A comparative study of the Barley yellow dwarf virus species PAV and PAS: distribution, accumulation and host resistance

Transcription

1 Doi: /j x A comparative study of the Barley yellow dwarf virus species PAV and PAS: distribution, accumulation and host resistance J. Jarošová a, J. Chrpová b,v.šíp b and J. K. Kundu a * a Department of Virology, Crop Research Institute, Drnovska 507, Prague; and b Department of Genetics and Plant Breeding Methods, Crop Research Institute, Drnovska 507, Prague, Czech Republic This study investigated the distribution and characteristics of the Barley yellow dwarf virus (BYDV) species BYDV-PAS, which was recently separated from BYDV-PAV, the most commonly studied BYDV species. Throughout 3 years of experimental monitoring of BYDV incidence, PAS was the most frequently occurring species infecting cereals and grasses in the Czech Republic. Furthermore, Rhopalosiphum maidis and Metopolophium dirhodum were recorded as BYDV-PAS vectors, even though M. dirhodum does not usually transmit BYDV-PAV. In field experiments with barley and wheat, where virus accumulation, symptoms and effect on the yield were tested, BYDV-PAV was more severe than PAS. Infection with the BYDV-PAV isolate resulted in greater expression of symptoms and also in a greater reduction in plant height and grain weight per spike than BYDV-PAS. In a sensitive cultivar of barley (Graciosa), the amount of viral RNA of BYDV-PAV was also significantly higher than that of BYDV-PAS. In a tolerant line (Wbon-123), however, no such differences were found. In conclusion, although BYDV-PAS seems to be dominant in the Czech Republic, BYDV-PAV has the potential to cause more significant crop losses in barley and wheat. Keywords: barley, Barley yellow dwarf virus, PAS, PAV, resistance, wheat Introduction Barley yellow dwarf (BYD) is one of the most widespread and damaging viral diseases of grasses and cereal crops worldwide (D Arcy, 1995). The disease is caused by a group of related single-stranded RNA viruses assigned to the Luteovirus (Barley yellow dwarf virus (BYDV) spp. PAV, PAS, MAV and GAV) or Polerovirus (Cereal yellow dwarf virus-rpv) genera, or those unassigned to a genus (BYDV-SGV, BYDV-RMV and BYDV-GPV) in the family Luteoviridae (Miller & Rasochova, 1997). The virus is phloem-restricted and transmitted in a persistent manner, but with variable effectiveness, by many aphid species (Slykhuis, 1967). The BYDV species vary strongly in symptom manifestation, aphid transmission efficiency, host preferences and in their serological and molecular properties. PAV is the best studied BYDV, especially at the molecular level. It is also assumed to be the most widespread (D Arcy, 1995) and usually causes the most severe symptoms in most of the cereal crops. High PAV incidence is claimed to be caused by high transmission efficiency and a vector with a broad host range (McElhany * jiban@vurv.cz Published online date 28 May 2012 et al., 1995; Power & Gray, 1995). Previously, only PAV isolates were identified in the Czech Republic on the basis of serological detection, but the presence of BYDV-PAS and BYDV-MAV species was recently identified (Kundu, 2008, 2009). BYDV-PAS (type isolate PAV-129) was recently separated from PAV (Mayo, 2002). As these two species were indistinguishable by serological methods, molecular diagnostic methods such as RT-PCR-RFLP (Kundu et al., 2009) and sequencing were used to this end. Sequence analysis of BYDV field isolates conducted in the Czech Republic revealed that BYDV-PAS and -MAV were the most frequent isolates, whereas BYDV- PAV seemed to be less frequent in cereal crops (Kundu et al., 2009). Barley yellow dwarf virus (BYDV) induces yield losses ranging from 5 to 80%, with an average of 30% in affected fields (Perry et al., 2000). BYDV has caused significant yield losses over recent decades, particularly in winter crops, and PAV was regarded as the only species occurring in the Czech Republic (Vacke, 1991). The most effective and sustainable control method is the use of genetic resistance tolerance to the virus complex (Henry et al., 2002). In barley, the semidominant resistance gene Yd2, which was detected in a land race of Ethiopian origin, provides the most efficient protection against different BYDV isolates (Lister & Ranieri, 1995). This gene has also been transferred to several spring and winter barley cultivars and lines (Burnett et al., 1995; Ovesná et al., 436 ª 2012 The Authors Plant Pathology ª 2012 BSPP

2 Comparative study of BYDV-PAV and -PAS ; Šíp et al., 2004). Two resistance sources, Bdv1 (Singh et al., 1993) derived from the Brazilian spring wheat cultivar Forntana and Bdv2 (Banks et al., 1995) from Thinopyrum intermedium, have been described in wheat genotypes (Henry et al., 2002). Evaluation of resistance sources carrying these genes (Bdv1 and Bdv2) in central European conditions (Veškrna et al., 2009) suggested the polygenic nature of BYDV resistance. Similar results were obtained with wheat populations segregating for the Bdv1 gene (Ayala et al., 2002). Most resistance studies to date have used PAV, as it was regarded as the most prevalent and detrimental to yields of the BYDV species (Vacke et al., 1996; Ovesná et al., 2000; Balaji et al., 2003; Jefferies et al., 2003). However, several reports have suggested that PAS may cause resistance breaking in spring oat (Chay et al., 1996). The aim of this study was to investigate the two most frequently occurring BYDV species in the Czech Republic, PAS and PAV, in particular (i) the incidence of these BYDV species in cereal and grass hosts and aphid vectors in agroecosystems, (ii) the quantitative analysis of viral titre of these species in susceptible and tolerant hosts, and (iii) the resistance of winter wheat and barley to these species. Materials and methods Survey of BYDV in host plants and aphid vectors Samples of cereals, grass weeds and wild grass species, as well as aphids, were collected from 2008 to 2010 randomly. The monitoring took place during the growth season (April to November) all over the Czech Republic. In all cases, only one mixed sample was collected from each field either the plants with the most symptoms or the plants with the highest aphid incidence. Aphids were found on plant leaves, stems or in the spikes by visual inspection. For each sample, the following information was collected: (i) origin; (ii) plant species; (iii) aphid species (if applicable); (iv) date of collection; (v) season of crop sowing (autumn or spring); and (vi) volunteer plant (if applicable). Plant leaves were collected and transported on ice to the laboratories, where they were immediately used for diagnostic tests, or were ground and stored at )80 C. Aphids were collected from cereals and grasses into Petri dishes using a thin paintbrush and were transported to an insect-proof greenhouse, where they were transferred onto healthy barley seedlings (cv. Sebastian). An average sample consisted of approximately 20 aphids collected from one field balk meadow. An additional sample from an identical area consisting of about 10 aphids was also collected and conserved in 70% ethanol in a 1Æ5- ml Eppendorf tube. The aphids were allowed to feed and reproduce on the seedling for a period of 28 days. Leaf samples were then collected and tested for the presence of BYDV by both DAS-ELISA and RT-PCR. In case of discordant results, a second test and a test with the reserve aphids sample were performed. The BYDV-positive samples were further tested by RT-PCR-RFLP according to Kundu et al. (2009) so that the BYDV species could be identified. BYDV polyclonal antibodies (Sediag) were used in DAS-ELISA (Clark & Adams, 1977) to detect the virus in leaf tissues of cereals and grasses. Samples for ELISA were prepared by grinding 1 g leaf tissue in phosphate buffered saline, ph 7Æ4, with 2% polyvinylpyrrolidone and 0Æ2% egg albumin in a ratio of 1:20. Microplates were read using a MR 5000 Dynatech reader at 405 nm. For RT-PCR, plant samples were processed according to Kundu et al. (2009). Aphid samples were first cleared of the ethanol in which they were stored. Next, they were homogenized with a sterilized minishaker (using pellet pestles and a cordless motor; Sigma) in 10 ll lysis buffer from the MasterPure Complete DNA and RNA Purification Kit (Epicentre) in a 1Æ5-mL Eppendorf tube. After the homogenization, total nucleic acids were purified from the sample using the extraction kit mentioned above according to the manufacturer s instructions. RT-PCR and RFLP analyses were then carried out as described for the plant samples. Quantitative analysis of the BYDV titre by real-time RT-qPCR A winter barley cultivar, Graciosa, and the line Wbon- 123 were sown in early autumn (September) 2009 in a small-scale field experiment. Three square plots (each plot 1 m 2 ) were set up in two replicates, each with 100 plants (50 Graciosa plants and 50 Wbon-123 plants). One of the three plots represented BYDV-PAV infection, another BYDV-PAS infection and the third the healthy control. The plots were covered by insect-proof net isolators (1 m 2 1m 2 ). When the plants were at the growth stage where two leaves (beginning of tillering Feekes 2Æ0) were unfolded, they were infected with BYDV-PAS (isolate PS-RuJK, accession number EU863652) and BYDV-PAV (isolate Blatno85, accession number FJ645745) species by vector transmission. For each plant, approximately five viruliferous Rhopalosiphum padi aphids were allowed to feed on the plant for 2 days. Afterwards, the plants were treated with insecticide, Perfekthion (Dimethoate) at 0Æ6 Lh )1. At the time of symptom manifestation (early November), 20 randomly chosen plants were collected from each plot, and the green part of the plants (excluding root) was used for the analysis. The plants were ground in liquid nitrogen and 100 mg of the material used for RNA extraction. The RNA was isolated with a SpectrumÔ Plant Total RNA Kit (Sigma-Aldrich) according to the manufacturer s instructions. The concentration and purity of the isolated RNA was then measured spectrophotometrically. The viral titre was determined by RT-qPCR analysis according to Jarošová & Kundu (2010). Real-time PCR was performed using a 7300 Real-Time PCR system (Applied Biosystems). For analysis with SYBR Green I,

3 438 J. Jarošová et al. the PCR cycling consisted of three steps: a 2-min incubation at 95 C followed by 40 cycles of 95 C for 15 s and 60 C for 60 s; the conditions of the final dissociation curve were as follows: 95 C for 15 s, 60 C for 60 s and 95 C for 15 s. The PCR mastermix composed of the primers (1 ll primer pair mix of 10 lm primer pair stock), 12Æ5 ll of 2 Power Sybr Green Master mix (Applied Biosystems) and sterile nuclease-free water was added to a final volume of 20 ll. Finally, 5 ll cdna was added to this mixture. Three reference genes (GAPDH, TUBB and 18S rrna) were used to normalize the quantification as recommended and described in Jarošová & Kundu (2010). Results were analysed using STATISTICA v. 9 (Stat- Soft) and EXCEL (Microsoft). The values from the 20 plants representing one group (e.g. Graciosa infected with BYDV-PAV) were evaluated as a statistical data set by explorative data analysis (EDA) to test for a normal distribution. The statistical program used for EDA was QC.EXPERT V. 2.5 running graphical tests and tests of normality. When normality was ruled out, a Box Cox transformation of the data was carried out and a two-way ANOVA was then performed using the program STATISTICA. All statistical analyses were performed at the 0Æ05 level of probability. Resistance test of wheat varieties to PAS and PAV under field conditions A comparative study was performed to determine the level of resistance of these traits to both the PAV and PAS species. Ten barley (Wbon-116, Wbon-123, Doria, Wysor, Sigra, Finesse, Traminer, Perry, Luran and Graciosa) and 10 wheat (PSR 3628, Svitava, Dromos, Sparta, Banquet, Roane, Sisson, Meritto, Vlada and SG- S 2703) cultivars and breeding lines with different levels of resistance ranging from tolerant (containing the Yd2 gene in barley) to the most susceptible were selected. Winter barley cultivars and lines (Wysor, Doria, Wbon- 116 and Wbon-123) containing the Yd2 gene were included. The selection of winter wheat varieties was based on previous experiments during as described in Veškrna et al. (2009). The resistance levels of winter barley and wheat to infection by BYDV-PAV (isolate Blatno85) and BYDV-PAS (isolate PS-RuJK) was studied in field experiments running for over 2 years ( and ). These experiments had both infected and healthy variants and were carried out according to the methods described by Vacke et al. (1996). The plants were grown on two-row 1- m-long plots, each with two replicates (plant spacing 6 22 cm). The plant materials were infected with the PAV and PAS species of BYDV at tiller initiation (Feekes 2Æ0) using viruliferous R. padi greenhouse-reared aphids. Their inoculation access periods lasted 5 7 days and the aphids were then killed by insecticide, Perferthion (Dimethoate) at 0Æ6 Lh )1. To avoid infection by fungal diseases (e.g. powdery mildew, rusts, leaf spot diseases), fungicide Tango Super (Epoxiconazole, Fenpropiomorph) was applied at 1 L h )1 at the stage of flag leaf emergence GS39 (Zadoks et al., 1974). At the full flowering stage symptoms of BYDV infection were evaluated on a scale of 0 9 (where 0 represents no symptoms) developed by Schaller & Qualset (1980). At harvest, 20 randomly selected plants from close stands in each of the infected and control plots were evaluated for visual symptom score (VSS), plant height reduction (PHR) and grain weight per spike (GWS; to determine the percentage reduction in GWS as a result of infection, GWSR). The UNISTAT v. 5.0 package (UNISTAT Ltd.) was used for statistical analyses of the data. The mean trait values across varieties were compared using the least significant difference (LSD) method at the 0Æ05 level of probability. Simple correlation coefficients between responses of cultivars to BYDV-PAS and BYDV-PAV in the characters examined were calculated for different environmental conditions. Results Survey of BYDV species in hosts and vectors Of the 285 plant samples collected (Table 1), 151 were BYDV-positive. The most prevalent BYDV species was BYDV-PAS, detected in 66% of the cases (total number of samples, n = 99), followed by MAV with 18% (n =27 samples) and PAV with 17% (n = 25 samples). The PAS and PAV species were found on all the cultivated species (with the exception of Panicum miliaceum), and they were also present on Bromus spp., Festuca spp., Lolium multiflorum, Arrhenatherum elatius and Avena fatua. MAV showed quite high incidence in oat (33% of all samples), wheat, barley and millet plants. However, MAV was not found in corn or in weed species. The incidence of BYDV did not seem to be influenced by the plant species, region of the Czech Republic, or time of sowing (spring vs winter cereals) (Table 2). However, BYDV incidence was twice as high in volunteer plants (70%) than in culti- Table 1 Distribution of Barley yellow dwarf virus (BYDV) species in plants sampled Plant species Number of tested samples Number of BYDVpositive samples PAS PAV MAV Triticum aestivum Hordeum vulgare Panicum miliaceum Festuca spp Elytrigia repens Echinochloa crus-galli Lolium multiflorum Arrhenatherum elatius Bromus spp Avena sativa Avena fatua Zea mays Total number of plants Percentage Æ5 6Æ5 18

4 Comparative study of BYDV-PAV and -PAS 439 Table 2 Percentage distribution of individual Barley yellow dwarf virus (BYDV) species in field samples Incidence of BYDV species Sampling PAV (%) PAS (%) MAV (%) BYDV-negative Winter cereals Spring cereals including corn Permanent grasses Volunteer plants vs non-volunteer plants 7 vs vs 62 0 vs 20 vated or wild species (36%). The majority of BYDV infection in volunteer plants was associated with BYDV-PAS, which comprised 93% of all BYDV infections in volunteer plants (Table 2). During the 3 years of monitoring, approximately 300 samples of aphids were collected; of these, 285 samples survived and reproduced on barley seedlings. The four aphid species R. padi, Sitobion avenae, Rhopalosiphum maidis and Metopolophium dirhodum were found on the cereals or other Poaceae species (Triticum aestivum, Hordeum vulgare, Avena sativa, Zea mays, Bromus spp., Festuca spp., Elytrigia repens). The most prevalent aphid species were S. avenae and R. padi. In 2008 and 2010, the majority ( 70%) of samples collected were S. avenae, whereas in 2009, R. padi was the most prevalent. R. maidis and M. dirhodum were the least prevalent species during all years surveyed, constituting 5 and 6% of the total on average (Table 3). There was a seasonal pattern in the spread of aphid species. For example, in the summer S. avenae was the main species observed in the fields, whereas in the autumn, especially in late autumn months, R. padi prevailed. All colonized barley plants were tested 1 month later by both DAS-ELISA and RT-PCR. A total of 232 aphid colonies were BYDV-free and 53 aphid colonies were BYDV-positive. The infectivity of the aphids collected from the fields was therefore lower than 20%. For individual years, the infectivity of the aphids varied from a maximum of 33% in 2008 to a minimum of 13% in The most prevalent BYDV species was BYDV- PAS, with 85% of all positive BYDV cases; followed by BYDV-PAV (11%) and BYDV-MAV (4%). Sitobion avenae was the only aphid species that was found as the vector of BYDV-MAV. Rhopalosiphum padi and S. avenae were able to transmit BYDV-PAV. The four aphid species identified were found to be BYDV-PAS vectors (Table 3). No significant correlations were found between aphid species and plant species. Table 3 Incidence of aphid species sampled and of Barley yellow dwarf virus (BYDV) species among aphid samples Percentage BYDV species Aphid species abundance (%) MAV (%) PAS (%) PAV (%) Rhopalosiphum padi Sitobion avenae Rhopalosiphum maidis Metopolophium dirhodum Not determined 10 At the time of symptom manifestation, symptoms appeared clearly in cv. Graciosa, but no symptoms were found in line Wbon-123. The symptoms caused by PAV were noticeably more severe than those caused by PAS (Fig. 1). Viral titres were determined by RT-qPCR and the efficiency ranged between 97% and 101% for the reference genes and target genes (Table 4). Relative values and results are shown in Table 5. Statistical differences were recorded between the two barley cultivars lines for both species titres. In both cases, the viral titre in Graciosa was much higher than in Wbon-123. In the sensitive variety, the viral titres of BYDV-PAV and BYDV-PAS Quantitative analysis of BYDV uptake in winter barley Figure 1 Symptoms of Barley yellow dwarf virus (BYDV)-PAS and -PAV on winter barley cv. Graciosa (sensitive to BYDV) and line Wbon-123 (carrier of the Yd2 resistance gene) in a small-scale outdoor field experiment approximately 40 days after infection.

5 440 J. Jarošová et al. Table 4 Characteristics of gene-specific real-time RT-PCR Gene symbol Gene name Accession no. Primer sequence (5 fi3 ) Amplicon size PCR efficiency (%) GAPDH Glyceraldehyde-3-phosphate dehydrogenase LOC Forward: TGTCCATGCCATGACTGCAA Reverse: CCAGTGCTGCTTGGAATGATG TUBB b-tubulin U76897 Forward: CAAGGAGGTGGACGAGCAGATG Reverse: GACTTGACGTTGTTGGGGATCCA 18S rrna 18S ribosomal RNA M82356 Forward: GTGACGGGTGACGGAGAATT Reverse: GACACTAATGCGCCCGGTAT BYDV cp Coat protein of BYDV EF Forward: GTTGAGTTTAAGTCACACGC Reverse: TGTTGAGGAGTCTACCTATTTG also differed greatly. In contrast, differences in viral titres within the resistant line were not significant. In the sensitive variety, however, the viral titre of BYDV-PAV was approximately twice that of BYDV-PAS. Comparison of BYDV-PAS and BYDV-PAV for resistance traits Significant differences were found between BYDV species in all tested traits. In fact, using the BYDV-PAV isolate resulted in higher disease severity and also in a greater reduction in plant height and grain weight per spike. In general, high levels of resistance were recorded in winter barley breeding lines (Wbon-116, Wbon-123) and cultivars (Wysor, Doria) containing the Yd2 gene resistant to both PAV and PAS. The winter wheat breeding line PSR 3628, a hybrid of wheat and couch grass, was highly resistant to both tested BYDV species. Cultivars Svitava, Dromos, Sparta and Banquet were regarded as moderately resistant in the test. It was noted that the use of two species, namely the cultivars carrying the Yd2 gene in barley and the line PSR 3628 in wheat, allowed the detection of the sources of resistance for all the tested traits. The detection of susceptible cultivars lines of barley and wheat was also confirmed with both BYDV species (Table 6). A significant and positive correlation between symptom scores (VSS), reduction in plant height and reduction in grain weight per spike was detected in both years. The correlation between infections with BYDV-PAS and BYDV-PAV was especially tight for symptom scores (r =0Æ83, P <0Æ001 and 0Æ91, P <0Æ001, respectively), but also highly significant for reductions of grain weight per spike and plant height (r ranging from 0Æ54, P <0Æ01 to 0Æ87, P <0Æ001) (Table 7). Discussion BYDV-PAS (type isolate PAV-129) was recently separated from PAV (Mayo, 2002), but found to have a worldwide distribution the USA (Chay et al., 1996; Robertson & French, 2007), France (Mastari et al., 1998), Morocco (Bencharki et al., 1999), New Zealand (Delmiglio, 2008) and the Czech Republic (Kundu, 2008). This study confirms the previous findings that Table 5 Results of a two-way ANOVA analysis of Barley yellow dwarf virus (BYDV) viral titres in sensitive and tolerant barley varieties BYDV species Wbon-123 vs Graciosa Variety BYDV-PAV *** Wbon-123 ns BYDV-PAS *** Graciosa *** BYDV-PAV vs BYDV-PAS P > 0Æ05 was considered nonsignificant (ns), P < 0Æ01 as significant (*), P <0Æ001 as very significant (**) and P <0Æ0001 as extremely significant (***). BYDV-PAS is indeed the most prevalent BYDV species found in the Czech Republic (Kundu et al., 2009). BYDV- PAS was the most prevalent species during the 3 years monitored, but was especially prevalent in 2010, when the incidence of BYDV was the lowest of the 3 years. BYDV-PAV is generally accepted as being the most prevalent worldwide (Clement et al., 1986; Miller et al., 1988; Webby et al., 1993; Gourmet et al., 1996; Anderson et al., 1998, 2003; Ayala et al., 2001; Royer et al., 2005) because the most commonly employed method used for detection (DAS-ELISA) is not able to discriminate between BYDV-PAV and BYDV-PAS. Therefore, all the PAS isolates characterized could have been incorrectly considered to belong to BYDV-PAV. Mastari et al. (1998) reported an interesting distribution of the BYDV- PAV and -PAS groups between the host species they examined. Interestingly, 98% of the French isolates found in ryegrass belonged to the PAV group, whereas 83% of the French isolates present in barley contained the PAS virus. Most BYDV monitoring studies usually focus on cereals (rather than grasses generally) as they are economically more important and because plants with symptoms are easier to identify. In the present study, the majority of collected samples were also from cereals and only about 8% were from grasses. However, the three samples of ryegrass included in the study were infected with BYDV-PAV. Interestingly, the distribution of BYDV species in barley samples did not seem to be influenced by the plant species because it matched the general BYDV species distribution 69% of BYDV-positive samples belonged to BYDV-PAS, 17% were BYDV-MAV and 14% were BYDV-PAV. Furthermore, when all the grasses were taken as one group, the majority of BYDV-

6 Comparative study of BYDV-PAV and -PAS 441 Table 6 Comparison of Barley yellow dwarf virus (BYDV)-PAS and BYDV-PAV for resistance traits of wheat and barley varieties VSS a (%) PHR b (%) GWSR c (%) Crop Cultivar line PAS PAV PAS PAV PAS PAV Range Winter barley Wbon-116 (Yd2 gene) 1Æ50 a 2Æ75 ab 3Æ9 a 16Æ0 a 12Æ6 a 17Æ2 a 1Æ7 Wbon-123 (Yd2 gene) 1Æ38 a 2Æ13 a 5Æ3 a 16Æ4 a 23Æ4 ab 29Æ8 ab 2Æ3 Doria (Yd2 gene) 3Æ38 b 3Æ88 b 0Æ0 a 21Æ1 ab 17Æ4 a 23Æ8 a 3Æ0 Wysor (Yd2 gene) 1Æ63 a 2Æ13 a 9Æ0 ab 19Æ6 a 25Æ4 ab 17Æ8 a 3Æ2 Sigra 5Æ13 c 5Æ88 c 18Æ8 bc 35Æ3 bc 23Æ9 ab 31Æ3 ab 5Æ3 Finesse 4Æ88 c 6Æ25 cd 25Æ6 c 43Æ1 c 28Æ3 abc 44Æ2 b 6Æ8 Traminer 4Æ75 c 7Æ13 de 18Æ8 bc 40Æ4 c 36Æ3 bcd 65Æ1 c 6Æ8 Perry 5Æ88 cd 6Æ13 cd 21Æ5 c 43Æ2 c 48Æ1 de 62Æ7 c 7Æ7 Luran 6Æ75 de 7Æ88 ef 17Æ8 bc 49Æ4 c 54Æ8 e 73Æ2 cd 8Æ5 Graciosa 7Æ38 e 8Æ63 f 26Æ8 c 68Æ6 d 44Æ4 cde 84Æ0 d 9Æ7 Winter wheat PSR Æ75 a 1Æ17 a 4Æ3 a 1Æ8 a 3Æ0 a 8Æ0 a 1Æ0 Svitava 4Æ13 b 5Æ63 bcd 6Æ5 a 11Æ9 abc 35Æ4 bcd 48Æ2 b 3Æ8 Dromos 3Æ88 b 4Æ90 b 7Æ7 a 22Æ3 bcd 40Æ0 cd 43Æ5 b 4Æ0 Sparta 4Æ00 b 4Æ70 b 12Æ5 ab 11Æ0 ab 28Æ6 bc 51Æ7 b 4Æ0 Banquet 4Æ13 b 6Æ25 d 10Æ6 a 22Æ0 bcd 24Æ0 b 46Æ0 b 4Æ3 Roane 4Æ38 b 6Æ17 cd 7Æ4 a 27Æ8 d 37Æ1 bcd 57Æ0 b 6Æ3 Sisson 5Æ00 bc 6Æ58 d 11Æ4 ab 19Æ9 bcd 38Æ4 bcd 49Æ2 b 6Æ5 Meritto 4Æ38 b 5Æ20 bc 19Æ3 b 28Æ6 d 45Æ3 d 56Æ9 b 7Æ5 Vlada 6Æ38 cd 6Æ30 d 11Æ3 ab 26Æ1 cd 41Æ1 d 55Æ8 b 7Æ5 SG-S Æ25 d 7Æ92 e 31Æ8 c 47Æ8 e 64Æ1 e 76Æ9 c 10Æ0 Average 4Æ44 a 5Æ40 b 13Æ5 a 27Æ6 b 33Æ4 a 46Æ7 b a Average VSS (visual symptom score recorded on a scale of 0 9, where 0 represents no symptoms). b PHR: plant height reduction. c GWSR: reduction of grain weight per spike. Means in columns followed by the same letter are not significantly different from each other at P =0Æ05 in a LSD test. Table 7 Coefficients of correlation between examined resistance traits and Barley yellow dwarf virus (BYDV) species PAS and PAV across 20 plant genotypes in 2009 (above diagonal) and in 2010 (below) VSS-PAS VSS-PAV PHR-PAS PHR-PAV GWSR-PAS GWSR-PAV VSS-PAS 0Æ914*** 0Æ590** 0Æ496* 0Æ763*** 0Æ736*** VSS-PAV 0Æ834*** 0Æ724*** 0Æ626** 0Æ805*** 0Æ832*** PHR-PAS 0Æ628** 0Æ584** 0Æ853*** 0Æ612** 0Æ685*** PHR-PAV 0Æ898*** 0Æ841*** 0Æ586** 0Æ614** 0Æ795*** GWSR-PAS 0Æ608** 0Æ699*** 0Æ665*** 0Æ541** 0Æ874*** GWSR-PAV 0Æ669*** 0Æ851*** 0Æ622** 0Æ647** 0Æ774*** VSS: average visual symptom score recorded on a scale of 0 9, where 0 represents no symptoms; PHR: plant height reduction; GWSR: reduction of grain weight per spike. *, **, *** significant at P =0Æ05, P =0Æ01 and P =0Æ001, respectively. positive samples (63%) were infected with BYDV-PAS and only 38% were infected with BYDV-PAV. However, the correlations between host species and virus species cannot be confirmed from this study nor the study of Mastari et al. (1998). The high incidence of BYDV-PAS could be partly explained by the wide vector spectrum. Although the only aphid species in this study infectious to BYDV- MAV was S. avenae and BYDV-PAV was transmitted by R. padi and S. avenae, BYDV-PAS was transmitted by all four aphid species found on cereals. Peiffer et al. (1997) reported that R. padi, S. graminum, S. avenae and one biotype of M. dirhodum were able to transmit BYDV-PAV when injected with the virus. However, R. maidis did not transmit PAV, even when very high concentrations (200 lg ml )1, 4 ng PAV per aphid) were injected into aphids. The experiment was conducted with the NY-PAV isolate, which is now known to be a true PAV member (Mastari et al., 1998). In the present study, 5% of PAS isolates were transmitted by R. maidis and 9% by M. dirhodum. No PAV isolates transmitted by M. dirhodum were found. Therefore, the transmission of BYDV-PAS seems to be less vector-specific than the transmission of BYDV-PAV. However, the discrepancy in the incidence of the two species is orders of magnitude apart and cannot be explained only by a wider spectrum range of aphid vectors. In biological comparisons of PAV and PAS, Chay et al. (1996)

7 442 J. Jarošová et al. claimed that the efficiency of transmission by R. padi and S. avenae was not significantly different. Therefore, there may be an additional causal factor for the widespread incidence of BYDV-PAS. Differences in pathogenicity of the BYDV species could also explain the high prevalence of BYDV-PAS. Because the less aggressive species may cause fewer plant deaths, the reservoir of the virus may exponentially increase with time. In the studies presented here, viral titre analysis, together with symptom manifestation, revealed that PAV seemed more harmful than PAS to the sensitive plant variety. Furthermore, PAV caused more severe symptoms and a greater reduction in plant height and grain weight per spike in different genotypes in the field infection trials. These findings are in contrast to the findings of Chay et al. (1996) and Bencharki et al. (1999), who both reported that the PAS caused more severe symptoms when inoculated to a range of oat and barley genotypes. Both of these studies used spring varieties in greenhouses and growth chambers. In contrast, the tests in the present study were carried out on winter varieties in fields, where the effect of wintering also played a role. There was a significant difference between PAV and PAS in terms of resistance traits. Inoculation with the BYDV-PAV isolate resulted in higher disease severity and also in a greater reduction in plant height and grain weight per spike than the BYDV- PAS isolate. With both species of BYDV (cultivars carrying the Yd2 gene in barley and line PSR 3628 in wheat), the sources of resistance were recognized in all the tested traits. The high level of resistance to BYDV-PAV in PSR 3628 was described recently by Veškrna et al. (2009). The use of a more aggressive BYDV-PAV isolate led to better differentiation between the tested genotypes, especially for visual symptom score and reduction in plant height. The results obtained also suggested that differentiation between genotypes on the basis of their resistance to BYDV could be facilitated by using BYDV-PAV species because of its ability to cause greater disease severity than BYDV-PAS. From the results of this study, it is concluded that PAS is the most frequently occurring BYDV in this region. A significant difference in virus RNA accumulation between the PAS and PAV species was found. In susceptible plants, the viral titre of PAS was greater than that of PAV, whereas no significant differences were recorded in tolerant plants carrying the Yd2 resistance gene. PAV resulted in more severe symptoms and caused a greater reduction in plant height and yield than PAS. Finally, the level of resistance traits in winter barley and winter wheat was comparable for both PAS and PAV. Acknowledgements The authors would like to express their gratitude to Jindra Štolcová, Šárka Bártová, Zuzana Červená, Eva Svobodová, Jana Drabešová and Blanka Jaňourová for their excellent technical assistance. This work was supported by grants from the Ministry of Agriculture, Czech Republic from projects QH81269 (50%) and QH91158 (50%). References Anderson JM, Bucholtz DL, Greene AE et al., Characterization of wheatgrass-derived barley yellow dwarf virus resistance in a wheat alien chromosome substitution line. Phytopathology 88, Anderson GR, Papa D, Peng J, Tahir M, Lapitan NL, Genetic mapping of Dn7, a rye gene conferring resistance to the Russianwheataphidinwheat.Theoretical and Applied Genetics 107, Ayala L, van Ginkel M, Khairallah M, Keller B, Henry M, Expression of Thinopyru intermedium-derived Barley yellow dwarf virus resistance in elite bread wheat backgrounds. Phytopathology 91, Ayala L, Henry M, van Ginkel M, Singh R, Keller B, Khairallah M, Identification of QTLs for BYDV tolerance in bread wheat. Euphytica 128, Balaji B, Bucholtz DB, Anderson JM, Barley yellow dwarf virus and Cereal yellow dwarf virus quantification by real-time polymerase chain reaction in resistant and susceptible plants. Phytopathology 93, Banks PM, Larkin PJ, Bariana HS et al., The use of cell culture for subchromosomal introgressions of barley yellow dwarf virus resistance from Thinopyrum intermedium to wheat. Genome 38, BencharkiB,MuttererJ,ElYamaniM,Ziegler-GraffV,ZaouiD, Jonard G, Severity of infection of Moroccan barley yellow dwarf virus PAV isolates correlates with variability in their coat protein sequences. Annals of Applied Biology 134, Burnett PA, Comeau A, Qualset CO, Host plant tolerance or resistance for control of barley yellow dwarf. In: D Arcy CJ, Burnett PA, eds. Barley Yellow Dwarf: 40 Years of Progress. St Paul, MN, USA: APS Press, Chay CA, Smith DM, Vaughan R, Gray SM, Diversity among isolates within the PAV serotype of barley yellow dwarf virus. Phytopathology 86, Clark MF, Adams A, Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. Journal of General Virology 34, Clement DL, Lister RM, Foster JE, ELISA-based studies on the ecology and epidemiology of barley yellow dwarf virus in Indiana. Phytopathology 76, D Arcy CJ, Symptomology and host range of barley yellow dwarf. In: D Arcy CJ, Burnett PA, eds. Barley Yellow Dwarf: 40 Years of Progress.StPaul,MN,USA:APSPress,9 28. Delmiglio C, The Incidence and Phylogenetic Analysis of Viruses Infecting New Zealand s Native Grasses. Auckland, New Zealand: University of Auckland, PhD thesis. Gourmet C, Kolb FL, Smyth CA, Pedersen WL, Use of imidacloprid as a seed-treatment insecticide to control barley yellow dwarf virus (BYDV) in oat and wheat. Plant Disease 80, Henry M, Posadas G, Segura J, Rajaram S, Evaluating resistance to BYDV-PAV, BYDV-MAV, and CYDV-RPV in Thinopyrum intermedium-derived wheat lines. In: Henry M, McNab A, eds. Barley Yellow Dwarf Disease: Recent Advances and Future Strategies. Proceedings of an International

8 Comparative study of BYDV-PAV and -PAS 443 Symposium held at El Batán, Texcoco, Mexico, 1 5 September Texcoco, Mexico: CIMMYT, Jarošová J, Kundu JK, Validation of reference genes as internal control for studying viral infections in cereals by quantitative real-time RT-PCR. BMC Plant Biology 10, 146. JefferiesSP,KingBJ,BarrAR,WarnerP,LogueSJ,LangridgeP, Marker-assisted backcross introgression of the Yd2 gene conferring resistance to barley yellow dwarf virus in barley. Plant Breeding 122, Kundu JK, First report of Barley yellow dwarf virus-pas in wheat and barley grown in the Czech Republic. Plant Disease 92, Kundu JK, First report of Barley yellow dwarf virus-mav in oat, wheat, and barley grown in the Czech Republic. Plant Disease 93, 964. Kundu JK, Jarošová J, Gadiou S, Cervená G, Discrimination of three BYDV species by one-step RT-PCR-RFLP and sequence based methods in cereal plants from the Czech Republic. Cereal Research Communications 37, Lister R, Ranieri R, Distribution and economic importance of barley yellow dwarf. In: D Arcy CJ, Burnett PA, eds. Barley Yellow Dwarf: 40 Years of Progress.StPaul,MN,USA:APS Press, Mastari J, Lapierre H, Dessens JT, Asymmetrical distribution of barley yellow dwarf virus PAV variants between host plant species. Phytopathology 88, Mayo M, ICTV at the Paris ICV: results of the plenary session and the binomial ballot. Archives of Virology 147, McElhany P, Real LA, Power AG, Vector preference and disease dynamics: a study of barley yellow dwarf virus. Ecology 76, Miller WA, Rasochova L, Barley yellow dwarf viruses. Annual Review of Phytopathology 35, Miller WA, Waterhouse PM, Gerlach WL, Sequence and organization of barley yellow dwarf virus genomic RNA. Nucleic Acids Research 16, Ovesná J, Vacke J, Kučera L, Chrpová J, Novaková I, Jahoor A, Genetic analysis of resistance in barley to barley yellow dwarf virus. Plant Breeding 119, Peiffer ML, Gildow FE, Gray SM, Two distinct mechanisms regulate luteovirus transmission efficiency and specificity at the aphid salivary gland. Journal of General Virology 78, Perry KL, Kolb FL, Sammons B, Lawson C, Cisar G, Ohm H, Yield effects of Barley yellow dwarf virus in soft red winter wheat. Phytopathology 90, Power A, Gray S, Aphid transmission of barley yellow dwarf viruses: interactions between viruses, vectors, and host plants. In: D Arcy CJ, Burnett PA, eds. Barley Yellow Dwarf: 40 Years of Progress. St Paul, MN, USA: APS Press, Robertson NL, French R, Genetic structure in natural populations of barley cereal yellow dwarf virus isolates from Alaska. Archives of Virology 152, Royer TA, Giles KL, Nyamanzi T et al., Economic evaluation of the effects of planting date and application rate of imidacloprid for management of cereal aphids and barley yellow dwarf in winter wheat. Journal of Economic Entomology 98, Schaller C, Qualset C, Breeding for resistance to barley yellow dwarf virus. In: Proceedings of the Third International Wheat Conference, Madrid, Spain. University of Nebraska Agricultural Experiment Station, Public MP 41, Singh R, Burnett P, Albarran M, Bdv1: a gene for tolerance to barley yellow dwarf virus in bread wheats. Crop Science 33, Šíp V, Chrpová J, Vacke J, Ovesná J, Possibility of exploiting the Yd2 resistance to BYDV in spring barley breeding. Plant Breeding 123, Slykhuis J, Virus diseases of cereals. Review of Applied Mycology 46, Vacke J, Výroční Zpráva. Prague, Czech Republic: Výzkumný Ústav Rostlinné Výroby. Vacke J, Šíp V, Skorpik M, Response of selected spring wheat varieties to the infection with barley yellow dwarf virus. Genetika a Slechteni-UZPI (Czech Republic) 32, Veškrna O, Chrpová J, ŠípV,Sedláček T, Horčička P, Reaction of wheat varieties to infection with barley yellow dwarf virus and prospects for resistance breeding. Czech Journal of Genetics and Plant Breeding 45, Webby GN, Lister RM, Burnett PA, The occurrence of barley yellow dwarf viruses in CIMMYT bread wheat nurseries and associated cereal crops during Annals of Applied Biology 123, Zadoks JC, Chang TT, Konzak CF, Decimal code for growth stages of cereals. Weed Research 15,