GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International

Transcription

1 Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray text fields available as needed to describe your protocol. The last page in not protected to allow for pictures and or comments that will not fit on the protected form. Thank you! Note to MAC users: to ensure your graphic can be viewed on a PC please follow the steps below when inserting the graphic into this document. DO NOT drag and drop or copy/paste the graphic into this document. Open the original graphic in the program that created it Choose File, Save As Select No Compression in the save options. Save as JPG or PNG or similar format that's compatible with both PC and Mac Word versions. Switch to Word, choose Insert, Picture, From File and choose the newly saved picture. These instructions are very generic. The menu options for your graphics program may be different. Donating Investigator/PI Bachmanov Alexander bachmanov@monell.org Institution Monell Chemical Senses Center Address 3500 Market street City Philadelphia Lab Contact Maria Theodorides State PA Zip theodorides@monell.org Telephone Strain Name 129P3.B6By-Tas1r3 FAX MMRRC Stock Number 36961

2 NAME OF PCR: MMRRC # 0 - Protocol: () Reagent/ Constituent Water 10x Buffer (contains / without 15mM MgCl 2 ) dntps (stock concentration is mm) Primer 1 (stock concentration is μm) Primer 2 (stock concentration is μm) Primer 3 (stock concentration is μm) Primer 4 (stock concentration is μm) Taq Polymerase Additives / Other (if applicable): DNA sample extracted NaOH Proteinase K Other: with TOTAL VOLUME OF REACTION: Comments on protocol (e.g., different concentration of MgCl 2, etc): Volume (μl) μl Strategy: Steps Temp ( o C ) Time (m:ss) # of Cycles 1. Initiation/Melting HOT START? 1 2. Denaturation 3. Annealing steps will cycle in sequence } 4. Elongation } 5. Amplification (i.e., 72 o C, 10 min) 1 6. Finish (i.e., 4 o C, indefinite) n/a n/a Primers: 1: 2: 3: 4: Name Electrophoresis Protocol: Agarose: % V: Estimated Running Time: Nucleotide Sequence (5' - 3') min. Primer Combination Band Genotype bp WT +/+ bp HET +/- bp KO or MT -/- SAMPLE GEL

3 Genotyping protocol for 129P3.B6By-Tas1r3 strain (#36961): This strain was produced by serial backcrossing of offspring from an intercross between the C57BL/6ByJ (B6) and 129P3/J (129) inbred strains onto the 129 strain and selection of mice carrying a fragment of B6 chromosome 4 including the Tas1r3 gene. As a result, the congenic mice have the genetic background of the 129 strain and a donor fragment of chromosome 4 containing the Tas1r3 gene from the B6 strain. The size of the donor fragment does not exceed 194 kb and encompasses, besides Tas1r3, several other genes that have been excluded as candidates for the Tas1r3 locus. We maintained 129.B6- Tas1r3 mice as a segregating congenic strain by mating congenic mice that have only one chromosome containing the B6 donor fragment (B6/129 genotype at the Tas1r3 locus) with 129 inbred mice. As a result, in each backcross generation we obtained mice with two different Tas1r3 genotypes: B6/129 heterozygotes (B6/129) and 129/129 homozygotes (129/129). Because the B6 allele of the Tas1r3 gene is dominant, B6/129 mice are phenotypically different from 129/129 mice. Genomic DNA of congenic mice was purified by standard techniques. Tas1r3 genotypes were determined with a TaqMan hybridization-based single nucleotide polymorphism (SNP) allelic discrimination assay (Life Technologies, Applied Biosystems, USA). The allelic discrimination assay was designed to genotype the SNP site rs in the exon 3 of the Tas1r3 gene. The reagents included primers (forward 5 -ATTGCACCCATTGAGCTCTCA-3 and reverse 5 -ACGTTTCCCGGTCACTTAGC-3 ) and allele-specific probes [5 -(VIC)-CATGCTGGCACTATA-(MGB)-3 for B6 allele and 5 -(FAM)- CATGCTGGCGCTATA-(MGB)-3 for 129 allele; base substitution at polymorphic site is underlined]. Each reaction contained 10 ng of genomic DNA, TaqMan Genotyping Master Mix (Life Technologies, Applied Biosystems, USA), 900 nm primers, and 50 nm probes in 25 ul. Real-time PCR and subsequent analysis were performed with the ABI Prism 7300 Sequence Detection System (Applied Biosystems) and the following conditions: 95 C for 10 min and then 40 cycles of amplification (92 C denaturation for 15 s, 60 C annealing/extension for 1 min). Context sequence: GGTCACTTAGCCGATCCATGCTGGC[A/G]CTATAGCTGACCTGTGGTGATCAAG

4 129P3/J homozygotes (129/129) C57BL/6ByJ/ 129P3/J heterozygotes (B6/129) C57BL/6ByJ homozygotes (B6/B6) NTC Figure 1. Allelic discrimination using allele specific probes for the Tas1R3 gene. After PCR amplification, end-point normalized fluorescent reporter signal (Rn) values for B6 (X-axis) and 129 (Y-axis) alleles were plotted using SDS software. A spot on the graph represents reading from the well. Rn plots for the samples formed three distinct clusters: 129/129 homozygote, B6/B6 homozygote, B6/129 heterozygote. NTC non-template control.

5 Sample Gel: SAMPLE GEL Lanes: 1. 1Kb+ ladder 2. H 2O 3. Wild-type +/+ sample 4-5. Hom -/- samples