Supporting Information. Application of spectral crosstalk correction for improving multiplexed

Transcription

1 Supporting Information Application of spectral crosstalk correction for improving multiplexed microrna detection using a single excitation wavelength Yuanjian Liu, Min Wei, Ying Li, Anran Liu, Wei Wei, *, Yuanjian Zhang, and Songqin Liu Jiangsu Engineering Laboratory of Smart Carbon-Rich Materials and Device, Laboratory of Environmental Medicine Engineering, Ministry of Education, School of Chemistry and Chemical Engineering, Southeast University, Nanjing, , China College of Food Science and Technology, Henan University of Technology, Zhengzhou, , China Phone: Fax: wei_wei98@163.com S1

2 Table of Contents Table S1. Sequences for oligonucleotides used for this work. Table S2. Abbreviations of different structures used for assembly. Table S3. Fluorophore photophysical and FRET properties. Table S4. Comparison of analytical performance of various methods. Figure S1. Chemical structures of TOTO-1, Cy3, Cy3.5 and Cy5. Figure S2. UV vis absorbance spectra of TOTO-1. Figure S3. Optimization of TOTO-1 concentration and incubation time. Figure S4. PL spectrums with different concentrations of targets mirna. References S2

3 Table S1. Sequences for oligonucleotides used for this work. Aauxiliary oligos Sequence (5'to3') L1 CATTAA L2 GCCAAA L3 GGTGAA FRET oligos Sequence (5'to3') P1 ACCCCTATCACGATTAG P1 ACCCCTATCACGATTAG-Cy3 P2 AGTGTGAGTTCTACCATT-Cy3.5 P3 GCTGGGTGGAGAAGGT-Cy5 Target oligos Sequence (5'to3') mirna-155 UUAAUGCUAAUCGUGAUAGGGGU mirna-182 UUUGGCAAUGGUAGAACUCACACU mirna-197 UUCACCACCUUCUCCACCCAGC Table S2. Abbreviations of different structures and oligonucleotides used for assembly. mirna structure model Oligonucleotides used for assembly Cy3-structure L1, P1, mirna-155 Cy3.5-structure L2, P2, mirna-182 Cy5-structure L3, P3, mirna-197 S3

4 Table S3. Fluorophore photophysical and FRET properties. R 0 in Å/J(λ) in cm 3 M -1* Fluorophores QY Ext. coeff. (M -1 cm -1 ) λ max λ max abs. (nm) em. (nm) Cy3 Cy3.5 Cy5 TOTO /3.61e /2.73e /1.36e -12 Cy Cy Cy abs., absorption; em., emission; Ext. coeff., extinction coefficients; QY, quantum yield. * Forster distance (R 0 ) and spectral overlap integral J(λ) are averages calculated from the spectra of all dye-labelled oligomers used. S4

5 Table S4. Comparison of analytical performance of various methods for determination of mirna. method system detection range detection limit reference fluorescence target-triggered recycling signal 10 pm to 10 nm 0.3 fm 1 amplification fluorescence hairpin probe-based rolling circle 0.2 fm to 1 nm 10 fm 2 amplification naked eye poly(vinylidene fluoride) thin paper 10 nm to 10 µm 3 DPV tungsten oxide-graphene composites 0.1 fm to 0.1 nm 0.05 fm 4 DPV methylene blue as redox indicator 0.1 pm to 0.5 nm 84.3 fm 5 microfluidic microfluidic bead-based enzymatic 0.01 pm to 10 nm 0.1 pm 6 amplification assay SPR bioluminescent enzyme Renilla luciferase 5 fm to 10 pm 1 fm 7 SERS absortion of microrna to silver or gold 1 fm 8 nanorods fluorescence application of spectral crosstalk correction 0.02 nm to 10 nm 18 pm this work S5

6 Figure S1. Chemical structures of TOTO-1, Cy3, Cy3.5 and Cy5. S6

7 Figure S2. UV vis absorbance spectra of TOTO-1 in the presence of duplex nucleic acid (curve a), and free TOTO-1 (curve b). 50 nm nucleic acids nanostructure was mixed with 0.5 µm TOTO-1 (i.e., one bisintercalator dye per 4 nucleic acids bps); spectra were acquired after 1 h incubation at room temperature. S7

8 Figure S3. (A) Change in the PL intensity with different concentrations of TOTO-1 in the presence of 10 nm duplex nucleic acid. (B) Dependence of PL intensity of 100 nm TOTO-1 in the presence of 10 nm duplex nucleic acid on incubation time. Error bars show the standard deviation of three experiments. S8

9 Figure S4. PL spectrums with different concentrations of targets mirna-155 (A), mirna-182 (B) and mirna-197 (C) at (a) 0, (b) 0.2, (c) 0.5, (d) 1, (e) 2, (f) 4, (g) 6, (h) 8, and (i) 10 nm, respectively. (D-F) Calibration curve corresponding to the increase in the FRET signal. PL intensities were obtained at 570 nm for Cy3 (D), 596 nm for Cy3.5 (E), and 670 nm for Cy5 (F), respectively. Error bars show the standard deviation of three experiments. Reference (1) Zhu, G. C.; Liang, L.; Zhang, C. Y. Anal. Chem. 2014, 86, (2) Li, Y.; Liang, L.; Zhang, C. Y. Anal. Chem. 2013, 85, (3) Yildiz, U. H.; Alagappan, P.; Liedberg, B. Anal. Chem. 2012, 85, (4) Shuai, H. L.; Huang, K. J.; Xing, L. L.; Chen, Y. X. Biosens. Bioelectron. 2016, 86, (5) Rafiee-Pour, H. A.; Behpour, M.; Keshavarz, M. Biosens. Bioelectron. 2016, 77, (6) H. Zhang, Y. Liu, X. Fu, L. Yuan, Z. Zhu. Microchim. Acta 2015, 182, (7) Cissell, K. A.; Rahimi, Y.; Shrestha, S.; Hunt, E. A.; Deo, S. K. Anal. Chem. 2008, 80, (8) Driskell, J. D.; Seto, A. G.; Jones, L. P.; Jokela, S.; Dluhy, R. A.; Zhao, Y. P.; Tripp, R. A. Biosens. Bioelectron. 2008, 24, S9