur. J. Immunol : Funaro, A., Ferrero, E., Mehta, K. and Malavasi, F., Schematic portrait of human CD38 and related molecules. Chem. Immunol : Kitanaka, A., Ito, C., Nishigaki, H. and Campana, D., CD38-mediated growth suppression of B-cell progenitors requires activation of phosphatidylinositol 3-kinase and involves its association with the protein product of the c-cbl proto-oncogene. Blood : Zupo, S., Rugari, E., Dono, M., Taborelli, G., Malavasi, F. and Ferrarini, M., CD38 signaling by agonistic monoclonal antibody prevents apoptosis of human germinal center B cells. Eur. J. Immunol : Zupo, S., Isnardi, L., Megna, M., Massara, R., Malavasi, F., Dono, M., Cosulich, E. and Ferrarini, M., CD38 expression distinguishes two groups of B-cell chronic lymphocytic leukemias with different responses to anti-igm antibodies and propensity to apoptosis. Blood : Nolz, J. C., Tschumper, R. C., Pittner, B. T., Darce, J. R., Kay, N. E. and Jelinek, D. F., ZAP-70 is expressed by a subset of normal human B- lymphocytes displaying an activated phenotype. Leukemia : Dono, M., Burgio, V. L., Tacchetti, C., Favre, A., Augliera, A., Zupo, S., Taborelli, G. et al., Subepithelial B cells in the human palatine tonsil. I. Morphologic, cytochemical and phenotypic characterization. Eur. J. Immunol : Messmer, B. T., Messmer, D., Allen, S. L., Kolitz, J. E., Kudalkar, P., Cesar, D., Murphy, E. J. et al., In vivo measurements document the dynamic cellular kinetics of chronic lymphocytic leukemia B cells. J. Clin. Invest :