Supporting Information

Transcription

1 (xe number cells) LSK (% gated) Supporting Information Youm et al../pnas. SI Materials and Methods Quantification of sjtrecs. CD + T subsets were isolated from splenocytes using mouse CD + T cells positive section kit (Invitrogen). The sorted cells were lysed in mg/l proteinase K (Sigma) for h at C followed by min at 9 C. The amount of TRECs in cells was determined by real-time quantitative PCR using the ABI PRISM 9 Sequence Detector TaqMan system as described previously (, ) (Applied Biosystems). The PCR was performed with mδrec and ψjα specific primers and mδrec-ψjα fluorescent probe as described previously (). The standard curves for murine TRECs were generated by using δrec ψjα TREC PCR product cloned into a pcr-xl-topo plasmid that was generously provided by Gregory Sempowski, Duke University School of Medicine, Durham, NC. Vβ TCR Spectratyping Analysis. The analysis of hypervariable CDR of β chain offers a practical approach for the global qualitative assessment of diversity of TCR repertoire. For TCR spectratyping and CDR length analysis PCR, a FAM-labeled nested constant β-region primer is used in combination with multiplexed forward murine Vβ-specific primers. PCR was performed for cycles with denaturation at 9 C for s, annealing for C for s, and min extension at C and the PCR products were analyzed on an ABI genetic analyzer as described previously (, ). Each Vβ Jβ rearrangement is visualized by six to eight peaks and each peak represents one or a set of T-cell clones bearing the same CDR length. Each peak was analyzed and quantified with ABI PRISM GeneScan analysis software (Applied Biosystems), based on size and density. Data were used to calculate the area under the curve for each Vβ family. Each peak, representing a distinct CDR of a certain length, was quantified with statistical software (BioMed Immunotech). Statistical Analyses. A two-tailed Student s t test was used to test for differences between genotypes or treatments (P <. and P <.). The results are expressed as the mean ± SEM. The differences between means and the effects of treatments were determined by one-way ANOVA using Tukey s test (Sigma Stat), which protects the significance (P <.) of all pair combinations. Thymocyte A C FgfTg CD B.% FgfTg. FgfTg.%.%.%.%.%.%.% CD D CD CD.%.%.. c-kit c-kit.... FgfTg Sca- Sca- Fig. S. Impact of FGF overexpression on primary lymphoid organs. (A) Total thymocyte number from -mo-old and Fgftg mice (n = ). (B) The representative FACS dot plots of thymocytes stained with CD and CD in -mo-old and Fgftg mice. (C and D) The bone marrow cells were stained with Sca and c-kit and gated on lineage markers to identify hematopoietic stem cells (HSC) that are LSK. Compared with -mo-old mice, the frequency of LSKs is significantly reduced in Fgftg mice (n = ). Youm et al. of

2 Fold Change Body Weight (g) A FgfTg C D Male Female days mo mo..... Macrophages with Crytals FgfTg E C CMJ CMJ M C M B F Fold Change mtec P =.9 ctec % gated (CD - MHCII + Ly + FgfTg G Aire FgfTg Betat FgfTg DLL RANK Fold Change FgfTg FgfTg Fig. S. Impact of FGF overexpression on thymic architecture. (A) Representative image ( and ) of H&E-stained sections of formalin-fixed, paraffin-embedded thymus from -mo-old and Fgftg mice. Corticomedullary junctions (CMJ) are shown by red arrows. (B) Representative image ( ) of H&E-stained sections of formalin-fixed, paraffin-embedded thymus from -mo-old and Fgftg mice. The perithymic adipocytes in mice are similar to white adipocytes, whereas Fgftg mice show an increase in brown adipose tissue around the perithymic region. (C) Body weight at three different ages in male and female Fgf tg mice. (D) The macrophages with crystals were quantified by counting three sections each of and Fgftg mice (n = ). The overexpression of FGF reduces the amount of crystalline material in macrophages. (E) Electron micrographs of macrophages with crystalline material. (F) The quantification of FACS analysis from mtecs (Ly. MHCII + ) gated on CD EpCAM + cells in thymi of - to -mo-old and Fgftg mice. (G) Real-time PCR analysis of Aire, Betat, DLL, and RANK in thymi of -mo-old and Fgftg mice (n = ). The mrna expression was normalized to Gapdh and is shown as relative expression (ΔΔCt). Data are presented as means ± SEM, P <.. Youm et al. of

3 Thymocyte (million) number A B C month Fgf-/- month F G ETP (%gated) CD Naive H CD Naive Cell number (^) CD Naive Cell number (^) FgfTg CD E/M Cell number (^) m- m-fgftg CD E/M D CD CD CD CD CD CD CD CD month Fgf-/- month CD Naive E ETP (% gated) CD E/M P =. Fgf-/- Fgf-/ m- m-fgftg m- m-fgftg m- m-fgftg m- m-fgftg m- m-fgftg CD Naive Cell number (^) CD E/M Cell number (^) CD C/M Cell number (^) m- m-fgftg m- m-fgftg m- m-fgftg..... m- m-fgftg m- m-fgftg m- m-fgftg m- m-fgftg CD E/M Cell number (^) CD Naive Cell number (^) CD E/M Cell number (^) I CD Naive m- m-fgftg CD E/M.. CD Naive CD E/M m- m-fgftg m- m-fgftg m- m-fgftg J Cell number (^) Splenocyte Number P =. Fgftg Fig. S. Role of FGF on thymic development and peripheral T-cell repertoire. (A) The thymocytes from - to -mo-old and Fgftg mice (n = per group) were stained to identify ETPs (Lin lo CD + CD). There is a significant increase (P <.) in percent gated ETPs. (B) Representative FACS dot plots of thymocytes stained with CD and CD in -mo-old and Fgf / mice. (C) Total thymocyte number from -mo-old and Fgf / mice (n = ). (D) The thymocytes were stained with CD, CD CD, and CD and gated on CD- and CD-negative cells to identify thymocyte subsets. Ablation of Fgf does not affect T-cell development stages in thymus. (E) The frequency of Lin CD + CD ETPs in and FGF null mice at mo of age. (F and G) The cell subsets index and absolute number (in millions of cells) of naïve (CDL + CD and E/M (CDL CD hi ) CD and CD cells in -mo-old and Fgftg mice (n = per group). (H and I) The calculation of cell subsets and absolute number (in millions of cells) of naïve (CDL + CD and E/M (CDL CD hi ) CD and CD cells in -mo-old and Fgftg mice (n = per group). (J) The splenocyte number in -mo-old and FGF tg mice (n = ). Youm et al. of

4 A Vs Fgftg- CD+ T cells Perturbation (%) 9 CDR size TCR V families B TCR V CDR spectratyping profiles of CD+ T cells in month-old FGF Tg mouse BV BV BV. BV BV. BV. BV. BV BV BV. BV. BV. Tg Tg BV9 BV BV BV BV BV BV BV BV BV BV9 BV Tg Tg Fig. S. Impact of FGF overexpression on TCR repertoire. (A) The CD cells were sorted from spleen from and Fgf tg mice ( mo old) to prepare cdna that was used for TCR spectratyping. The CDR polymorphism analysis revealed that -mo-old Fgf tg mice do not displayed significant perturbation of TCR Legend continued on following page Youm et al. of

5 diversity. The D graph depicts perturbation in CD T cells. Each line crossing on the y axis of the landscape denotes change from splenic CD cells-specific CDR length or size (x axis) of a particular Vβ family (z axis). The perturbation in TCR diversity is shown as landscape surfaces, in which smooth (blue) landscapes show an unchanged TCR diversity. (B) The CD cells were sorted from spleen from and FGF tg mice ( mo old) to prepare cdna that was used for TCR spectratyping. TCR diversity of peripheral CD T cells was analyzed by measuring the distribution of lengths of the CDR of TCR. Representative TCR Vβ profile in aged mouse and polyclonal Gaussian distribution of CDR lengths in Fgftg mice. The data were generated using an ABI sequencer and analyzed using GeneMapper. Youm et al. of

6 A B CDSP CDSP C E MHCII LSK Flt+(% gated) CD EpCam mtec ctec mtec ctec F CD. CD. DP CD. CD Bone Marrow.% Bone Marrow.% % % FGF-/- FGF-/- Fgf-/- FGF-/- DN G CD. CD. % CD. % CD. CDL CD Thymocytes % Fgf-/- CD Thymocytes % CD.%.%.% month.% month Fgf-/- CD+ from CD. CD Fgf-/- CD D 9%.9% 9%.% Cell Subsets Index Index Subsets Cell H cells/ml) Number Cell (xe I Cell Number (xe cells/ml) P=. P=. Fgf-/- Fgf-/- P=. P=. FGF-/- FGF-/- Fgf-/- CD+ from CD. Ly Fig. S. Impact of FGF ablation on immune cell homeostasis. (A) The bone marrow cells were stained with Sca and c-kit and gated on lineage markers to identify HSC that are LSK. Compared with -mo-old mice, the frequency of LSKs was not affected in Fgf / mice (n = ). (B) The cell subsets index of thymocyte number from CDSP, CDSP, CD+CD+DP, and DN in -mo-old and Fgf / mice (n = ). (C) The representative FACS dot plots from splenocytes stained with CD, CDL, and CD in -mo-old and Fgf / mice (n = ). Ablation of FGF does not affect the frequency of naïve (CDL + CD ) or E/M cells (CDL CD hi ). (D) The cell subsets index of CD (CDL + CD ) naïve and E/M (CDL CD hi ) cells in -moold and Fgf / mice (n = ). (E) The FACS analysis of ctecs (Ly. + MHCII + ) and mtecs (Ly. MHCII + ) gated on CD EpCAM + cells in thymi of -mo-old and Fgf / mice (n = ). (F) The bone marrow cells from and Fgf / mice were stained with CD. (donor) and CD. (recipients) to investigate the percent chimerism following lethal irradiation and HSCT. Ablation of FGF does not affect bone marrow chimerism. (G I) The thymocytes from -mo-old and Fgf / mice were stained with CD. (for donor cells), CD. (for host cells), CD, and CD. The total thymocyte subset numbers gated on donor and host cells from young and Fgf / mice are shown (n = 9 per group). Youm et al. of

7 Table S. Primers and sequences used in the study Primers Forward to Reverse to Real-time PCR primers FGF CTGGGGGTCTACCAAGCATA CACCCAGGATTTGAATGACC FGFR CCAGTGCATCCATGAACTCTGGGGTTCTCC GGTCACACGGTTGGGTTTGTCCTTATCCAG FGFR TGCCACAGAGAAGGACCTGTCTGATCTGGT TGCCACAGAGAAGGACCTGTCTGATCTGGT FGFR GCGACAGGTGTCCTTGGAATCTAACTCCTC CCAATAGCTTCTGCCATGACCACCTGTCCA FGFR GACCAAACCAGCACCGTGGCTGTGAAGATG GTTTCCCTTGGCGGCACATTCCACAATCAC βklotho CTGGCTAAGGTTCAAGTACGGAGACCTCCC GGAGCTGAGCGATCACTAAGTGAATACGCA EVA GGCTGGCTTTCCCTGATGTAT TTAACCGAACATCTGTCCCGT IL GGGAGTGATTATGGGTGGTGAG TGCGGGAGGTGGGTGTAG FGF (KGF) TTGACAAACGAGGCAAAGTG CCCTTTGATTGCCACAATTC RT-PCR primers FGF TTCTTTGCCAACAGCCAGAT GTCCTCCAGCAGCAGTTCTC FGFr ACGGGGAGAATCGTATTGG TCCGAGGGTACCACACTTTC FGFr GAGCGACTTCCATAGCCAGA CATGGATGCACTGGAGTCAG FGFr CTGTGCACAAGCTGACCAAG GAGTTCATGGAGGAGCTGGA FGFr GAGCTACTTCCGAGCCTCCT ACTGAAGTGGCACAGCACAC βklotho TCCCCTGTGATTTCTCTTGG GGGGAGGAGACCGTAAACTC Youm et al. of