Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution.

Transcription

1 Short questions 1 point per question. Q1 (1 point): Explain why a lettuce leaf wilts when it is placed in a concentrated salt solution. Q2 (1 point): Put a cross by the correct answer(s) below. The Na + /K + pump carries out: a. Primary active transport b. Secondary active transport c. Symport d. ATP hydrolysis Q3 (1 point): Name an enzyme that takes part in glycolysis, uses an induced-fit mechanism and carries out substrate-level phosphorylation. NB there is only one correct answer. 1

2 Q4 (1 point): The following enzyme-catalysed reaction has reached equilibrium: Glucose-6-phosphate Fructose -6-phosphate What can be done to obtain a greater amount of fructose-6-phosphate? Mark the correct answer(s) with a cross. a. Add more enzymes to the reaction b. Add ATP c. Remove fructose-6-phosphate from the reaction mixture d. Add more glucose-6-phosphate to the reaction mixture Q5 (1 point): Which coenzyme can take up electrons in redox reactions, contains an adenine base and is required in glycolysis? NB there is only one correct answer. Q6 (1 point): Which enzyme can make a DNA copy using an RNA template? Mark the correct answer(s) with a cross. a. RNAse b. DNA polymerase c. Reverse transcriptase d. DNA ligase Q7 (1 point): A cdna library cannot be used to isolate the promotor region of a gene. Why not? 2

3 Q8 (1 point): You have identified a gene that you wish to insert into a plasmid (shown below) and introduce into E. coli cells. Place the following steps in the correct order: a. E. coli cells are plated out on Tetracycline-containing medium. b. Treatment with DNA ligase. c. The desired gene sequence and the plasmid are each treated with PstI. d. E. coli cells are transformed with the DNA. e. The restriction fragments are mixed. f. E. coli cells are plated out on Ampicillin-containing medium. Q9 (1 point): Number the Carbon atoms in the ring form of ribose below. 3

4 Q10 (1 point): What is ribose called, when the OH group at position 2 is replaced with H? Q11 (1 point): What is the name of the discontinuous sequences of DNA that are initially synthesized at the lagging strand? Q12 (1 point): Which base can undergo deamination and thereby course mutations? Q13 (1 point): A linear DNA fragment is digested by a restriction enzyme that cuts at two different positions. How many bands will be observed after gel electrophoresis of the digested DNA? How many bands would you observe if a plasmid is cut two places? 4

5 Q14 (1 point): The following three pieces of sequences originate from the same DNA string and have been found by sequencing. What is the sequence of the full DNA fragment? 5 AGCGTTAG 3 5 CCGGTAAA 3 5 AGCCGGTA 3 Q15 (1 point): The figure below depicts a phase in a biological process that ultimately leads to cell division. What is the biological process called and which phase is depicted? 5

6 Q16 (1 point): In pea plants, the allele that encodes tall plants (H) dominates the allele that encodes short plants (h). How large a fraction of the progeny will be tall in a monohybrid cross between two plants that are both heterozygous with regards to height? (You may want to use a Punnett square to figure this out). Q17 (1 point): In pea plants, the allele that encodes spherical seeds (S) dominates the allele that encodes wrinkled seeds (s). You want to determine whether a pea plant with spherical seeds is homozygous or heterozygous by performing a test cross with a plant with wrinkled seeds. How large a fraction of the progeny do you expect to have spherical seeds and how large a fraction do you expect to have wrinkled seeds, if the plant in the P generation with the spherical seeds is homozygous, respectively heterozygous? (Note: Two answers are required one if the plant in the P generation with the spherical seeds is homozygous and one if it is heterozygous. You may want to use a Punnett square to figure this out). 6

7 Q18 (1 point): This exercise is regarding a dihybrid cross, in which we look at the allele for tall plants (H), which dominates the allele for short plants (h), and the allele for spherical seeds (S), which dominates the allele for wrinkled seeds (s). The genes for plant height and seed shape are not linked. Which of the below genotypes would you not expect to find in the progeny of a cross between plants with these two genotypes: HhSs x hhss. A. hhss B. HhSS C. Hhss D. hhss E. HhSs Q19 (1 point): This exercise is regarding red-green colour blindness in humans. A woman and a man, both with normal colour vision, have a son, who is red-green colour-blind. Did the son inherit the disease-causing allele from his mother or his father? Explain your reasoning. 7

8 Q20 (1 point): Below, a family tree is shown for a family in which a hereditary disease occurs. Squares represent men, while circles represent women. Black squares/circles represent people with the disease, while white squares/circles represents healthy individuals. Since we are dealing with a rare hereditary disease, it is safe to assume that individuals that are married into the family do not carry the disease-causing allele. The dashed line indicates that two cousins marry. Both of them are healthy. They now expect their first child. What is the probability that this child will inherit the disease? Explain your reasoning. Q21 (1 point): The TATA box is the area in promotors of eukaryotes, where the DNA string first starts denaturing so that the transcription machinery can get access. The TATA box mainly consists of A-T basepairs. Why is this an advantage, considering that the DNA string should denature? 8

9 Long questions from 4 to 9 points per question. Q22 (6 points): The sketch below shows a polypeptide chain: (i) Mark clearly on the sketch: A: A peptide bond B: The N-terminus of the polypeptide C: The C-terminus of the polypeptide D: A hydrophobic side chain (ii) Can this polypeptide chain form a disulphide bridge? Explain why/ why not? The exercise continues on the following page. 9

10 (iii) Write the amino acid sequence of the polypeptide in single-letter code (one letter per amino acid) (iv) Would this amino acid sequence be suitable as part of a membrane-spanning alpha helix? Explain why/ why not? (v) Write an mrna sequence that would be translated to the above amino acid sequence (write only the coding part of the mrna). NB there is more than one correct answer. 10

11 Q23 (4 points): The DNA fragment shown in Figure 1 is digested by the restriction enzyme EcoRI as indicated. The number in parenthesis shows the position of the cleavage site in basepairs (bp) from the start of the fragment. The total length of the DNA fragment is 4000 bp. Small parts of the DNA sequence is known as shown. Figure 1: DNA fragment with a total length of 4000 bp. (i) The figure below depicts a gel on which marker DNA of known size has been run. Sketch the location of the bands that will appear, if the DNA fragment shown in Figure 1 is digested by EcoRI and subsequently run on the gel next to the marker DNA. The exercise continues on the following page. 11

12 The gel is blotted onto a membrane and hybridized with the following radioactively labelled probe: 3 CCCTCCCGTAGAGCGCTTAAAGCATTTCGCG 5 After hybridization, the membrane is put on an x-ray film. (ii) Which band will be apparent on the resulting picture? Explain your reasoning. Q24 (9 points): The DNA string shown in Figure 2 originates from the Y chromosome. Note that it contains the sequence CCTT (or AAGG on the complementary string) repeated several times. Different individuals will have the sequence CCTT repeated a varying number of times (from 1 approximately 100 times), while all individuals will have the same flanking sequences (marked in bold). The sequence does not encode protein TTACGAGCTTTGGGCTATGCCTCAGTTTAAAATACATGCCTGCCTTCCTTCCTTCCTTCCTTCCTTCCTT 3 AATGCTCGAAACCCGATACGGAGTCAAATTTTATGTACGGACGGAAGGAAGGAAGGAAGGAAGGAAGGAA CCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGG 140 TTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTT AAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAA 210 CCTTGAAAGAGTCTCTCTGTTACCCAGGCCC 3 GGAACTTTCTCAGAGAGACAATGGGTCCGGG 5 Figure 2: DNA sequence from the Y chromosome. The exercise continues on the following page. 12

13 (i) Does the sequence shown in Figure 2 originate from a man or from a woman? Explain your reasoning. You want to amplify the sequence shown in Figure 2 using PCR. This will enable you to compare the size of the PCR product that is produced when using DNA from a crime scene, with the size of the PCR product that is produced when using DNA from suspects. (ii) Design two primers that can be used for amplifying the area with the repeated sequences of CCTT. The two primers should each consist of 20 nucleotides. Write the sequence of the two primers and remember to mark the 5 and 3 ends. Also mark where the two primers will bind on the sequence in Figure 2. 13

14 (iii) List two reasons why you should design your primers so that they only bind the flanking sequences and not the area with the repeated CCTT sequences. (iv) Besides DNA from a biological sample and primers, which ingredients are needed for PCR? (v) What is the size of the PCR product, if you use the primers that you designed in (ii) and the DNA sequence that is shown in Figure 2? The exercise continues on the following page. 14

15 A count has been murdered. DNA from a hair that was found on the crime scene has been purified (the count himself was bald, so it cannot be from him). Using this DNA and a set of primers binding the flanking regions of the DNA sequence shown in Figure 2, PCR is performed. DNA is also purified from the three suspects: The count s brother, the butler and the gardener. PCR is performed using this DNA and the same set of primers. The products of all four PCR reactions are run on a gel, as depicted in the figure below. Here, the content of the five lanes of the gel is listed: A: Marker DNA containing DNA fragments of known length. B: Product of PCR using DNA purified from the hair from the crime scene. C: Product of PCR using DNA purified from the count s brother. D: Product of PCR using DNA purified from the butler. E: Product of PCR using DNA purified from the gardener. (vi) Who is it most probable that the hair belongs to? Explain your reasoning. 15