mirna Profiling: On the Road to Biomarker Development

Transcription

1 Isolation Quantification Functionalization mirna Profiling: On the Road to Biomarker Development Eric Lader, Ph.D. Senior Director, R&D - 1 -

2 Welcome to the three-part webinar series on The mirna Revolution Webinar 1 : Meeting the challenges of mirna research An introduction to mirna function & analysis Date: October 5 th, 2011 Speaker: Jonathan Shaffer, Ph.D. Webinar 2 : mirna Quantification From experimental design through data analysis Date: October 12 th, 2011 Speaker: Subu Yerramilli, Ph.D. Webinar 3 : Profiling mirna expression in Cells, FFPE, and Serum: on the road to biomarker development Date: October 19 th, 2011 Speaker: Eric Lader, Ph.D

3 RNA interference: A natural phenomenon Discovery tool, potential therapeutic May 26,

4 Canonical pathway of microrna biogenesis NUCLEUS microrna Gene POL II DNA Pri-miRNA Transcribed by RNA Polymerase II as a long primary transcript (pri-mirnas), which may contain more than one mirna. CYTOPLASM Drosha-DGCR8 Exportin Pre-miRNA In the nucleus, Pri-miRNAs are processed to hairpin-like pre-mirnas by RNAse IIIlike enzyme Drosha Exportin Pre-miRNAs are then exported to the Cytosol by Exportin 5 DICER-TRBP mature mirna In the cytosol RNAse III-like Dicer, processes these precursors to mature mirnas RISC Ago RISC Assembly These mirnas are incorporated in RISC High homology mrna cleavage Partial homology Translational Repression mrna degradation mirnas with imperfect base pairing to the target mrna, lead to translational repression and/or mrna degradation Krol, J et.al., (2010) Nature Rev Genetics, 11, 597; Winter, J. et.al., (2009) Nature Cell Biology, 11,

5 Potential events leading to disruption of normal mirna:target interaction in disease Altered Transcription Methylation Histone Modification Transcription Factors Drosha Processing microrna Gene Pri-miRNA Drosha-DGCR8 Exportin AAAA Pre-miRNA Genomic Instability Amplification/Deletion Translocation Insertional Mutagenesis Dicer Processing DICER-TRBP mature mirna mirnp Target Transcript Ago Loss of mirna Binding Site in Target SNP or Mutation Alternative Splicing Loss of 3 -UTR - 5 -

6 Unique mirna signatures are found in human cancers mirnas located in genomic regions amplified in cancers (e.g. mir cluster) can function as oncogenes, whereas mirnas located in portions of chromosomes deleted in cancers (e.g. mir- 15a-miR-16-1 cluster) can function as tumor suppressors. Abnormal expression of mirnas has been found in both solid and hematopoietic tumors. mirna expression fingerprints correlate with clinical and biological characteristics of tumors, including tissue type, differentiation, aggression and response to therapy. In the last 5 years, a substantial number of studies and reviews have associated the presence of various mirnas with cell proliferation, resistance to apoptosis, invasiveness, and differentiation in cancer cells. Array data from Calin and Croce Nature Reviews Cancer 6, (2006)

7 Therapeutics: mirna as drug, mirna as target of drug drug target - 7 -

8 Isolation Quantification Functionalization mirna Isolation Technologies - 8 -

9 mirneasy procedure Industry standard: total RNA or enrichment of mirna Options: Copurification of mirna & total RNA - or - mirna enriched fraction and total RNA > 200 nt Formats: Single Spin 96 - well Plate Manual Automated on QIAcube - 9 -

10 mirneasy FFPE Kit Purification of mirna from archival samples FFPE tissue sections Remove paraffin (Deparaffinization Solution) Lyse with proteinase K digestion followed by heat treatment. RNA. Over 500 Million FFPE samples archived! Tissue banks, pathology labs, biomed labs quality is Heavily fragmented Variable cross-linking by formaldehyde cross-linking interferes with RT Low RNA yields Optimized Optimized removal removal of of small small gdna gdnafragments by by DNase DNaseand and DNase DNaseBooster Buffer Buffer Total RNA Treat supernatant with DNase, then add buffer RBC and ethanol Bind total RNA (including mirna) to RNeasy MinElute column Wash Elute Eluted RNA

11 mirna in Blood RBC, WBC, platelets, CTC, other cells, extracellular? Whole blood contains RBC, WBC, platelets, other cells (e.g. circulating tumor cells) Serum (post clotting) Plasma (no-clotting) High levels of nucleases present in plasma: Freely circulating RNA should be rapidly degraded Surprisingly, stabile mirna can be detected in serum and plasma

12 Stable mirna in circulation Exosomes, microvesicles, complexed: An evolving story Ago mirna Exosomes & micro vesicles 1,2,3 Ago-2-miRNA complexes 4 HDL mediated mirna transport 5 Other protective protein 6 1) Valadi, H., et.al.,(2007) Exosome-mediated transfer of mrnas and micrornas is a novel mechanism of genetic exchange between cells, Nat Cell Biol 9: ) Hunter MP et. al., (2008) Detection of microrna Expression in Human Peripheral Blood Microvesicles, PLoS ONE 3:e3694 3) Kosaka, N et. al (2010) Secretory mechanisms and intercellular transfer of micrornas in living cells, J Biol Chem 285: ) Arroyo, JD et. al., (2011) Argonaute2 complexes carry a population of circulating micrornas independent of vesicles in human plasma, Proc. Natl. Acad. Sci 108: ) Vickers, KC., et. al., (2011) MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat Cell Biol 13:423 6) Wang K, Zhang S, Weber J, Baxter D, Galas DJ.(2010) Export of micrornas and microrna-protective protein by mammalian cells. Nucleic Acids Res Nov 1;38(20):

13 mirneasy Mini Kit Purification of total circulating mirna Clarified plasma or serum Plasma Serum QIAzol Bind Wash Elute Manual or Automated on QIAcube

14 Circulating mirnas Not only in plasma Weber et al., (2010) Clinical Chem. 56:

15 Isolation Quantification Functionalization mirna Expression Profiling

16 miscript II PCR System Dual buffer technology offers flexibility and specificity HiSpec Buffer miscript II RT Kit HiFlex Buffer Specific detection of mature mirnas Flexible detection of all RNA molecules - Mature mirnas - Precursor mirnas - mrnas - Other non coding RNAs Only mature mirna detection is desired Single assays mirna PCR arrays mirnome arrays (human, mouse, rat, dog) When mrnas/precursors/other long non coding RNAs quantified in parallel with mature mirnas New miscript PCR Controls for normalization work equally well in both buffer systems

17 miscript II System: miscript HiFlex Buffer mrna mirna, other small RNAs

18 miscript HiFlex Buffer: Simultaneous detection of precursor & mature mirna Parallel detection of mature mirna and precursor mirna. Total RNA was purified from HeLa S3 cells using the mirneasy Mini Kit. cdna was then prepared in a miscript II reverse transcription reaction using miscript HiFlex Buffer. In real-time PCR, miscript Primer Assays were used for mature mirna quantification, and miscript Precursor Assays were used for precursor mirna quantification. The miscript Primer Assay for RNU6-2 was used for normalization. CT (Relative to RNU6-2) Pre-miRNA mature mirna Real-time PCR was carried out on the Rotor- Gene Q cycler. 0 let-7a-1 let-7a-2 let-7a-3 mir-24-2 let-7b let-7f-1 mir-30c-2 mir-30a mir-20a mir-27a mir mir-221 mir-224 mir-181a-2 mir-18a mir

19 miscript II System: miscript HiSpec Buffer mrna mirna, other small RNAs

20 miscript HiFlex Buffer: Detection of micrornas & mrnas from the same cdna miscript HiFlex Buffer should be used to prepare cdna for the quantification of both mature micrornas & mrnas using appropriate primer assays. Long RNAs such as mrnas are not converted into cdna in miscript HiSpec Buffer Mean CT HiFlex buffer Mean CT GAPDH PPIA CDK1 MAPK1 Let-7a mir-16 mir-21 mir-25 GAPDH PPIA CDK1 MAPK1 Let-7a mir-16 mir-21 mir-25 HiSpec buffer

21 Specificity of miscript II PCR System: Let-7 family isoform discrimination mirna sequence Let-7b UGAGGUAGUAGGUUGUGUGGUU Let-7c UGAGGUAGUAGGUUGUAUGGUU mir-98 UGAGGUAGUAAGUUGUAUUGUU Let-7d AGAGGUAGUAGGUUGCAUAGUU Let-7e UGAGGUAGGAGGUUGUAUAGUU Let-7a UGAGGUAGUAGGUUGUAUAGUU Let-7f UGAGGUAGUAGAUUGUAUAGUU Let-7g UGAGGUAGUAGUUUGUACAGUU Let-7i UGAGGUAGUAGUUUGUGCUGUU ******* * *** *** cdna used in PCR cdna prepared using HiSpec Buffer: Relative detection (as % of perfect match) miscript Primer Assay Used Let-7b Let-7c mir-98 Let-7d Let-7e Let-7a Let-7f Let-7g Let-7i Let-7b Let-7c mir Let-7d Let-7e Let-7a Let-7f Let-7g 10 Let-7i

22 miscript PCR Controls for snorna/snrna Designed to work in either HiSpec or HiFlex Systems Official Symbol Alias Expected Product Size (bp) Human tissue panel: cdna prepared using HiSpec Buffer SNORD61 U61; RNU61; HBII-342 SNORD68 HBII SNORD72 HBII SNORD95 U95 81 SNORD96A U96A Mean CT SNORD61 SNORD68 SNORD72 SNORD95 SNORD96A RNU6-2 RNU6-2 U6; RNU6B 85 5 Brain Kidney Liver Lung Skeletal Muscle Testis Thymus Human tissue panel: cdna prepared using HiFlex Buffer Mean CT SNORD61 SNORD68 SNORD72 SNORD95 SNORD96A RNU6-2 5 Brain Kidney Liver Lung Skeletal Muscle Testis Thymus

23 Isolation Quantification Functionalization.miRNA Profiling with.the miscript PCR System

24 miscript mirna PCR Arrays Most up to date mirnomes, most focused content. Complete mirna genome (mirnome) miscript mirna Pathway Arrays Species Human miscript mirna PCR Array Mouse miscript mirna PCR Array Rat miscript mirna PCR Array Dog miscript mirna PCR Array Number of assays (mirbase V16) Total Number of Plates 96 well format 384 well format Human Human, Mouse, Rat: Brain Cancer Cancer Ovarian Cancer Cell Differentiation & Development Immunopathology Inflammation mifinder Neurological Development & Disease Serum & Plasma Mouse Rat Dog

25 miscript mirna PCR Arrays Genome-wide, disease, & pathway-focused analysis Add cdna to Quantitect Sybr Master Mix and aliquot mixture across PCR array

26 miscript mirna Array format: Standardized controls (96 well plate) Cel-miR-39 SNORD61; SNORD68; SNORD72 SNORD95; SNORD96A; RNU6B mirtc PPC Spike in Control miscript Controls for Normalization RT Control PCR Control miscript controls: Common for Human, Mouse, Rat and Dog miscript mirna PCR Arrays

27 Compatible instrumentation: 96- & 384-well formats.96-well Blocks: 7000, 7300, 7500, 7700, 7900HT, ViiA 7.FAST 96-Well Blocks: 7500, 7900HT, Step One Plus, ViiA 7.FAST 384-Well Block: 7900HT, ViiA 7.iCycler, MyiQ, MyiQ2, iq5, CFX96, CFX384.Opticon, Opticon 2, Chromo 4.Mastercycler ep realplex 2/2S/4/4S.LightCycler 480.Mx3000p, Mx3005p, Mx4000p.TP-800.RotorGene Q PCR Array Service Core

28 Performance: reproducibility Technical Replicates, mifinder Array High technical reproducibility from a first time mirna PCR array user. Mean CT:Technical Replicate y = x R 2 = Mean C T : Technical Replicate 1 Total RNA was purified in parallel from two HeLa S3 cell pellets (identical passage numbers) using the mirneasy Mini Kit. cdna was then prepared from each HeLa S3 total RNA preparation in a miscript II reverse transcription reaction using miscript HiSpec Buffer. The cdna was then used as a template in realtime PCR using the mifinder miscript mirna PCR Array and miscript SYBR Green PCR Kit. This data demonstrates the highly technical reproducibility that is achievable when using the miscript mirna PCR Arrays, even for a first time user

29 Performance: reproducibility Biological Replicates, mifinder Array High biological reproducibility for a first time mirna PCR array user. Mean CT: Biological Replicate y = x R 2 = Mean C T : Biological Replicate 1 Total RNA was purified from two HeLa S3 cell pellets (collected from different parental stocks at different times) using the mirneasy Mini Kit. cdna was then prepared from each HeLa S3 total RNA preparation in a miscript II reverse transcription reaction using miscript HiSpec Buffer. The cdna was then used as a template in realtime PCR using the mifinder miscript mirna PCR Array and miscript SYBR Green PCR Kit. This data demonstrates the high biological reproducibility that is achievable when using the miscript mirna PCR Arrays, even for a first time user

30 Performance: reproducibility Operator 1 vs. Operator 2, mifinder Array High operator to operator reproducibility Total RNA was purified from HeLa S3 cell pellets using the mirneasy Mini Kit. 30 Two operators independently prepared cdna from the HeLa S3 total RNA in a miscript II reverse transcription reaction using miscript HiSpec Buffer. CT: Operator y = x R 2 = The operators then used the cdna as a template in real-time PCR using the mifinder miscript mirna PCR Array and miscript SYBR Green PCR Kit. Real-time PCR was performed using the Rotor- Gene Q and 100 well Rotor-Discs This data demonstrates the high operator to operator reproducibility that is achievable when using the miscript mirna PCR Arrays C T : Operator

31 Replicates: Technical versus biological summary Technical Replicates Reproducibility of the miscript mirna PCR Arrays is very high Results demonstrate that what you are seeing is a result of biology, not technique RTC & PPC show technical reproducibility, and can be compared across plates Biological Replicates Needed to verify the results are a result of biology Three biological replicates needed for statistical analysis p values and 95% Confidence Intervals

32 Isolation Quantification Functionalization mirna Profiling

33 mirnome profiling in cultured cells PC3 cells transduced with p53 vs. empty control vector Ct Adeno-p mir-34a mir a mir-203 mir-551a Ct Control Human mirnome miscript mirna PCR Array: Identifies Known and Novel mirna Targets of the p53 Signaling Pathway

34 mirnome profiling of fresh tissue samples Adenocarcinoma vs. adjacent normal tissue Profiling of mirna expression using the whole-mirnome mirna array. 451 mirnas exhibited detectable expression in at least one of the tissue types. At ± 4-fold cutoff for strong expression regulation, 56 mirnas were strongly down-regulated in the adenocarcinoma tissue, while 50 were strongly up-regulated in adenocarcinoma tissue (red fold-regulation threshold lines). The online mirna PCR Array data analysis tool automatically performs all Ct based fold-change calculations from raw threshold cycle data and provides various statistical outputs, such as fold-regulation Log2 (Fold-Regulation) Down-regulated Up-regulated

35 mirnome profiling of HCT 116 colorectal cancer cells: ± 5-aza-2 -deoxycytidine treatment 5-aza-2 -dc irreversibly inhibits DNA methyltransferase driven methylation reactions by incorporating into DNA and covalently binding to the active site of the DNMT. 1.E CT : 5-aza-2'-dC Treated HCT 116 cells 1.E+01 1.E+00 1.E-01 1.E-02 1.E-03 1.E-04 1.E-05 1.E-05 1.E-04 1.E-03 1.E-02 1.E-01 1.E+00 1.E+01 1.E+02 Log2 (Fold-Regulation) p Value Log2 (Fold-Regulation) 2 - CT : Untreated HCT 116 cells A scatter plot of 2 - CT values demonstrates that significant differences exist in the mature mirna expression levels of the two samples that were tested. Of the mature mirnas that exhibited detectable expression in at least the untreated or treated cells (415 mature mirnas), 104 mirnas were strongly up-regulated in 5-aza-2 -dc treated cells, while only 30 were strongly down-regulated in 5-aza-2 -dc treated HCT 116 cells. When a p Value of 0.05 is applied, the expression up-regulation of 89 of the 104 mirnas is significant, and the expression down-regulation of 21 of the 30 mirnas is significant. The online miscript mirna PCR Array data analysis tool automatically performs all CT based fold-change calculations from uploaded raw threshold cycle data and provides various statistical outputs such as a scatter plots, fold-regulation values, and volcano plots

36 mirna profiling of FFPE samples on mifinder Array lung tissue: normal vs. tumor Total RNA was isolated from 5 µm normal and tumor lung FFPE tissue sections using the mirneasy FFPE Kit. The mifinder miscript mirna PCR Array was used to profile of mature mirna expression. Data analysis was performed using the online miscript mirna PCR Array data analysis tool. CT Value FFPE Isolation 1 FFPE Isolation 2 FFPE Isolation mirna 2 - CT : Tumor Lung FFPE Tissue 1.E+04 1.E+03 1.E+02 1.E+01 1.E+00 1.E-01 1.E-02 1.E-03 1.E-04 1.E-04 1.E+03 1.E+02 1.E+01 1.E+00 1.E-01 1.E-02 1.E CT : Normal Lung FFPE Tissue 1.E+04 The raw data in Panel A (C T Values: FFPE Isolations 1, 2, and 3) demonstrates the high reproducibility that can be achieved using the mirneasy FFPE Kit. Each isolation was from a different tumor lung FFPE tissue section from the same donor. When normal and tumor tissue samples are compared, a scatter plot of 2 - CT values demonstrates that significant differences exist between the mature mirna expression levels of the two tissue types (Panel B, ± 3-fold [red lines] used as a cutoff for significance). The online miscript mirna PCR Array data analysis tool automatically performs all C T based fold-change calculations from uploaded raw threshold cycle data and provides various statistical outputs such as a scatter plots, fold-regulation values, and volcano plots

37 mirna profiling of circulating mirna from blood.human Serum & Plasma miscript mirna PCR Array.Profile the expression of mature mirna that researchers have reported as elevated in serum and other bodily fluids in disease Heart and liver injury or disease, atherosclerosis, diabetes, and a number of organ-specific cancers What is on the array? 85 mirna assays (aberrant levels in serum in cancer, other disease) housekeeping gene assays Reverse Transcription Control assays PCR Control assays RNA Recovery Control assays - Syn-cel-miR-39 mirna Mimic ~ 20 µl serum per cdna synthesis (per 384 array)

38 Workflow for circulating mirna profiling Spike C elegans mirna control into lysate

39 Profiling of circulating mirna Stability of endogenous mirna in human serum and plasma at 25 o C 35 R 2 = Serum hours 25 o C R 2 = Plasma Circulating mirna is not naked, as unprotected mirna would have a half-life of only minutes 24 hours at ambient temperature has little effect on the mirna profile from serum or plasma hours 25 o C

40 Profiling of circulating mirna Freeze/thaw stability of mirna in human serum and plasma 35 R 2 = Serum Circulating mirna is unaffected by up to 20 freeze-thaw cycles 20 F/T cycles R 2 = Plasma Storing multiple archival aliquots is suggested for precious samples to avoid mishaps Whole blood should NOT be subject to freeze-thaw to avoid cell lysis freeze-thaw cycle

41 Profiling of circulating mirna Subtle differences between serum and plasma (same donor) R 2 = serum plasma Triplicate isolations from the same plasma or serum sample (not triplicate collections of fluid) Most assays do not vary by more than one Ct Either serum or plasma is suitable for profiling but plasma may be more consistent as the additional variability of clotting is not required Our recommendation is to compare serum to serum, plasma to plasma

42 Variability in mirna in Serum array Among 10 normal volunteers Less than 2-fold variability hsa-mir-30e hsa-mir-17 hsa-mir-19b hsa-mir-150 hsa-mir-106a hsa-mir-423-5p hsa-mir-93 hsa-mir-92a hsa-let-7c

43 Profiling of serum mirna expression using the Serum & Plasma miscript mirna PCR Array Total RNA was isolated from normal (n=10) and breast cancer (n=3) serum using the mirneasy Supplementary Protocol. In real-time PCR, the Serum mirna PCR Array was used to profile a panel of mirna. The data in Panel A (C T Values: Serum Isolations 1, 2, & 3) demonstrates the high reproducibility that can be achieved using the mirneasy Supplementary Protocol for serum or plasma samples. Each isolation was from a different normal serum donor. A scatter plot of 2 - CT values demonstrates several significant differences exist between the mature mirna expression levels of normal and breast cancer serum pools, including hsa-mir-34a, which has been shown to be a blood-based marker for patients with primary and metastatic breast cancer. Data was normalized against cel-mir-39 assay, which detects Syncel-miR-39 miscript mirna spike-in. Data analysis was performed using the online Qiagen PCR Array data analysis tool, which automatically performs all C T based fold-change calculations from uploaded raw threshold cycle data and provides various statistical outputs. A B 38 3 normal serum samples 1.E+01 CT Value Serum Isolation 1 Serum Isolation 2 Serum Isolation mirna 2 - CT : Breast Cancer Serum 1.E+00 1.E-01 1.E-02 mir-34a 1.E-03 1.E-04 1.E-05 1.E-05 1.E-04 1.E-03 1.E-02 1.E CT : Normal Serum 1.E+00 1.E+01 Reference: Roth, C., B. Rack, et al. (2010). Breast Cancer Res 12(6): R

44 Isolation Quantification Functionalization Circulating mirna profiling and data normalization

45 Circulating mirna and data normalization.step 1: Check reverse transcription control (mirtc) and PCR control (PPC) Ct values Position Control Ct: Sample A Ct: Sample B H09 mirtc H10 mirtc H11 PPC H12 PPC As determined by the raw Ct values, the reverse transcription and PCR efficiency of both samples are highly comparable Ct values differ by less than 0.25 units

46 Circulating mirna data normalization (cont.).step 2: Observe housekeeping gene Ct values Position Gene Ct: Sample A Ct: Sample B H05 SNORD H06 SNORD H07 SNORD H08 RNU Housekeeping genes are either not expressed or exhibit borderline detectable expression As is often found with serum samples, standard housekeeping genes cannot be used for data normalization How should you proceed?

47 Circulating mirna data normalization (cont.) Step 3: Potential data normalization options Normalize data of each plate to its RNA Recovery Controls Can only be used if Syn-cel-miR-39 miscript mirna Mimic (MSY ) is spiked into the time of preparation (only controls for variability in recovery) Normalize data to Ct mean of all expressed targets (targets with Ct < 35) for a given plate Normalize data to Ct mean of targets that are commonly expressed in the samples of interest (Ct<35) (better, works well as long as >half the targets are detectable) -OR- -OR- Normalize data to average Ct of several invariant mirnas (e.g. can use normfinder or similar to pick least variant mirna assays)

48

49 Try free miscript PCR Array Starter Pack Experience PCR Array Performance Try them today! miscriptmirnapcr Array Starter Pack Promo Code: MS 11 FREE PCR Arrays of any Pathway 296-well/100-well (2 samples) OR 1384-well (4 samples) With Purchase of: miscript II Reverse Transcription Kit miscript SYBR Green PCR Mastermix(2-Pack) To try the free Starter Pack, click the link below Receive your Free ipod Shuffle by Sharing your data with us Contact: to claim your gift Thousands of scientists have discovered the power of PCR Arrays. Join them on the road to success!

50 QUESTIONS? Conclusion of the 3 part mirna webinar series on The mirna Revolution Webinar 1 : Webinar 2 : Webinar 3 : Meeting the challenges of mirna research An introduction to mirna function & analysis mirna Quantification From Experimental Design Through Data Analysis mirna Profiling On the Road to Biomarker Development Copy of slides and webinar recordings will be available on Thank you! Eric Lader eric.lader@qiagen.com For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at or can be requested from QIAGEN Technical Services or your local distributor