Nanopore sequencing How it works

Transcription

1 Product 1

2 Nanopore sequencing How it works The nanopore processes the length of DNA or RNA presented to it. The user can control fragment length through the library preparation protocol utilised. (e.g. >2 Mb DNA has been recorded 1.) An enzyme motor controls the translocation of the DNA or RNA strand through the nanopore. Once the DNA or RNA has passed through, the motor protein detaches and the nanopore is ready to accept the next fragment. Nanopore reader DNA or RNA fragments pass through a nanoscale hole. The fluctuations in current during translocation are used to determine the DNA or RNA sequence. An electrically resistant membrane means all current must pass through the nanopore, ensuring a clean signal. The nanopore signal, captured by the ASIC in the device, is characteristic of the sequence of the DNA or RNA fragment. Algorithms are used to convert the signal into basecalled sequence data. 2

3 Sequencing with 1D and 1D 2 reads Translocation 1D The template and the complement strands are sequenced as individual strands. 1D analysis delivers high data yields from a wide variety of sample types. Library prep Whether using 1D or 1D 2, library preparation results in the addition of a sequencing adapter at each end of the fragment. Both the template and complement strands carry the motor protein which means both strands are able to translocate the nanopore. Template......Template... (Exit) Next molecule Y-adapter Y-adapter Translocation 1D 2 1D 2 library preparation deploys special adapters that increase the probability that the complement strand will immediately follow the template strand. This method of sequencing when used with 1D 2 analysis produces a higher accuracy read. Library DNA Template......Template... (Exit)...Complement 3

4 DNA library preparation For maximum throughput For minimal preparation time Ligation Sequencing Kit Rapid Sequencing Kit with transposase High molecular weight gdna Transposome complex gdna Optional fragmentation or size selection 5 min 60 min End-prep and nick repair p A Ligation of sequencing adapters A p T Cleavage and addition of transposase adapters Attachment of sequencing adapters 5 min Loading Loading DNA ends are repaired and da-tailed Sequencing adapters are ligated onto the prepared ends Fragment lengths can be controlled by fragmentation or size selection The transposase simultaneously cleaves template molecules and attaches tags to the cleaved ends Rapid sequencing adapters are added to the tagged ends Fragment lengths are a result of the random cleavage 4

5 Which DNA kit? These library preparation kits are all PCR-free, allowing sequencing without PCR bias Ligation 1D (SQK-LSK109) Rapid (SQK-RAD004) Ligation 1D 2 (SQK-LSK309) Use for Highest throughput Rapid and simple prep Highest raw read accuracy Prep time 60 mins 10 mins 80 mins Input amount 1,000 ng dsdna 400 ng HMW gdna (>30 kb) 1,000 ng dsdna Fragmentation Optional Transposase based Optional Read length Equal to fragment length Random distribution, dependent on input fragment length Equal to fragment length Also available: Optimised PCR-based kits for low input amounts Application-specific library preparation kits (e.g. 16S sequencing) Barcoding kits for cost-effective analysis of multiple samples View all kits and full specifications at store.nanoporetech.com 5

6 RNA library preparation For sequencing the RNA molecule directly For full-length transcript analysis with high throughput Direct RNA Sequencing Kit cdna-pcr Sequencing Kit Full-length poly-a + RNA AAAAAAAAAAAAAAAAA Full-length poly-a + RNA AAAAAAAAAAAAAAAAA 10 min 70 min Splint ligation Reverse transcription TTTTTT AAAAAAAAAAAAAAAAAA TTTTTTTTTT 105 min Primer annealing Reverse transcription Strand Switching TTTTTT AAAAAAAAAA AAAAAAA TTTTTTTTTT CCC AAAAAAAAAA AAAAAAA TTTTTTTTTT AAAAAAAAAAAAAAAAAA TTTTTTTTTTTTTTTTTT GGG CCC AAAAAAAAAA AAAAAAA TTTTTTTTTT Cleanup and adapter attachment 55 min PCR F R 25 min GGG CCC AAAAAAAAAA TTTTTTTTTT AAAAAAAAAAAAAAAAAA TTTTTTTTTTTTTTTTTT Adapter attachment 5 min GGG CCC AAAAAAAAAA TTTTTTTTTT Loading Loading Optional reverse transcription step improves throughput cdna strand is not sequenced Sequencing adapters attached to prepared ends Read length reflects length of molecules in sample cdna is synthesised using reverse transcription and strand-switching method, and then is amplified with PCR Strand-switching before PCR enriches for full-length transcripts Sequencing adapters are attached to the amplified cdna 6

7 Which RNA kit? Direct RNA (SQK-RNA002) cdna-pcr (SQK-PCS109) Direct cdna (SQK-DCS109) Use for RNA molecules directly and preserve base modifications Full-length transcripts with high throughput Full-length transcripts without PCR bias Prep time 105 mins 165 mins 275 mins Input recommendation 500 ng RNA (poly A+) 1 ng RNA (poly A+) 100 ng RNA (poly A+) Read length Equal to RNA length Enriched for full-length cdna Enriched for full-length cdna PCR required No Yes No Reverse transcription Optional Yes Yes Barcoding options for the cdna kits are available, and are in development for the Direct RNA Sequencing Kit. For full specifications visit store.nanoporetech.com 7

8 Maximising flow cell usage Barcoding Barcoding kits allow users to multiplex samples to generate maximum data from a single flow cell, to separate the reads from sequential library loadings and to lower the cost per sample. Native Barcoding Kit for a PCR-free approach PCR Barcoding Kits for up to 96 samples Barcode libraries of gdna, amplicon or cdna either with a dedicated barcoding kit or a barcoding expansion pack Washing The wash kit allows re-use of flow cells after short sequencing runs, meaning multiple libraries can be run sequentially. Barcode multiple samples Pool and sequence Separate and analyse Visit store.nanoporetech.com for more details 8

9 VolTRAX TM Automated library preparation solution for nanopore sequencing Consumable cartridge converting any biological samples to a form ready for application to a nanopore sensing device. Automation of library preparation methods integrating capabilities such as PCR. Fluorescence detector for DNA and RNA QC. Only minutes of hands-on time, even for novel/complex experiments. USB powered and portable, liquids are moved around the cartridge in a path programmed by software, performing individual reactions in sequence. Weight 301 g including cartridge Size (Device & cartridge): L 134 mm, W 58 mm, H 64 mm VolTRAX Starter Pack $8,000 (includes VolTRAX device, Configuration Kit, 4x Cartridge Packs, 4x Sequencing Kits and 6x MinION Flow Cells). Buy now at store.nanoporetech.com/devices 9

10 Researchers no longer have to send out their samples to core labs or service providers, they can do it now at their own bench, and within a week have an answer to their question they should do it. Professor Todd Michael J. Craig Venter Institute 10

11 MinION TM Portable DNA/RNA sequencing for anyone 11

12 MinION Portable DNA/RNA sequencing for anyone Sample added to flow cell here. Consumable flow cell where the biology and electronics come together for nanopore sequencing. USB powered device; link to laptop, computer or MinIT to operate. Bespoke sensor array with multiple nanopores for scaled-up sequencing. Flow cell with 512 active channels. Sensor chip works with custom ASIC for control and data acquisition. Weight 87 g (103 g with a flow cell) Size W 105 mm, H 23 mm, D 33 mm Compatible with MinIT TM preconfigured IT solution. Compatible with Flongle TM for smaller, rapid tests. 12

13 Which MinION Starter Pack? Recommended Basic Enhanced Project MinION Flow cells included Sequencing kits Wash kits Community Support Included Included Included Training / Services included Optional 1-day workshop 1-day consultancy $1,000 $4,500 $12,700 * A wide range of training and support services are available to help make the most of your nanopore sequencing experiments. Visit store.nanoporetech.com/services for full explanation of the options. Add MinIT if you would like a simple, preconfigured IT solution for MinION sequencing. Buy now at store.nanoporetech.com 13

14 Flongle Adapting MinION for smaller rapid tests and analyses Sample added to flow cell here. Consumable flow cell with 126 channels. Same MinION device. Reusable adapter that allows docking of smaller flow cell. Weight 20 g Size W 105 mm, H 23 mm, D 8 mm Flongle Trial Pack $5,000 (includes 1x adapter and 48x flow cells). Further pack sizes available, see store. Compatible with GridION X5, MinION and MinIT. Visit nanoporetech.com/products/flongle for more details 14

15 MinIT Simple, preconfigured IT solution for MinION and Flongle sequencing Multiple ports; including USB 3.0, USB 2.0 and ethernet. Ability to perform basecalling; fastq files are written to an onboard SSD, data can then be transferred to your own system. Pre-installed software; including Linux OS and MinKNOW TM (control software for nanopore sequencing). Small footprint; under 500 g and designed to replace your current laptop. Bluetooth and Wi-Fi enabled; control your experiments using a laptop, tablet or smartphone. Weight 290 g Size W 119 mm, H 68 mm, D 45 mm Individual MinIT $2,400, or available as part of MinION starter pack. Compatible with MinION and Flongle. Buy now at store.nanoporetech.com/devices 15

16 GridION X5 High-throughput, benchtop system with integrated compute module Consumable flow cell where the biology and electronics come together for nanopore sequencing. Sample added to flow cell here. Up to 2,560 active channels can be sequencing at one time on the GridION TM X5. 5 individual flow cells can be operated individually or together, suitable for fee-for-service operations. Onboard data analysis offering real-time local analysis, generating as much as 150 Gb data. Weight 11 kg Size W 370 mm, H 220 mm, D 365 mm Compatible with Flongle. For full specifications visit store.nanoporetech.com 16

17 Which GridION X5 plan? Starter Pack CapEx GridION X5 device 1 1* Flow cells included 60** 60** Sequencing kits included Wash kits included 5 5 Software licence and device warranty*** Covers use of Starter Pack 3 years included Delivery of device and consumables Included Included Remote Installation Assurance Included Included $49,955 $95,455 * Device purchase. ** To be shipped within 4 months of device delivery according to user s schedule. *** Subsequent charge is $12,500 per annum. Oxford NANOPORE Service Certified Service provider certification is available for the GridION X5. Additional starter pack options and a wide range of training services are available online. Buy now at store.nanoporetech.com 17

18 The PromethION is a real game changer, combining ultra-long reads with high sequence output for the production of contiguous, high-quality reference genomes. Using this platform, we sequenced the 2.56 Gb lettuce genome at >100X coverage using just a few flow cells. Alexander Wittenberg KeyGene, PromethION service provider 18

19 PromethION TM High-throughput, high-sample number benchtop system 19

20 PromethION High-throughput, high-sample number benchtop system Sample added to flow cell here. Compatible with multichannel pipette. Each flow cell comprises up to 3,000 active channels and has four sample inputs. Inside the PromethION 48 individual flow cells can be operated individually or together. Up to 144,000 active channels can be sequencing at one time on the PromethION. Sequencing module Compute module Weight Main unit: 40 kg Compute module: 22 kg Size Main unit: W 437 mm, H 258 mm, D 410 mm Compute module: W 178 mm, H 462 mm, D 673 mm 20

21 Which PromethION plan? Starter Pack CapEx PromethION sequencing device and compute 1 1* Flow cells included 60** 60** Sequencing kits included Software licence and device warranty*** Covers use of Starter Pack 3 years included Delivery of device and consumables Included Included On-site Assurance and Familiarisation Included Included $165,000 $297,000 * Device purchase. ** To be shipped within 4 months of device delivery according to user s schedule. *** Subsequent charge is $20,000 per annum. Oxford NANOPORE Service Certified Service provider certification is also available for the PromethION. Cost-effective annual flow cell packs and smaller top-up packs are available to suit your project needs with flow cells from $2,000 - $625. Buy now at store.nanoporetech.com 21

22 Data analysis and basecalling As a DNA or RNA strand passes through the nanopore, the current is measured several thousand times per second. These current samples are known as raw data. The raw data: is processed using machine-learning techniques into basecalled data the sequence of DNA or RNA bases captures biological features such as base modifications. It is down to the algorithm to correctly interpret that information can be accessed for the development of new analysis tools Tools such as new basecallers can be accessed through a developer licence available to nanopore technology users. For more information visit nanoporetech.com/analyse Data structure Raw data Raw data straight off ASIC CCGACTCCGGTTACCCGCGTTGATTTGCTGGGGCAGGGCCG Basecalled 22

23 Data analysis and basecalling Control of the sequencing device and primary data analysis are performed by MinKNOW. The same software is used across all devices. The channel panel and duty time plots give you real-time insight into the progress and performance of your sequencing run, visualising the number of pores that are sequencing. This allows you to quality check your run, and if there s a problem with the library: stop sequencing, wash the flow cell, and start again. MinKNOW can output basecalled reads in.fastq or.fast5 formats live, or the data can be basecalled after the run with a range of algorithms. These include basecallers trained to identify modifications, or community-developed tools. 23

24 Onward analysis options After the output of data from MinKNOW, there are several possible avenues for downstream data analysis, dependent on the level of bioinformatic capability available. The cloud-based EPI2ME platform provides easy access to real-time data analysis workflows. An intuitive graphical interface provides easy interpretation of individual or multiple barcoded samples. Full QC metrics give feedback on run performance and include number of reads, read length distribution and quality scores. EPI2ME TM Protocol builder Communitydeveloped tools Custom analysis pipelines Bioinformatic capability needed How Use the cloud-based EPI2ME platform for real-time analysis workflows. Follow analysis recommendations provided by Oxford Nanopore Technologies in the protocol builder. Run open-source tools written and developed by the Nanopore Community. All the data, raw or basecalled, can be used in custom analysis pipelines written by the user for specific applications. Where epi2me.nanoporetech. com/workflow community. nanoporetech.com community. nanoporetech.com User defined 24

25 Onward analysis with EPI2ME Why EPI2ME for data analysis? Scalable analysis of your data Reproducible analysis, uses docker images No need to install anything aside from EPI2ME agent locally Real-time monitoring of your experiments Simple workflow configuration Clear figures: shareable, interactive, printable EPI2ME workflows can classify and identify species in real time, displaying their taxonomy in clear, interactive figures. The What s In My Pot (WIMP) workflow harnesses the benefits of long reads and real-time data streaming to supply rapid identification and quantification of bacteria, fungi, archaea and viruses from mixed metagenomics samples. The 16S workflow is compatible with the 16S Barcoding Kit and unravels heavily complex metagenomics samples, resolving to genus level. You can multiplex for a lower cost per sample. The ARMA workflow uses the highly-curated Comprehensive Antibiotic Resistance Database (CARD) to identify antibiotic resistance markers and to provide information about the drugs they confer resistance to. Human genome and exome alignments are available against the GRCh38 reference, generating real-time coverage plots at either chromosomal or gene level. 25

26 In development SmidgION TM Towards the analysis of any living thing, by any person, in any environment The smallest sequencing device so far. Same nanopore sensing technology. Designed for use with a smartphone in any location. Visit nanoporetech.com/products/smidgion for more details 26

27 In development 27

28 In development Oxford Nanopore Technologies phone +44 (0) Oxford Nanopore Technologies, the Wheel icon, EPI2ME, Flongle, GridION, Metrichor, MinION, MinIT, MinKNOW, PromethION, SmidgION and VolTRAX are registered trademarks of Oxford Nanopore Technologies in various countries. All other brands and names are the property of their respective owners Oxford Nanopore Technologies. All rights reserved. Flongle, GridION, MinION, PromethION and VolTRAX are currently for research use only. 28